MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-055G18
Chromosome	X (Build37)
Map Location	78,349,968 - 78,351,142
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC654474, LOC629153, LOC546338, LOC100042229, LOC667776, EG629182, Tmem47
Downstream gene	LOC100041462, LOC100041474, 4930595M18Rik, EG667799
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC654474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654474
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC629153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546338
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	LOC100042229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC667776 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 462 ESTs, 14 Proteins pseudo : _no_value

name	EG629182 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629182 MGI:3648228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Tmem47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192216 MGI:2177570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930595M18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245492 MGI:3045300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667799 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667799 MGI:3648640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 626 ESTs, 21 Proteins pseudo : _no_value

name	LOC100042229 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271787 GeneID:100042229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042229 transcript_id : XM_001477903.1

name	Tmem47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270284 GeneID:192216 MGI:2177570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 47 transcript_id : NM_138751.1

name	Tmem47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365049 GeneID:192216 MGI:2177570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 47 transcript_id : NM_175771.3

name	LOC100041462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271724 GeneID:100041462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to synaptosomal-associated protein 23 transcript_id : XM_001476422.1

name	4930595M18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382854 GeneID:245492 MGI:3045300
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930595M18 gene transcript_id : NM_173435.2

name	LOC100042229 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271788 GeneID:100042229
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477953.1

name	Tmem47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270285 CCDS:CCDS30254.1 GeneID:192216 MGI:2177570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 10 product : transmembrane protein 47 protein_id : NP_620090.1

name	Tmem47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28461139 CCDS:CCDS30254.1 GeneID:192216 MGI:2177570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 10 product : transmembrane protein 47 protein_id : NP_786965.1

name	LOC100041462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271725 GeneID:100041462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476472.1

name	4930595M18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734114 GeneID:245492 MGI:3045300
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245492 protein_id : NP_775611.1

name	LOC629153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629153
definition	number : 1 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 4 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 3 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 2 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 1 pseudo : _no_value

name	EG667799 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667799
definition	number : 1 pseudo : _no_value

name	LOC667776 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271789 GeneID:667776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 462 ESTs, 14 Proteins product : similar to Non-POU-domain-containing, octamer binding protein pseudo : _no_value transcript_id : XR_033448.1

name	EG629182 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271790 GeneID:629182 MGI:3648228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG629182 pseudo : _no_value transcript_id : XR_033453.1

