MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-052L09
Chromosome	X (Build37)
Map Location	50,132,155 - 50,133,284
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Usp26, LOC100040479, LOC665888, 1700080O16Rik, LOC100040495, Gpc4, Gpc3, Kis2, LOC100041925
Downstream gene	LOC665929, 6330534C20Rik, LOC624936, LOC546298, LOC100040569, Phf6, Hprt1, C430049B03Rik, Plac1, 4632404H22Rik, 4930432H15Rik, LOC385527, Mospd1, LOC100040609, Etd, Cxx1c, LOC100040644, Cxx1a, Cxx1b, AW822252, 4930502E18Rik, 1700013H16Rik, EG547172, Zfp36l3, Xlr, LOC100040719, LOC100040730
Link	Open Mouse BAC browser

Click to get alignment info.

name	Usp26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83563 MGI:1933247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC665888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700080O16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74279 MGI:1921529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100040495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Gpc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14735 MGI:104902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14734 MGI:104903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kis2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:751866 MGI:3617487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 235 ESTs, 9 Proteins pseudo : _no_value

name	LOC665929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	6330534C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434778 MGI:3588225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins pseudo : _no_value

name	LOC546298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 mRNAs, 2934 ESTs, 9 Proteins

name	LOC100040569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Phf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70998 MGI:1918248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hprt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15452 MGI:96217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C430049B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72575 MGI:1924903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Plac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56096 MGI:1926287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632404H22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78755 MGI:1926005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930432H15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73866 MGI:1921116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mospd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70380 MGI:1917630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040609 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 45 Proteins pseudo : _no_value

name	Etd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69501 MGI:1916751
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxx1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72865 MGI:1920115
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040644 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040644
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cxx1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66158 MGI:1913408
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cxx1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:553127 MGI:3576504
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	AW822252 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331578 MGI:2148030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	4930502E18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75013 MGI:1922263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700013H16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75514 MGI:1922764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	EG547172 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547172 MGI:3646091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Zfp36l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333473 MGI:3525151
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22441 MGI:98976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040719 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 9 Proteins

name	LOC100040730 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040730
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Usp26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878220 GeneID:83563 MGI:1933247
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 26 transcript_id : NM_031388.1

name	LOC100040479 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271539 GeneID:100040479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100040479 transcript_id : XM_001474763.1

name	1700080O16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407367 GeneID:74279 MGI:1921529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700080O16 gene transcript_id : XM_135858.3

name	LOC100040495 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271541 GeneID:100040495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to 1700080O16Rik protein transcript_id : XM_001474805.1

name	Gpc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680058 GeneID:14735 MGI:104902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 4 transcript_id : NM_008150.1

name	Gpc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980679 GeneID:14734 MGI:104903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 3 transcript_id : NM_016697.2

name	6330534C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702180 GeneID:434778 MGI:3588225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330534C20 gene transcript_id : NM_001034059.1

name	LOC546298 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271562 GeneID:546298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 mRNAs, 2934 ESTs, 9 Proteins product : similar to ribosomal protein S2 transcript_id : XM_001477049.1

name	LOC100040569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271543 GeneID:100040569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100040569 transcript_id : XM_001474921.1

name	Phf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563291 GeneID:70998 MGI:1918248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 6 transcript_id : NM_027642.1

name	Hprt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:96975137 GeneID:15452 MGI:96217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxanthine guanine phosphoribosyl transferase 1 transcript_id : NM_013556.2

name	C430049B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407371 GeneID:72575 MGI:1924903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA C430049B03 gene transcript_id : XM_980571.1

name	Plac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360115 GeneID:56096 MGI:1926287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placental specific protein 1 transcript_id : NM_019538.4

name	4632404H22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348852 GeneID:78755 MGI:1926005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632404H22 gene transcript_id : NM_030167.2

name	4930432H15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888240 GeneID:73866 MGI:1921116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432H15 gene transcript_id : NM_028671.2

name	Mospd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802204 GeneID:70380 MGI:1917630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : motile sperm domain containing 1 transcript_id : NM_027409.2

