MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-058J19
Chromosome	X (Build37)
Map Location	104,671,100 - 104,672,299
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gm784, Cysltr1, EG331493, LOC668490, LOC100042772, LOC100043263, Zcchc5, Gpr23, P2ry10, A630033H20Rik, Gpr174, LOC668502, LOC622613, LOC385404, Itm2a
Downstream gene	4933401B06Rik, Tbx22, 2610002M06Rik, Gm732, Gm378, LOC668516
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333564 MGI:2685630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cysltr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58861 MGI:1926218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG331493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331493 MGI:3648285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668490 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 3 Proteins pseudo : _no_value

name	LOC100042772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100043263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Zcchc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213436 MGI:2685221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr23 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78134 MGI:1925384
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	P2ry10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78826 MGI:1926076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A630033H20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213438 MGI:2441814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr174 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213439 MGI:2685222
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668502 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668502
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC622613 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	LOC385404 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins pseudo : _no_value

name	Itm2a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16431 MGI:107706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933401B06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71011 MGI:1918261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Tbx22 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245572 MGI:2389465
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	2610002M06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67028 MGI:1914278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm732 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213450 MGI:2685578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213454 MGI:2685224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC668516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Gm784 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090555 GeneID:333564 MGI:2685630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 784, (NCBI) transcript_id : NM_001007580.1

name	Cysltr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388547 GeneID:58861 MGI:1926218
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteinyl leukotriene receptor 1 transcript_id : NM_021476.3

name	EG331493 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359007 GeneID:331493 MGI:3648285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG331493 transcript_id : NM_001033541.2

name	Zcchc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054991 GeneID:213436 MGI:2685221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 5 transcript_id : NM_199468.1

name	Gpr23 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803306 GeneID:78134 MGI:1925384
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 23 transcript_id : NM_175271.3

name	P2ry10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347647 GeneID:78826 MGI:1926076
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : purinergic receptor P2Y, G-protein coupled 10 transcript_id : NM_172435.3

name	A630033H20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351977 GeneID:213438 MGI:2441814
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A630033H20 gene transcript_id : NM_175442.3

name	Gpr174 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802201 GeneID:213439 MGI:2685222
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 174 transcript_id : NM_001033251.2

name	LOC622613 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407742 GeneID:622613
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC622613 transcript_id : XM_887053.2

name	Itm2a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51556453 GeneID:16431 MGI:107706
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integral membrane protein 2A transcript_id : NM_008409.2

name	4933401B06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271860 GeneID:71011 MGI:1918261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 4933401B06 gene transcript_id : XM_001479708.1

name	Tbx22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21644588 GeneID:245572 MGI:2389465
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 22 transcript_id : NM_145224.1

name	Tbx22 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142375618 GeneID:245572 MGI:2389465
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : T-box 22 transcript_id : NM_181319.3

name	2610002M06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381786 GeneID:67028 MGI:1914278
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610002M06 gene transcript_id : NM_025921.2

name	Gm732 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359829 GeneID:213450 MGI:2685578
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 732, (NCBI) transcript_id : NM_001033252.2

name	Gm378 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086586 GeneID:213454 MGI:2685224
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : gene model 378, (NCBI) transcript_id : XM_142049.3

name	Cysltr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542449 GeneID:58861 MGI:1926218
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004974 - leukotriene receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : leukotriene D4 receptor; LTD4 receptor; cysteinyl leukotriene 1 receptor product : cysteinyl leukotriene receptor 1 protein_id : NP_067451.2

name	EG331493 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702049 CCDS:CCDS30343.1 GeneID:331493 MGI:3648285
definition	codon_start : 1 note : novel protein containing 7 transmembrane receptor (rhodopsin family) domain product : hypothetical protein B130007I08 protein_id : NP_001028713.1

name	Zcchc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054992 CCDS:CCDS30344.1 GeneID:213436 MGI:2685221
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger CCHC domain containing 5 product : zinc finger, CCHC domain containing 5 protein_id : NP_955762.1