clone name	MSMg01-548G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296D08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-131M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243O10
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-055G18.b	B6Ng01-055G18.g
ACC	DH877874	DH877875
length	1,163	1,107
definition	DH877874\|Mus musculus domesticus DNA, BAC clone: B6Ng01-055G18, 5' end.	DH877875\|Mus musculus domesticus DNA, BAC clone: B6Ng01-055G18, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcattattcttgacatcttattaatactttattgtgtaaatgtatc acattttgattattcatctaccagttgatgaatgggtaaacctttccatg tcttggcttttatgaatagagcagcaatgaacaaggatgagcaagtgtct ctgtaaggatcatgtcatatatagatagtcctttggatatatgatctgtg tttcactattttgtaggcatttactaatcaaatcaaattgacaatcaaaa tttagcaccataccatccttccatgcagttttaataaagttttctttcct attgtcccactaaatgttacagacatttgtaccttaataatataggctac tgacaatagaaatttactttttttcttaattgaaaacatttagtttaaat tggagacaaaagtgatatgggttcctgcatgaattgtttatattagccac aaaatttattgcccaatatcttactctatattttaatacactatattatt aataacagtgcaaggctattatattagcaattttactttgaaatcttaat tcacttcacagtataagatagagttataactatgctctcatccaatatta taagacccatggactctgagcttacatctttatcaacatctagtaccaca gatacagacacagttttgtgttcatgtctagaaataatagaactgaatga tgggtaaattttaaaagtatgtgaaacacttaggaagcagaaatgtctgc aaatcagtgtgtgtgtgtacatatatgcatgaacatgtgtccatttgaat caaagagaaagactaacatctggaacacaggaacaaggacagcttgagga ttgttcatcatcatgaaaatatgttggccttgacagaatttggtattatg gatgagtatttgggagaaattgagtactctgtctacaatgcttgctcaac agattaagttcatggatttactggtaataaaagaagtctctggaccatgt aagggattgcagaagcatagcttttgttgctggctattttatacattaat gcatcttcaaacaaattattttctgctctgcttggagaggagatttttct tgtcatgagtgaatggagatactgacttgctgactttcctcacgtggata aagatgacttatt	gaattccttctttatgtcctctaccatcatcatgagatatgcttttaaat ccaggtctaccttttcaggtgtgttagggtgtcctggattgggcgaagtg ggcgttctgggttctgatgatggtgagtggtcctggcttctgttagtagg attcttacgtttacctttcgccatctggcaatctctggagttagttgtta tagttgtctttgttaaaagattgttcctctgttgattttgttaccctcta tcagcaggcgtgggagacaagctctcttctctgagtttcagtggtcagag cagtctctgtaggcaagctctcctctctcagggaaggtgtacagttatct ggtgtttggacctcctcctggctgaaggtgaaggcccaaaacaggatctt tcccagaagctgtgttgctttggccaggaaggtggccagttgtctggagt cgaagatgttgccgcctcagaagctctgtggctcttgccgggaaggtggc tggttgtctggagctgaagatggtgccgccccagaatctctgtgactctc tcacccgtcccagaaacggctggcactctgtattccacacggtcacccgt gcagcctgccctccgcggagtcccggagccaagaaggctcccgccggcgc ctgtgccacaaacctctcaggccaggcagacccccgtgctctcaccagga aggtggccggctgtctggagctgaagatggcgccgcccagaagctctgca actctctcgcccgtcccagaaacggctggcactctgtattcccacacggt cacccgtgcagcctgccctccgcggagtcccggagccaagaaaggctccc gcccgcgcctgtgccacaaactctccagccaggcagacccccgtgctctc acaagaaagtgccggctgtctggagctgatgatggcgccgcccagagctc tgcgattctctcgcccgtccagaaacggctggcacttgtattcacacggt ccccgtgcacttgccctcgcggagttccggagccaagaaggctcccgttg ctcctgtccacaatctcttcaggcaggaagaccccgttcctataccagga aagtgtc
quality values	Open. Hide. 61 41 29 35 61 36 28 61 61 50 61 61 61 61 61 47 61 55 43 61 61 55 61 61 61 61 19 20 30 23 33 20 35 49 43 59 55 37 59 59 61 61 61 61 59 59 61 59 61 59 59 59 59 61 61 59 59 61 61 61 61 61 61 61 59 59 59 55 55 59 59 59 59 35 37 59 55 34 44 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 55 59 61 61 61 61 61 61 59 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 55 61 61 61 61 61 61 61 61 61 55 61 50 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 53 61 61 61 61 52 61 43 61 61 53 61 53 61 61 61 43 57 57 57 57 57 57 53 53 57 57 57 57 57 53 53 57 57 57 57 57 52 57 53 40 38 57 50 53 47 40 53 53 53 57 53 57 36 57 53 50 57 57 57 53 57 57 57 57 57 57 42 57 57 43 38 53 42 53 57 57 57 53 40 36 47 42 53 53 38 47 57 53 53 53 53 53 50 57 50 53 53 41 52 53 50 57 38 32 53 52 30 47 43 50 57 57 57 57 52 53 37 22 53 53 30 23 52 52 53 52 42 52 53 52 30 45 43 53 53 43 34 53 45 40 53 53 52 34 21 24 20 10 