name	Etd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31341018 GeneID:69501 MGI:1916751
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : embryonic testis differentiation transcript_id : NM_175147.2

name	Cxx1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270961 GeneID:72865 MGI:1920115
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAAX box 1 homolog C (human) transcript_id : NM_028375.3

name	Cxx1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21313589 GeneID:66158 MGI:1913408
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAAX box 1 homolog A (human) transcript_id : NM_024170.1

name	Cxx1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65787324 GeneID:553127 MGI:3576504
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CAAX box 1 homolog B (human) transcript_id : NM_001018063.1

name	AW822252 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271601 GeneID:331578 MGI:2148030
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AW822252 transcript_id : XM_001474711.1

name	4930502E18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626043 GeneID:75013 MGI:1922263
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930502E18 gene transcript_id : NM_029142.1

name	1700013H16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271603 GeneID:75514 MGI:1922764
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 1700013H16 gene transcript_id : XM_135430.4

name	EG547172 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001197 GeneID:547172 MGI:3646091
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG547172 transcript_id : XM_622034.2

name	Zfp36l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57222289 GeneID:333473 MGI:3525151
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 36, C3H type-like 3 transcript_id : NM_001009549.1

name	Xlr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357146 GeneID:22441 MGI:98976
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated complex transcript_id : NM_011725.3

name	LOC100040719 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271612 GeneID:100040719
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 9 Proteins product : similar to X-linked lymphocyte-regulated protein pM1 transcript_id : XM_001475126.1

name	LOC100040479 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271540 GeneID:100040479
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474813.1

name	LOC100040495 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271542 GeneID:100040495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474855.1

name	1700080O16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407368 GeneID:74279 MGI:1921529
definition	codon_start : 1 product : hypothetical protein LOC74279 protein_id : XP_135858.2

name	Gpc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680059 CCDS:CCDS30124.1 GeneID:14735 MGI:104902
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glypican 4 protein_id : NP_032176.1

name	Gpc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980680 CCDS:CCDS30125.1 GeneID:14734 MGI:104903
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IGI]; GO:0045926 - negative regulation of growth [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0030513 - positive regulation of BMP signaling pathway [Evidence IMP]; GO:0001658 - ureteric bud branching [Evidence IGI] codon_start : 1 product : glypican 3 protein_id : NP_057906.2

name	6330534C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702181 CCDS:CCDS30126.1 GeneID:434778 MGI:3588225
definition	codon_start : 1 product : hypothetical protein LOC434778 protein_id : NP_001029231.1

name	LOC546298 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271563 GeneID:546298
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477099.1

name	LOC100040569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271544 GeneID:100040569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474971.1

name	Phf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563292 CCDS:CCDS30127.1 GeneID:70998 MGI:1918248
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD finger protein 6 protein_id : NP_081918.1

name	Hprt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:96975138 GeneID:15452 MGI:96217
definition	EC_number : 2.4.2.8 GO_component : GO:0005737 - cytoplasm [Evidence IEA] [Evidence IDA] GO_function : GO:0004422 - hypoxanthine phosphoribosyltransferase activity [Evidence IDA] [Evidence IMP]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0046083 - adenine metabolism [Evidence IMP] [Evidence IGI]; GO:0006168 - adenine salvage [Evidence IMP]; GO:0007610 - behavior [Evidence IMP]; GO:0021954 - central nervous system neuron development [Evidence IMP]; GO:0021895 - cerebral cortex neuron differentiation [Evidence IMP]; GO:0019835 - cytolysis [Evidence IMP]; GO:0048813 - dendrite morphogenesis [Evidence IMP]; GO:0042417 - dopamine metabolism [Evidence IMP]; GO:0007625 - grooming behavior [Evidence IGI]; GO:0006178 - guanine salvage [Evidence IMP]; GO:0046100 - hypoxanthine metabolism [Evidence IMP] [Evidence IC]; GO:0046651 - lymphocyte proliferation [Evidence IMP]; GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0045964 - positive regulation of dopamine metabolism [Evidence IMP]; GO:0006164 - purine nucleotide biosynthesis [Evidence IMP]; GO:0006166 - purine ribonucleoside salvage [Evidence IMP] [Evidence IGI]; GO:0001975 - response to amphetamine [Evidence IMP]; GO:0021756 - striatum development [Evidence IMP] codon_start : 1 product : hypoxanthine guanine phosphoribosyl transferase 1 protein_id : NP_038584.2