name	Gpr23 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424926 CCDS:CCDS30345.1 GeneID:78134 MGI:1925384
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0008289 - lipid binding [Evidence IEA]; GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : P2Y purinoceptor 9 product : G protein-coupled receptor 23 protein_id : NP_780480.1

name	P2ry10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369579 CCDS:CCDS30346.1 GeneID:78826 MGI:1926076
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : purinergic receptor P2Y G-protein coupled 10 product : purinergic receptor P2Y, G-protein coupled 10 protein_id : NP_766023.1

name	A630033H20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425170 GeneID:213438 MGI:2441814
definition	GO_function : GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : novel protein similar to purinergic receptor P2Y G-protein coupled 10 (P2ry10) (A630033H20Rik) product : hypothetical protein LOC213438 protein_id : NP_780651.1

name	LOC622613 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407743 GeneID:622613
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892146.2

name	Gpr174 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701752 CCDS:CCDS30348.1 GeneID:213439 MGI:2685222
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0045028 - purinergic nucleotide receptor activity, G-protein coupled [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : putative purinergic receptor FKSG79 product : G protein-coupled receptor 174 protein_id : NP_001028423.1

name	Itm2a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51556454 CCDS:CCDS30349.1 GeneID:16431 MGI:107706
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : integral membrane protein 2A protein_id : NP_032435.2

name	4933401B06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271861 GeneID:71011 MGI:1918261
definition	codon_start : 1 product : hypothetical protein LOC71011 protein_id : XP_001479758.1

name	Tbx22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21644589 CCDS:CCDS30350.1 GeneID:245572 MGI:2389465
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; T-box transcripttion factor protein 22 product : T-box 22 isoform 1 protein_id : NP_660259.1

name	Tbx22 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044451 CCDS:CCDS30351.1 GeneID:245572 MGI:2389465
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; T-box transcripttion factor protein 22 product : T-box 22 isoform 2 protein_id : NP_851836.1

name	2610002M06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27229022 GeneID:67028 MGI:1914278
definition	GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC67028 protein_id : NP_080197.2

name	Gm732 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701758 CCDS:CCDS30352.1 GeneID:213450 MGI:2685578
definition	codon_start : 1 product : hypothetical protein LOC213450 protein_id : NP_001028424.1

name	Gm378 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086587 GeneID:213454 MGI:2685224
definition	codon_start : 1 product : similar to BMI1-like protein protein_id : XP_142049.3

name	LOC100042772 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042772
definition	number : 1 pseudo : _no_value

name	LOC100042772 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042772
definition	number : 2 pseudo : _no_value

name	LOC100043263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043263
definition	number : 1 pseudo : _no_value

name	LOC668502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668502
definition	number : 2 pseudo : _no_value

name	LOC668502 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668502
definition	number : 1 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 1 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 2 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 3 pseudo : _no_value

name	LOC668516 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668516
definition	number : 4 pseudo : _no_value

name	LOC668490 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271824 GeneID:668490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 3 Proteins product : similar to Zinc finger protein 277 pseudo : _no_value transcript_id : XR_033882.1

name	LOC385404 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271825 GeneID:385404
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 3 Proteins product : similar to 60S ribosomal protein L7 pseudo : _no_value transcript_id : XR_033931.1