16 18 57 40 53 57 43 36 57 52 40 43 52 41 57 27 45 29 33 40 38 53 34 57 46 47 30 50 57 53 50 42 52 57 52 38 52 25 16 34 57 19 34 53 32 53 50 38 34 33 57 47 38 36 21 24 53 52 40 42 48 48 42 40 37 52 42 28 36 17 45 41 42 42 42 39 37 31 32 37 40 33 31 20 48 44 37 44 40 35 53 28 57 39 33 25 35 30 28 35 37 47 37 37 53 33 39 57 44 22 31 19 22 23 40 30 24 30 41 37 48 19 28 37 33 23 40 24 19 30 29 24 29 30 12 19 30 29 32 25 29 31 39 19 38 29 15 10 19 12 5 7 7 29 36 31 29 31 30 36 39 22 27 28 28 51 47 30 21 27 29 30 36 23 16 34 25 29 16 9 13 20 28 16 17 46 15 25 51 32 34 47 19 20 26 11 29 21 29 29 28 23 26 30 10 11 14 24 51 28 33 51 28 29 13 28 51 38 21 25 33 34 15 27 11 10 20 35 20 33 22 33 31 20 23 5 31 29 43 22 29 16 26 19 15 46 11 23 28 25 13 15 8 24 17 28 9 14 28 28 7 7 20 24 31 19 51 10 26 18 17 15 29 8 33 19 12 33 51 51 28 17 17 33 12 20 34 23 33 25 33 15 34 22 30 19 20 26 26 22 33 10 29 10 9 5 4 8 17 10 7 22 38 14 33 14 20 24 13 12 7 8 5 12 14 14 8 11 38 19 20 20 13 28 19 27 44 39 21 11 8 6 10 6 11 17 15 23 19 21 6 4 4 6 5 6 8 23 33 13 11 6 14 15 5 4 7 14 44 44 16 11 8 7 13 12 17 24 18 12 15 18 5 7 24 8 17 6 17 5 8 11 5 5 12 18 16 12 7 7 13 6 5 4 4 10 6 4 5 5 7 15 5 7 10 9 13 15 16 10 5 5 24 9 11 17 15 23 23 9 8 20 17 12 31 9 20 10 5 8 8 9 4 4 12 7 21 11 26 27 11 6 22 4 5 5 4 7 6 5 5 8	Open. Hide. 55 61 49 61 61 61 43 43 49 52 36 49 52 27 17 24 36 59 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 49 49 36 55 59 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 52 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 52 61 61 61 61 61 61 61 59 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 49 61 61 61 61 61 61 61 55 61 61 55 55 55 61 55 52 52 61 61 61 61 61 61 61 55 55 55 55 43 55 55 52 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 50 61 61 55 61 41 47 47 61 61 61 61 55 61 61 61 61 61 49 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 50 61 61 40 47 40 61 61 53 61 61 47 19 43 53 61 61 61 61 61 61 61 61 61 50 61 61 39 61 40 61 61 47 61 52 61 53 61 61 61 61 61 35 61 61 53 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 50 52 52 53 52 53 52 61 61 61 24 61 41 46 52 45 47 45 53 61 37 27 47 53 53 53 47 57 52 38 36 51 57 53 52 53 53 53 39 47 31 47 34 53 52 53 39 47 53 47 34 42 53 53 53 53 28 53 50 53 52 53 47 47 50 47 42 28 53 57 25 47 52 53 57 33 53 53 23 57 28 43 30 14 42 10 53 53 47 39 30 36 31 18 57 52 27 50 53 52 47 28 47 36 37 34 42 30 53 53 45 53 52 50 53 42 40 24 40 22 26 16 10 45 30 42 25 41 13 50 50 45 39 39 27 53 40 52 45 45 41 30 42 43 52 26 35 46 38 17 23 12 31 41 18 29 36 53 30 52 53 34 30 41 45 22 37 24 38 50 28 53 18 11 24 16 33 50 24 14 16 11 9 31 53 26 24 14 53 53 12 37 53 42 38 29 34 26 25 24 31 20 31 30 50 42 27 37 53 31 24 32 29 33 32 31 12 28 46 22 30 14 33 14 40 42 40 18 25 21 33 36 40 53 37 23 19 15 6 23 12 12 28 34 31 15 34 33 37 31 31 45 40 25 27 29 21 9 6 16 15 7 19 24 53 48 36 44 43 16 16 25 28 40 10 27 27 28 23 17 26 47 10 30 43 25 47 7 21 47 25 25 35 14 29 30 28 27 24 23 39 5 37 15 15 18 11 15 17 7 8 19 30 24 30 18 13 6 15 11 7 12 6 5 8 13 5 24 28 14 29 16 14 6 37 17 30 31 30 29 17 12 23 14 29 18 11 7 11 19 12 15 34 18 33 14 29 9 30 8 25 16 25 6 11 35 30 20 29 41 14 18 14 18 28 20 17 6 7 18 11 19 29 11 8 20 13 12 21 37 29 20 19 39 15 29 25 19 20 13 10 5 26 8 6 10 11 15 27 17 14 18 41 17 28 29 22 28 12 12 32 36 23 10 14 18 6 13 15 31 13 26 23 12 6 6 8 15 23 31 34 9 14 27 24 18 11 11 11 5 7 14 25 20 26 7 9 6 6 11 25 29 29 6 16 19 7 10 15 9 23 6 17 6 15 8 6 7 13 6 23 13 28 25 7 8 36 14 28 7 8 9 14 15 14 10 8 30 6 7 13 17 6 9 7 15 7 6 5 11 24 8 13 6 8 8 10 8 7 8 9 7 5 18 7 7 6 5 15 19 30 19 8 5 4 4 4 8 12 5 5 5 7 5 11 13 12 25 30 8 18 5 16 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_78349968_78351142
seq2: B6Ng01-055G18.b_47_1209 (reverse)