name	C430049B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407372 GeneID:72575 MGI:1924903
definition	codon_start : 1 product : hypothetical protein LOC72575 protein_id : XP_985665.1

name	Plac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506575 CCDS:CCDS30128.1 GeneID:56096 MGI:1926287
definition	codon_start : 1 note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 26 product : placental specific protein 1 protein_id : NP_062411.1

name	4632404H22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313466 CCDS:CCDS30129.1 GeneID:78755 MGI:1926005
definition	codon_start : 1 product : hypothetical protein LOC78755 protein_id : NP_084443.1

name	4930432H15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312034 GeneID:73866 MGI:1921116
definition	codon_start : 1 product : hypothetical protein LOC73866 protein_id : NP_082947.1

name	Mospd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312580 CCDS:CCDS30131.1 GeneID:70380 MGI:1917630
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : motile sperm domain containing 1 protein_id : NP_081685.1

name	Etd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28201997 GeneID:69501 MGI:1916751
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : embryonic testis differentiation-associated product : embryonic testis differentiation protein_id : NP_780356.1

name	Cxx1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386306 GeneID:72865 MGI:1920115
definition	codon_start : 1 note : mammalian retrotransposon derived 8a product : CAAX box 1 homolog C protein_id : NP_082651.1

name	Cxx1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313590 CCDS:CCDS30134.1 GeneID:66158 MGI:1913408
definition	codon_start : 1 product : mammalian retrotransposon derived 8b protein_id : NP_077132.1

name	Cxx1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:65787325 CCDS:CCDS30135.1 GeneID:553127 MGI:3576504
definition	codon_start : 1 note : mammalian retrotransposon derived 8c product : CAAX box 1 homolog B protein_id : NP_001018073.1

name	AW822252 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271602 GeneID:331578 MGI:2148030
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474761.1

name	4930502E18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626044 CCDS:CCDS30136.1 GeneID:75013 MGI:1922263
definition	codon_start : 1 product : hypothetical protein LOC75013 protein_id : NP_083418.1

name	1700013H16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20946689 GeneID:75514 MGI:1922764
definition	codon_start : 1 product : hypothetical protein LOC75514 protein_id : XP_135430.1

name	EG547172 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001198 GeneID:547172 MGI:3646091
definition	codon_start : 1 product : similar to 60S ribosomal protein L38 protein_id : XP_622034.2

name	Zfp36l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:57222290 CCDS:CCDS30138.1 GeneID:333473 MGI:3525151
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger protein 36-like 3 protein_id : NP_001009549.1

name	Xlr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756021 CCDS:CCDS30139.1 GeneID:22441 MGI:98976
definition	codon_start : 1 note : X-linked gene family of B-cell surface antigens product : X-linked lymphocyte-regulated protein pM1 protein_id : NP_035855.1

name	LOC100040719 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271613 GeneID:100040719
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475176.1

name	LOC665888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665888
definition	number : 1 pseudo : _no_value

name	LOC665929 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665929
definition	number : 1 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 1 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 2 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 3 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 4 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 5 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 6 pseudo : _no_value

name	LOC385527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385527
definition	number : 1 pseudo : _no_value

name	LOC385527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385527
definition	number : 2 pseudo : _no_value

name	LOC100040644 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040644
definition	number : 1 pseudo : _no_value

name	LOC100040644 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040644
definition	number : 2 pseudo : _no_value

name	LOC100040644 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040644
definition	number : 3 pseudo : _no_value

name	LOC100040730 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040730
definition	number : 1 pseudo : _no_value

name	Kis2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:114796628 GeneID:751866 MGI:3617487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kaplan integration site 2 transcript_id : NR_003188.1

name	LOC100041925 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271561 GeneID:100041925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 235 ESTs, 9 Proteins product : similar to ribosomal protein S17 pseudo : _no_value transcript_id : XR_033016.1