clone name	MSMg01-174I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-113L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-307J08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449O14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-147A17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-418H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045P08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048L10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427D18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-108I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-395N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-054D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-365A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069N01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-334E12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-275M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-068H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322I11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-058J19.b	B6Ng01-058J19.g
ACC	DH880143	DH880144
length	1,171	1,154
definition	DH880143\|Mus musculus domesticus DNA, BAC clone: B6Ng01-058J19, 5' end.	DH880144\|Mus musculus domesticus DNA, BAC clone: B6Ng01-058J19, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccatctctagacaaattaggttgttaatccaattagtaaagttag tgccaaagctataatcgaatcagatcaaacaggaagaagagcaaagagga caaagagtgcagagaagtacccaggccattaagccagacaacactgttgc aaaatagtcagagagaattccaccttcctttgaagtcatattatttctaa cttacagcaaggtaaaggcatgctctgaaaattcaaaagttgtgaaattc taggcaatttgacacttacattgtcaggttcggctttggaatactgaaat cttttgtgaatgctttttgtgaaaatccataaagaagattccagcctttg agcagtccattattaatccgtatttccacagaaacacattagttaaagtt aaccccatctcagtggtatggtacatatcgatgttcttttccctttaagt attgatgaatgcagacttccagactggtttatttcatgaaacaaaatatg aacatcataataaaatagtacataacgtgaatggaacctacaattggaat caaagatggtttaaggttgctatatgtcagatcaagggcagaagttgtct atcagaagctacacccttcctaataacatcttatcttatgtctgaaaagt caacacttgcccattatgtctagaatgagtaacaattctctctgttcatt ggctgctatttaattccatgtcttcaatgaggaaaccgaacagattaggt aacttggcaagtcactgaatctgaaccaatcaaagcctctttcccaggag cttaaactgaggaaagcaacaatgtccgaaagaagatttgcaacatatat tatattatagtagcaggcgtggtagtgatgattacatgttgtcaaccagg aattctaatcagccagtgcttaaagaaacagttgctatggttttgatgtc tgtttctccttttctttgattcttctgatcttactgtctaaacacattaa ttttaagagaccttgctttttctttttctaggttcccccctctttttttc attttcctaattgcttgtattttgccagggaggctagatattgtatgtta ttttgaataaacttaatgctctgggtgagaagaaaattctggtcctgcca gctatataatcttctttgttc	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtgagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagaagccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaaactggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagagcatcatcctgagtgaggtaacacaatcacaaa ggaactcacacaatatgtactcactgataagtggatactagcccaaaacc taggatacccacgatataagatacaatttcctaaacacatgaaactcaag aaaaatgaagactgaagtgtggacactatgcccctccttagaagtgggaa caaaacacccatggaaggagttacagaaacaaagtatggagctgagatga aaggatggaccatgtagagactgccatatccagggatccaccccataatc agcttccaaatgctgacaccattgcatacactagcaagattttactgaaa ggacccagatgtagctgtctcttgtgagactatgccggggcctagcaaac acagaagtggatgctcacagtcagctaatggatggatcacagggctccca atggagagctagagaagtacccaagagctaaagggatctcaaccctatag gtggacacatatgactaaccagtaccctggagctctgactctagctgcaa tgatcaaaagatggcctagtccgcatcacttgaaagaaggtcatgaaacc agactttggtggtctcggtacaggaacccaggccaaaggggagatgtgtg ggtt
quality values	Open. Hide. 61 47 36 31 61 61 38 24 61 61 61 61 61 61 61 61 49 43 61 61 61 61 47 55 59 61 61 49 34 30 25 30 28 28 23 36 39 59 59 59 61 61 61 61 61 59 59 61 61 59 55 59 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 52 59 59 61 59 61 61 35 55 61 61 61 59 59 61 61 61 61 61 61 59 44 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 61 55 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 50 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 37 50 50 61 53 61 61 61 61 61 61 61 61 61 53 61 61 61 61 47 61 61 30 61 61 61 61 61 61 28 61 61 53 61 61 61 53 57 57 53 53 53 47 57 53 53 50 53 53 57 47 47 46 45 57 53 37 47 57 57 57 53 57 53 57 52 53 43 57 57 53 57 53 53 53 45 52 57 57 53 53 50 57 52 53 57 47 50 53 