seq1  AATAAGTCATCTTTTATCACAGTGAGGAAAGGTCAGCAAGTCAGTAATCC  50
      ||||||||||| ||||||   ||||||||| |||||||||||||||   |
seq2  AATAAGTCATC-TTTATCCACGTGAGGAAA-GTCAGCAAGTCAGTA--TC  46

seq1  TCCATTCACTCACTGAC-AGAAATATCCTCCTTCCTTCCAAAGCAGAGCA  99
      |||||||||||| |||| ||||| |||     ||||  | ||||||||||
seq2  TCCATTCACTCA-TGACAAGAAAAATC-----TCCTCTCCAAGCAGAGCA  90

seq1  GAAAAATGATTTGTTTG-AGATTGGCATTAATGTATAAAATAGCCAGGCA  148
      | ||||| ||||||||| ||||  |||||||||||||||||||||||  |
seq2  G-AAAATAATTTGTTTGAAGAT--GCATTAATGTATAAAATAGCCAGCAA  137

seq1  C-ATAGCTATGCTTCTGCTATCCCTTACATGGTCCAGAGACTTCTTTTAT  197
      | | |||||||||||||| |||||||||||||||||||||||||||||||
seq2  CAAAAGCTATGCTTCTGCAATCCCTTACATGGTCCAGAGACTTCTTTTAT  187

seq1  TACCAGTTAAATCCATGAACTTAATCTGTTGGAGCAAGCATTGTAGACAG  247
      |||||| ||||||||||||||||||||||| |||||||||||||||||||
seq2  TACCAG-TAAATCCATGAACTTAATCTGTT-GAGCAAGCATTGTAGACAG  235

seq1  AGTACTCAATTTCTCCCAAATACTCATCCATAATACCAAATTCTGTCAAG  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTACTCAATTTCTCCCAAATACTCATCCATAATACCAAATTCTGTCAAG  285

seq1  GCCAACATATTTTCATGATGATGAACAATCCTCAAGCTGTCCTTGTTCCT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCAACATATTTTCATGATGATGAACAATCCTCAAGCTGTCCTTGTTCCT  335