name	LOC100040609 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271545 GeneID:100040609
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 45 Proteins product : similar to casein kinase 1, gamma 3 pseudo : _no_value transcript_id : XR_032024.1

clone name	MSMg01-133A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366E13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-177A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524D24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-505G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-353D22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-342J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-075F15
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-245E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068K23
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-052L09.b	B6Ng01-052L09.g
ACC	DH875981	DH875982
length	1,114	1,102
definition	DH875981\|Mus musculus domesticus DNA, BAC clone: B6Ng01-052L09, 5' end.	DH875982\|Mus musculus domesticus DNA, BAC clone: B6Ng01-052L09, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttactatacacataatgcagaaagacagcttcaatcaggaaatg aaattttatgagagtaatagatgaacaaggaagagtccagaagaaatcca tcatgcctgacacagtaaaccagcaaaattcccctactaataactgagaa agaaaagatcaaacaatagttcaaccaaccagaaaaacaaccaacaaaat ttttcaaattactgaccatctctccataataactttaaacaatcaaaaaa aaaaaaccaaaaaacaaaccaaacaagaaaactttaaacaaaatggccgc aggtcaccaataaagagatatggactcctaatttcaggaagcaaataata atgtacatacaatatcaaatgatttcattactccactctcacataacata gacaggttctagattacaaagcaaatcttaatgtgtaagattcttttgta tcttatagggtcatagtggactaaactaggaatgagtaactagagaaatg atataaatatatggagactgaatgatgcatcgctgagtgactgagaggtc attgaagatatcatggaggacatttaataattcctagtattaaatgaaag ggaaagcatagtcacacagccattggaagaagttaacagttctaagaggt tttggctgacttaagacttttacttgtatcctctttaaggtcagcaatca catctaccagtaaacttttgaagtatttatcctgtgttttccctatctca gtaaactattgaaatctctggaatttagtaactgtatttgaaatcataga gatcccaaataaataacataaggatggacctcaagggcttagaaaagcaa gaacaaagcaaatccaaaaagtagtagacagcaagaaatataaagttcaa ggcaagaattaataaatggaggggagggggctggagagatggctcggcgg ataagagcactgactgctcttctgaagtcctgagtcaatcccagcaacac atggtggctcacacaccgtaatgagatctgatgcctctttctggtgcgtt tgaagtagctacagtgtacttattatatatcatcttaaagaataataaat tgagctaaagagca	gaattcctagaggctttcagggatagagcaaatgggagaatgagattgac gcccttataggattgcagggattgagcaaaatgtaaaaattgagatagga ggcttccttgaggcttgcagggatagagcaaaatgggagaatgacataga cttcctataggattgctggatagagcaagatgcaagacttgagataggct ggcagggatagagcaagatgggagaatgagataggagacttcctagaggc ttacagggacagagcaagatgggagacttgagataggtttcctaaaggcc tatagcgagagatgaagataggagacttgagataggagacttcctagaga cttgctgggattgagtaagatgggagtttgagataggagaattcctagag gtgtgcagtgatagagcaagatgggagaataagataccagaattcctaga cccttgtatggagagagcaagatgggagtctgaaatagcagacttccaag agattttcaggtatagagcaagatgggagactagagataggaggcttcct agaggcttgtaagaatagaacaagatgggagtctgagataggaggctttc taaagacttgcagggatagagcaagatgggagtctgaaataggaggattc ctagaggcttggagggatagagcaagttgggagtctgagataggaggctt cctaagggctttcagggatagagcaatatgggagtttgagataggaggat tcctagaggtttgcagggatagagcaagatgggagaacgaggtaggagaa ttcctagagtcttgcagggatagagcaagatgggagtctgaaatagcaga cttccctagagatttaaaggatagagcaaatgggagacttgagataggag gcatcctagagacttgcagtttagaacaagatgggagtctgagataggag gcttcctaaaggcttgcagggatagagaaagatccgagaatgagataagg tacttcctatagacttgcaggatgagtaaaatggggagacatgagatagg aacttcctagagtcctgccaggatagagcagatgggaattcgaacgggag ga