53 45 57 53 45 47 57 45 53 52 43 57 50 57 42 53 53 52 53 57 57 57 47 50 50 50 43 44 42 53 53 53 47 43 47 47 34 52 50 50 45 53 50 50 50 52 42 57 46 36 57 52 38 43 53 50 47 57 50 50 57 50 53 53 57 53 53 57 34 53 45 36 37 50 57 41 41 53 52 38 42 50 50 57 50 42 52 36 52 40 50 24 53 57 50 50 38 52 38 18 53 50 57 47 29 40 40 53 23 28 34 31 52 52 37 34 40 33 22 44 33 8 25 24 32 36 37 36 37 53 44 33 36 36 39 30 36 34 33 38 53 52 33 39 42 33 34 40 40 30 22 28 40 40 37 40 36 41 29 29 33 44 41 33 53 31 28 37 30 24 29 41 41 16 24 21 25 29 45 32 30 39 48 31 24 48 32 45 30 18 25 27 28 40 27 23 30 44 24 30 32 20 31 46 39 35 41 48 26 23 10 46 39 20 27 29 29 29 30 39 29 29 29 39 27 29 28 29 34 34 35 28 29 28 21 32 14 29 12 24 12 8 21 28 41 24 28 38 28 29 29 26 14 28 34 21 30 19 29 11 26 33 23 35 41 15 28 25 26 23 26 21 19 25 29 35 28 38 34 29 24 20 29 26 7 8 8 20 24 28 24 28 23 31 33 23 51 24 14 29 51 10 18 16 29 22 18 25 31 23 28 20 39 31 16 51 51 22 21 30 14 29 36 18 19 41 18 51 15 31 14 5 30 18 51 44 19 28 16 51 19 26 34 22 22 28 15 21 28 22 18 31 23 26 20 22 17 16 10 27 7 28 17 38 33 9 10 4 8 7 19 27 27 22 15 44 39 17 24 16 9 38 17 27 17 19 21 22 28 19 8 4 10 23 22 11 8 34 39 35 15 7 11 30 22 22 13 9 3 20 23 18 28 19 7 8 8 33 30 42 36 37 30 9 7 26 31 34 15 25 25 12 27 16 3 8 29 4 4 5 29 11 12 6 42 42 18 15 12 26 5 13 7 7 23 8 26 10 13 21 5 21 4 8 3 6 14 4 17 6 9 6 12 8 5 9 5 3 5 17 9 13 6 26 19 5 4 6 6 5 8 21 5 6 14 6 4 10 11 5 6 6 5 12 8 6 21 30 11 7 6 9 8 4 4 6 8 6 1 3 6 2 2 5 4 4 5 7 3 3 6 3 10 4 5 9 8 4 3 19 8 10 9 5 2	Open. Hide. 61 47 55 47 61 61 61 49 22 61 25 20 19 15 10 25 55 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 59 59 49 30 35 44 59 59 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 59 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 55 55 55 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 55 61 61 50 49 61 55 61 55 55 55 55 55 55 55 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 52 52 61 61 61 61 61 61 61 61 61 53 61 61 53 61 61 61 61 61 52 61 61 61 61 61 61 61 45 50 50 47 52 50 53 53 53 52 38 53 61 53 61 61 61 61 50 61 61 61 61 61 37 61 61 61 61 61 61 61 61 61 61 61 53 61 61 46 47 46 53 46 47 47 43 61 61 61 61 61 61 52 61 61 61 47 47 61 61 61 61 50 61 61 53 53 53 53 45 53 52 50 52 53 57 57 53 57 53 40 53 45 53 53 53 52 53 52 53 57 57 52 57 50 53 53 53 53 53 53 53 53 53 53 53 52 53 50 57 53 53 57 53 52 46 53 53 53 38 53 53 57 51 45 45 57 46 52 57 47 47 35 47 46 50 52 45 47 47 46 43 52 47 46 45 53 52 53 39 57 37 34 45 47 43 52 45 52 50 57 37 50 45 38 57 53 52 31 50 53 38 47 47 52 50 45 35 47 43 43 38 53 45 52 43 46 46 46 35 35 50 53 40 42 53 47 57 52 41 52 35 22 52 46 46 42 41 28 53 53 30 33 34 52 52 29 53 33 50 34 37 53 50 50 52 37 30 25 17 28 36 35 39 28 28 38 37 52 52 38 38 57 57 52 39 50 38 28 46 46 40 41 36 31 33 37 36 34 53 41 31 26 14 46 39 27 33 37 37 41 36 32 52 44 29 38 23 48 39 28 42 39 33 43 44 40 31 33 47 33 44 18 33 29 30 53 53 31 13 45 29 25 31 45 27 16 31 28 35 53 40 40 40 48 33 30 25 29 36 21 30 27 38 29 31 25 31 28 32 30 33 30 29 30 30 17 40 44 36 38 26 30 30 30 30 29 27 28 28 29 47 29 29 32 48 36 28 39 33 29 27 29 25 23 30 31 25 25 30 29 29 28 29 28 29 23 28 28 29 15 29 25 27 35 27 13 51 51 36 30 28 29 35 28 51 27 23 17 30 12 36 26 25 19 35 25 35 28 14 17 27 33 29 28 28 26 23 26 27 29 19 29 29 14 29 18 23 20 26 29 26 26 25 43 43 29 12 29 31 33 19 29 28 51 31 25 18 24 29 23 34 31 16 15 21 22 17 12 21 21 31 31 19 24 26 31 28 34 23 23 23 30 20 22 26 30 25 7 8 24 16 15 25 19 19 12 10 18 51 30 16 22 9 38 26 15 20 21 18 28 14 7 6 6 31 24 12 15 33 7 30 31 13 18 25 30 30 20 11 6 6 4 12 29 29 21 44 16 19 44 19 19 22 8 13 13 22 22 17 22 10 14 6 6 23 23 12 9 5 9 14 9 12 3 1 13 4 5 15 29 9 20 22 21 14 13 14 26 23 22 26 29 19 12 18 9 15 9 13 6 11 15 10 28 16 18 14 9 12 16 22 20 13 5 3 3 3 3 4 7 12 24 27 27 13 5 9 7 24 17 10 10 14 6 3 3 3 4 5 8 3 10 5 4 9 8 6 6 4 16 6 4 6 7 7 9 3 16 9 17 8 4 9 4 5 8 4 4 9 7 20 19 8 3 6 6 4 13 8 27 4 11 5 11 5 8 8 10 13 11 3 8 3 8 14 7 12 17 5 10 12 11 5 14 11 13 17 4 11 8 3 3 3 5 6 11 7 11 3 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_104671100_104672299
seq2: B6Ng01-058J19.b_47_1217 (reverse)