seq1  GTGTTCCAGATGTTAGTCTTTCTCTTTGATTCAAATGGACACATGTTCAT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTTCCAGATGTTAGTCTTTCTCTTTGATTCAAATGGACACATGTTCAT  385

seq1  GCATATATGTACACACACACACTGATTTGCAGACATTTCTGCTTCCTAAG  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATATATGTACACACACACACTGATTTGCAGACATTTCTGCTTCCTAAG  435

seq1  TGTTTCACATACTTTTAAAATTTACCCATCATTCAGTTCTATTATTTCTA  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTCACATACTTTTAAAATTTACCCATCATTCAGTTCTATTATTTCTA  485

seq1  GACATGAACACAAAACTGTGTCTGTATCTGTGGTACTAGATGTTGATAAA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATGAACACAAAACTGTGTCTGTATCTGTGGTACTAGATGTTGATAAA  535

seq1  GATGTAAGCTCAGAGTCCATGGGTCTTATAATATTGGATGAGAGCATAGT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGTAAGCTCAGAGTCCATGGGTCTTATAATATTGGATGAGAGCATAGT  585

seq1  TATAACTCTATCTTATACTGTGAAGTGAATTAAGATTTCAAAGTAAAATT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAACTCTATCTTATACTGTGAAGTGAATTAAGATTTCAAAGTAAAATT  635

seq1  GCTAATATAATAGCCTTGCACTGTTATTAATAATATAGTGTATTAAAATA  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAATATAATAGCCTTGCACTGTTATTAATAATATAGTGTATTAAAATA  685

seq1  TAGAGTAAGATATTGGGCAATAAATTTTGTGGCTAATATAAACAATTCAT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAGTAAGATATTGGGCAATAAATTTTGTGGCTAATATAAACAATTCAT  735

seq1  GCAGGAACCCATATCACTTTTGTCTCCAATTTAAACTAAATGTTTTCAAT  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGGAACCCATATCACTTTTGTCTCCAATTTAAACTAAATGTTTTCAAT  785

seq1  TAAGAAAAAAAGTAAATTTCTATTGTCAGTAGCCTATATTATTAAGGTAC  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAAAAAAAGTAAATTTCTATTGTCAGTAGCCTATATTATTAAGGTAC  835

seq1  AAATGTCTGTAACATTTAGTGGGACAATAGGAAAGAAAACTTTATTAAAA  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATGTCTGTAACATTTAGTGGGACAATAGGAAAGAAAACTTTATTAAAA  885

seq1  CTGCATGGAAGGATGGTATGGTGCTAAATTTTGATTGTCAATTTGATTTG  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCATGGAAGGATGGTATGGTGCTAAATTTTGATTGTCAATTTGATTTG  935

seq1  ATTAGTAAATGCCTACAAAATAGTGAAACACAGATCATATATCCAAAGGA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTAAATGCCTACAAAATAGTGAAACACAGATCATATATCCAAAGGA  985

seq1  CTATCTATATATGACATGATCCTTACAGAGACACTTGCTCATCCTTGTTC  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTATATATGACATGATCCTTACAGAGACACTTGCTCATCCTTGTTC  1035

seq1  ATTGCTGCTCTATTCATAAAAGCCAAGACATGGAAAGGTTTACCCATTCA  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCTGCTCTATTCATAAAAGCCAAGACATGGAAAGGTTTACCCATTCA  1085

seq1  TCAACTGGTAGATGAATAATCAAAATGTGATACATTTACACAATAAAGTA  1147
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACTGGTAGATGAATAATCAAAATGTGATACATTTACACAATAAAGTA  1135

seq1  TTAATAAGATGTCAAGAATAATGAATTC  1175
      ||||||||||||||||||||||||||||
seq2  TTAATAAGATGTCAAGAATAATGAATTC  1163

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information