quality values	Open. Hide. 61 30 28 40 61 61 61 61 61 61 61 47 61 61 61 40 61 39 61 61 61 61 55 61 49 55 61 37 43 43 37 52 27 28 36 36 43 59 59 59 61 61 59 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 59 55 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 59 52 61 52 61 59 59 59 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 55 55 52 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 55 61 50 61 55 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 52 61 47 50 61 61 61 43 61 61 61 61 61 61 61 61 52 61 61 61 61 53 61 61 61 61 61 61 61 45 61 47 42 33 61 61 61 61 61 61 61 53 61 52 53 61 61 47 42 57 57 53 47 57 57 50 50 53 57 53 47 53 53 57 57 53 53 53 47 53 53 57 57 52 53 57 57 53 57 42 57 53 47 57 53 57 47 47 47 53 52 52 38 53 53 43 53 57 42 57 45 57 50 53 53 53 45 57 57 57 52 57 53 28 57 57 36 37 41 47 53 53 53 53 53 57 53 52 37 57 45 57 39 30 22 53 57 57 57 37 33 52 53 52 52 52 57 50 53 36 57 45 57 57 57 53 37 53 50 53 53 30 41 47 53 53 39 53 42 57 37 45 45 28 30 10 53 45 42 50 40 45 37 38 27 57 39 53 53 50 30 46 35 38 43 42 40 46 37 37 38 57 57 57 38 40 53 42 37 27 32 57 53 37 50 39 44 38 57 30 53 50 57 57 40 39 38 33 34 38 33 37 36 42 36 36 37 29 57 31 32 35 40 33 38 38 28 57 20 29 53 34 48 37 57 40 33 33 40 57 38 37 32 32 44 34 37 33 53 25 24 33 34 46 43 43 57 37 31 37 31 41 41 18 57 35 28 36 26 53 44 29 34 27 31 41 57 20 29 31 25 35 31 32 23 41 30 41 28 29 26 29 28 14 31 29 29 31 11 23 46 17 27 20 48 32 16 38 51 45 44 24 30 21 13 17 29 41 29 14 47 41 18 35 31 51 23 25 31 39 25 51 51 46 38 28 28 33 19 22 38 22 29 20 21 28 29 20 33 28 29 36 29 22 46 24 20 46 29 28 31 25 28 14 18 27 29 12 5 36 25 28 29 14 33 13 22 29 30 51 24 24 29 28 29 26 51 51 15 27 17 46 46 46 29 27 29 26 27 29 13 36 14 29 12 32 21 11 25 27 27 9 26 10 14 29 19 14 36 10 43 7 28 17 20 11 14 29 22 29 26 17 17 21 26 17 23 15 12 16 7 7 5 8 7 18 31 36 15 46 19 27 26 28 30 31 22 14 6 24 20 14 44 7 21 14 14 33 20 11 17 27 22 25 20 15 11 9 6 5 25 32 11 26 17 32 16 20 14 12 26 25 26 22 23 17 17 25 34 22 17 16 8 38 18 9 13 28 38 8 26 18 17 28 38 17 19 23 8 6 5 6 6 9 28 12 28 8 29 13 27 11 8 14 5 14 9 4 4 4 5 8 4 30 7 4 6 4 4 6 17 11 35 44 5 16 17 14 24 6 6 14 42 30 9 13 9 14 4 12 6 6 34 7 5 3 3 5 11	Open. Hide. 61 61 43 47 61 61 50 34 24 17 22 19 22 23 49 41 61 47 37 52 61 61 49 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 59 61 61 61 61 61 59 59 59 55 59 49 59 59 59 61 59 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 47 61 61 61 61 61 61 61 61 61 61 61 52 61 61 53 61 61 50 61 61 61 61 61 61 50 53 61 61 50 43 39 61 61 61 61 53 61 61 61 52 61 61 61 61 61 61 61 61 61 61 42 61 61 61 61 53 61 52 61 53 61 61 61 43 52 61 61 61 53 53 53 46 57 53 53 57 53 53 52 53 36 37 47 47 53 57 52 53 47 47 57 47 53 57 45 53 57 53 52 53 53 46 52 57 57 57 57 42 53 53 57 53 57 45 53 45 50 37 53 47 33 53 30 53 53 57 53 50 53 53 45 45 53 47 52 53 53 53 42 42 47 57 36 32 53 50 53 47 47 53 53 52 38 32 57 57 47 53 30 53 53 57 43 57 47 32 52 34 38 47 47 17 41 34 27 47 34 53 53 53 38 47 33 52 42 45 53 53 37 52 50 57 47 31 31 52 38 57 50 45 45 57 50 50 53 53 57 37 52 39 50 40 40 50 53 40 39 28 41 18 27 50 12 26 23 50 42 50 50 38 25 37 24 42 46 42 29 52 50 31 17 24 53 57 20 22 38 37 53 42 42 35 33 38 32 37 57 57 53 53 30 32 57 53 42 41 29 33 20 40 21 53 37 17 45 36 24 26 20 33 33 52 36 40 28 41 28 57 29 36 30 24 52 57 47 37 33 40 33 53 30 33 26 21 28 29 18 48 57 33 53 31 35 16 37 15 29 23 28 27 41 13 53 32 22 53 28 47 34 28 38 17 17 23 53 24 33 37 28 30 12 17 19 21 45 44 29 29 33 29 31 14 27 24 33 29 29 19 47 44 15 33 23 21 24 29 32 34 51 25 27 29 19 40 31 12 29 23 29 33 13 29 16 13 21 22 33 24 34 24 51 51 13 45 6 46 43 23 20 24 24 29 24 29 29 33 23 8 25 30 26 29 19 32 28 14 31 32 23 12 20 28 18 27 21 29 26 32 14 16 34 30 39 28 35 27 38 14 25 30 14 39 41 34 19 16 7 51 10 23 15 29 27 16 14 26 25 23 10 39 51 17 26 15 24 29 12 14 29 13 29 14 22 33 14 23 23 26 13 23 24 18 31 23 32 41 20 21 27 14 34 15 20 15 20 28 51 26 15 20 28 18 9 7 20 38 17 17 29 25 19 30 12 29 23 28 29 21 33 27 17 7 5 5 7 30 36 13 22 28 9 23 8 19 23 12 7 6 15 15 23 33 19 9 9 7 24 25 14 6 5 5 6 11 12 22 23 28 25 19 34 35 11 11 5 10 7 6 19 33 30 12 14 17 14 20 6 6 6 15 16 28 16 28 10 22 6 18 11 9 12 5 16 17 9 6 7 29 29 30 7 17 8 6 5 23 19 11 6 5 20 26 18 26 6 11 6 14 5 9 9 5 6 9 8 5 5 5 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_50132155_50133284
seq2: B6Ng01-052L09.b_45_1158