seq1  GAACAAAGAAGTATTTAATATAGCCTTTGTGCCCAAATGTACAGAATATT  50
      ||||||||||| |||  |||||||     || |   | |  |||||| ||
seq2  GAACAAAGAAG-ATT--ATATAGC-----TGGC---AGGACCAGAAT-TT  38

seq1  TTCTCTTACCACAGAGCCATGTAGTTTAATTCAGAATAACATTACATTAT  100
      |  ||| ||| ||||| |||  ||||| ||||| ||||||| |||| |||
seq2  TCTTCTCACC-CAGAG-CATTAAGTTT-ATTCAAAATAACA-TACAATAT  84

seq1  CTTAGCCTTCACTGGCAAAAATACAAAGCAATTTTAGGAAAATGAAAAAA  150
      | ||||| || ||||| ||||||| ||||||  ||||||||||| |||||
seq2  C-TAGCC-TCCCTGGC-AAAATAC-AAGCAA--TTAGGAAAATG-AAAAA  127

seq1  AAGAGGGGGGGAAACCTAGAAAAAAGAAAATAGCAAGGTCTCTTAAAATT  200
      ||||||||||  ||||||| |||||||||| |||||||||||||||||||
seq2  AAGAGGGGGG--AACCTAG-AAAAAGAAAA-AGCAAGGTCTCTTAAAATT  173

seq1  AATGTGTTTAGACAGTAAGATCAGAAGAATCAAAGAAAAGGAGAAACAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  AATGTGTTTAGACAGTAAGATCAGAAGAATCAAAGAAAAGGAGAAACAG-  222

seq1  ACATCAAAACCATAGCAACTGTTTCTTTAAGCACTGGCCTGATTAGAATT  300
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  ACATCAAAACCATAGCAACTGTTTCTTTAAGCACTGG-CTGATTAGAATT  271