seq1  GAATTCTTACTATACACATAATGCAGAAAGACAGCTTCAATCAGGAAATG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTACTATACACATAATGCAGAAAGACAGCTTCAATCAGGAAATG  50

seq1  AAATTTTATGAGAGTAATAGATGAACAAGGAAGAGTCCAGAAGAAATCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTTTATGAGAGTAATAGATGAACAAGGAAGAGTCCAGAAGAAATCCA  100

seq1  TCATGCCTGACACAGTAAACCAGCAAAATTCCCCTACTAATAACTGAGAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGCCTGACACAGTAAACCAGCAAAATTCCCCTACTAATAACTGAGAA  150

seq1  AGAAAAGATCAAACAATAGTTCAACCAACCAGAAAAACAACCAACAAAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAGATCAAACAATAGTTCAACCAACCAGAAAAACAACCAACAAAAT  200

seq1  TTTTCAAATTACTGACCATCTCTCCATAATAACTTTAAACAATCAAAAAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCAAATTACTGACCATCTCTCCATAATAACTTTAAACAATCAAAAAA  250

seq1  AAAAAACCAAAAAACAAACCAAACAAGAAAACTTTAAACAAAATGGCCGC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAACCAAAAAACAAACCAAACAAGAAAACTTTAAACAAAATGGCCGC  300