seq1  CCTGGTTGACAACATGTAATCATCACTACCACGCCTGCTACTATAATATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGGTTGACAACATGTAATCATCACTACCACGCCTGCTACTATAATATA  321

seq1  ATATATGTTGCAAATCTTCTTTCGGACATTGTTGCTTTCCTCAGTTTAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATGTTGCAAATCTTCTTTCGGACATTGTTGCTTTCCTCAGTTTAAG  371

seq1  CTCCTGGGAAAGAGGCTTTGATTGGTTCAGATTCAGTGACTTGCCAAGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGGGAAAGAGGCTTTGATTGGTTCAGATTCAGTGACTTGCCAAGTT  421

seq1  ACCTAATCTGTTCGGTTTCCTCATTGAAGACATGGAATTAAATAGCAGCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTAATCTGTTCGGTTTCCTCATTGAAGACATGGAATTAAATAGCAGCC  471

seq1  AATGAACAGAGAGAATTGTTACTCATTCTAGACATAATGGGCAAGTGTTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAACAGAGAGAATTGTTACTCATTCTAGACATAATGGGCAAGTGTTG  521

seq1  ACTTTTCAGACATAAGATAAGATGTTATTAGGAAGGGTGTAGCTTCTGAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTTCAGACATAAGATAAGATGTTATTAGGAAGGGTGTAGCTTCTGAT  571

seq1  AGACAACTTCTGCCCTTGATCTGACATATAGCAACCTTAAACCATCTTTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAACTTCTGCCCTTGATCTGACATATAGCAACCTTAAACCATCTTTG  621

seq1  ATTCCAATTGTAGGTTCCATTCACGTTATGTACTATTTTATTATGATGTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCAATTGTAGGTTCCATTCACGTTATGTACTATTTTATTATGATGTT  671

seq1  CATATTTTGTTTCATGAAATAAACCAGTCTGGAAGTCTGCATTCATCAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATTTTGTTTCATGAAATAAACCAGTCTGGAAGTCTGCATTCATCAAT  721

seq1  ACTTAAAGGGAAAAGAACATCGATATGTACCATACCACTGAGATGGGGTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTAAAGGGAAAAGAACATCGATATGTACCATACCACTGAGATGGGGTT  771

seq1  AACTTTAACTAATGTGTTTCTGTGGAAATACGGATTAATAATGGACTGCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTTAACTAATGTGTTTCTGTGGAAATACGGATTAATAATGGACTGCT  821

seq1  CAAAGGCTGGAATCTTCTTTATGGATTTTCACAAAAAGCATTCACAAAAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGGCTGGAATCTTCTTTATGGATTTTCACAAAAAGCATTCACAAAAG  871

seq1  ATTTCAGTATTCCAAAGCCGAACCTGACAATGTAAGTGTCAAATTGCCTA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCAGTATTCCAAAGCCGAACCTGACAATGTAAGTGTCAAATTGCCTA  921

seq1  GAATTTCACAACTTTTGAATTTTCAGAGCATGCCTTTACCTTGCTGTAAG  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTTCACAACTTTTGAATTTTCAGAGCATGCCTTTACCTTGCTGTAAG  971

seq1  TTAGAAATAATATGACTTCAAAGGAAGGTGGAATTCTCTCTGACTATTTT  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAAATAATATGACTTCAAAGGAAGGTGGAATTCTCTCTGACTATTTT  1021

seq1  GCAACAGTGTTGTCTGGCTTAATGGCCTGGGTACTTCTCTGCACTCTTTG  1100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAACAGTGTTGTCTGGCTTAATGGCCTGGGTACTTCTCTGCACTCTTTG  1071

seq1  TCCTCTTTGCTCTTCTTCCTGTTTGATCTGATTCGATTATAGCTTTGGCA  1150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCTTTGCTCTTCTTCCTGTTTGATCTGATTCGATTATAGCTTTGGCA  1121

seq1  CTAACTTTACTAATTGGATTAACAACCTAATTTGTCTAGAGATGGAATTC  1200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACTTTACTAATTGGATTAACAACCTAATTTGTCTAGAGATGGAATTC  1171

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information