seq1  AGGTCACCAATAAAGAGATATGGACTCCTAATTTCAGGAAGCAAATAATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCACCAATAAAGAGATATGGACTCCTAATTTCAGGAAGCAAATAATA  350

seq1  ATGTACATACAATATCAAATGATTTCATTACTCCACTCTCACATAACATA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTACATACAATATCAAATGATTTCATTACTCCACTCTCACATAACATA  400

seq1  GACAGGTTCTAGATTACAAAGCAAATCTTAATGTGTAAGATTCTTTTGTA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGTTCTAGATTACAAAGCAAATCTTAATGTGTAAGATTCTTTTGTA  450

seq1  TCTTATAGGGTCATAGTGGACTAAACTAGGAATGAGTAACTAGAGAAATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATAGGGTCATAGTGGACTAAACTAGGAATGAGTAACTAGAGAAATG  500

seq1  ATATAAATATATGGAGACTGAATGATGCATCGCTGAGTGACTGAGAGGTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAATATATGGAGACTGAATGATGCATCGCTGAGTGACTGAGAGGTC  550

seq1  ATTGAAGATATCATGGAGGACATTTAATAATTCCTAGTATTAAATGAAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGAAGATATCATGGAGGACATTTAATAATTCCTAGTATTAAATGAAAG  600

seq1  GGAAAGCATAGTCACACAGCCATTGGAAGAAGTTAACAGTTCTAAGAGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAGCATAGTCACACAGCCATTGGAAGAAGTTAACAGTTCTAAGAGGT  650

seq1  TTTGGCTGACTTAAGACTTTTACTTGTATCCTCTTTAAGGTCAGCAATCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGCTGACTTAAGACTTTTACTTGTATCCTCTTTAAGGTCAGCAATCA  700

seq1  CATCTACCAGTAAACTTTTGAAGTATTTATCCTGTGTTTTCCCTATCTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTACCAGTAAACTTTTGAAGTATTTATCCTGTGTTTTCCCTATCTCA  750

seq1  GTAAACTATTGAAATCTCTGGAATTTAGTAACTGTATTTGAAATCATAGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACTATTGAAATCTCTGGAATTTAGTAACTGTATTTGAAATCATAGA  800

seq1  GATCCCAAATAAATAACATAAGGATGGACCTCAAGGGCTTAGAAAAGCAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCCCAAATAAATAACATAAGGATGGACCTCAAGGGCTTAGAAAAGCAA  850

seq1  GAACAAAGCAAATCCAAAAAGTAGTAGACAGCAAGAAATAATAAAGTTCA  900
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  GAACAAAGCAAATCCAAAAAGTAGTAGACAGCAAGAAAT-ATAAAGTTCA  899

seq1  AGGCAAGAATTAATAAATGGAGGGGAGGGGGCTGGAGAGATGGCTCGGCG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAAGAATTAATAAATGGAGGGGAGGGGGCTGGAGAGATGGCTCGGCG  949

seq1  GATAAGAGCACTGACTGCTCTTCTGAAGGTCCTGAGTTCAAATCCCAGCA  1000
      ||||||||||||||||||||||||||| |||||||||   ||||||||||
seq2  GATAAGAGCACTGACTGCTCTTCTGAA-GTCCTGAGT--CAATCCCAGCA  996

seq1  ACCACATGGTGGCTCACAACCACCCGTAATGAGATCTGATGCCTCTTTCT  1050
      | ||||||||||||||||  || |||||||||||||||||||||||||||
seq2  A-CACATGGTGGCTCACA--CA-CCGTAATGAGATCTGATGCCTCTTTCT  1042

seq1  GGTGCGTTTGAAGATAGCTACAGTGTACTTATGTATAATAATAAATCTTA  1100
      ||||||||||||| |||||||||||||||||| ||| |||    ||||||
seq2  GGTGCGTTTGAAG-TAGCTACAGTGTACTTAT-TAT-ATA--TCATCTTA  1087

seq1  AAAAATAATAAAATGGAAGCTAAAAGAGCA  1130
      || ||||||||| ||  |||| ||||||||
seq2  AAGAATAATAAATTG--AGCT-AAAGAGCA  1114

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information