MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-061B02
Chromosome	X (Build37)
Map Location	77,809,221 - 77,810,350
singlet/doublet	singlet
Overlap gene	none
Upstream gene	2410003J06Rik, LOC667749, LOC211702, LOC667755, LOC211705, LOC654474, LOC629153, LOC546338, LOC100042229, LOC667776
Downstream gene	EG629182, Tmem47, LOC100041462, LOC100041474, 4930595M18Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	2410003J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 44 ESTs, 18 Proteins

name	LOC667749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC211702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC667755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	LOC211705 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins pseudo : _no_value

name	LOC654474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:654474
definition	note : glyceraldehyde-3-phosphate dehydrogenase pseudogene pseudo : _no_value

name	LOC629153 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629153
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC546338 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546338
definition	note : heterogeneous nuclear ribonucleoprotein A3 pseudogene pseudo : _no_value

name	LOC100042229 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC667776 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 462 ESTs, 14 Proteins pseudo : _no_value

name	EG629182 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629182 MGI:3648228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Tmem47 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192216 MGI:2177570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100041462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC100041474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930595M18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245492 MGI:3045300
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271784 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 1 transcript_id : XM_135953.7

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407568 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 42 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 2 transcript_id : XM_893039.2

name	LOC100042229 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271787 GeneID:100042229
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042229 transcript_id : XM_001477903.1

name	Tmem47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270284 GeneID:192216 MGI:2177570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 47 transcript_id : NM_138751.1

name	Tmem47 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365049 GeneID:192216 MGI:2177570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 47 transcript_id : NM_175771.3

name	LOC100041462 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271724 GeneID:100041462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : similar to synaptosomal-associated protein 23 transcript_id : XM_001476422.1

name	4930595M18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382854 GeneID:245492 MGI:3045300
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930595M18 gene transcript_id : NM_173435.2

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984446 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 1 protein_id : XP_135953.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001575 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 2 protein_id : XP_898132.1

name	LOC100042229 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271788 GeneID:100042229
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477953.1

name	Tmem47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270285 CCDS:CCDS30254.1 GeneID:192216 MGI:2177570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 10 product : transmembrane protein 47 protein_id : NP_620090.1

name	Tmem47 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28461139 CCDS:CCDS30254.1 GeneID:192216 MGI:2177570
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 10 product : transmembrane protein 47 protein_id : NP_786965.1

name	LOC100041462 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271725 GeneID:100041462
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476472.1

name	4930595M18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734114 GeneID:245492 MGI:3045300
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245492 protein_id : NP_775611.1

name	LOC667749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667749
definition	number : 1 pseudo : _no_value

name	LOC211702 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211702
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 2 pseudo : _no_value

name	LOC629153 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:629153
definition	number : 1 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 4 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 3 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 2 pseudo : _no_value

name	LOC100041474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041474
definition	number : 1 pseudo : _no_value

name	LOC211705 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271723 GeneID:211705
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 11 Proteins product : similar to prohibitin pseudo : _no_value transcript_id : XR_032681.1

name	LOC667776 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271789 GeneID:667776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 462 ESTs, 14 Proteins product : similar to Non-POU-domain-containing, octamer binding protein pseudo : _no_value transcript_id : XR_033448.1

name	EG629182 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271790 GeneID:629182 MGI:3648228
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : predicted gene, EG629182 pseudo : _no_value transcript_id : XR_033453.1

clone name	MSMg01-331F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-327O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-548G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-457K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-443N22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-104C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-114M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126A23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125N11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093C02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174O01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-061B02.b	B6Ng01-061B02.g
ACC	DH881855	DH881856
length	1,120	1,023
definition	DH881855\|Mus musculus domesticus DNA, BAC clone: B6Ng01-061B02, 5' end.	DH881856\|Mus musculus domesticus DNA, BAC clone: B6Ng01-061B02, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttttaaataaaggaatagtaacagttactttgagacctttttta ttgttttgtgaatttatctcttttcagaatctggtaacaaggcaagtaaa ctgtctcagctaggttcctagtagctctagataagtgagatctaaggcct ggattttttatcatatgaagagaactgagaaggcagaaaaactaagaagg cagttgaatccttggcagaggagctaggtgcttgatactgctaaagccag tcagtcaatatcacctagaaagaataaattatagcaggaaatataatcta atgttctatggcaaaggcttacttattacctagatggctctcctatgctc ccatacatcatttgcttgtgtaataggagaagttgttaaaatctgcaaga aattggaactaaagtgtggccatctttgaccattgacctatattgagacc aagcaattttcagtaagacaatgaggctttaagaaaaattctcagtctga gaaaggaattcaatccaaggagaaaagaagggtgggtcacaaaaagaaca cttccattgggagactaatgcagctaagagacagagacaaggaggaacaa gcagtaactccacccaattgagggttccaatatcacagaaaccacaaggg cttagagaagcagcaggacatttcacatagatcttgggggtgaggagcaa gaaatcctgcaacatgtgggcctaggacagtacaagaaaatgatagaaca aatagctccaaggaaaaggggtcaatgaaaaagctacacactcaagagca tgtaggcagctcctatagggaggtgagcaagttccatgaaggaactgaga ggagtcatgaatgaccagagtggataaatgtcatggtaacaaaaatttca atctagggcaacgataaacagattaagagattgtcattgagaaatgtctc aaatcacagagcagaggacagtatgagggccagcatgatgagaagcttac tggcatacagtatggctttgtaataagtagacaaagcagacagttgcata gtgacacttagacagtaaagaggagagactatggatagatggaaaatacc ttggagaggttcaaaggcaa	gaattccatgaccgtgggctccctgtcgcacttctctggctttgaaatga gttccttggtcagaagcaatactgtgtggaataagatgatgatagataag tcattctgtcagtccgtggatggtggttttagcagaggtattacatgcag gaaaggcaaatcaataactagaataagtatatagtccagtaaaaacaaag cactgtcctttcaacgaaggaagtggtccagtgtagtcaacctgccacca ggttgctggctggacacctcgaggagtggtgccatatctggggctcagtg ttggtttttcctgttggcagatctggcattcagcagcagctgtagccagg tcaactttggtgagtggaagtccattttgctgagcccaagcataacctcc atcttgaccaccatggccactttgttcatgtgcccattgagcaatgacag ggatgtctgggaagagaggttgactgtccacagaaagggtcatcttatcc acttgattattgaactcctcctcggctgaagtcaccttttggtgagcatt tacatgggacacaaatatcttcacatcctttgcccatttggagagattta tccaaatcttccccagatgtctttctcaccaattttccaattatgatctt tccaagtccctgtccatccagccaatctattggctacagcccatgagtca gtgaataatcatacatctggccatttcttcgtacaaacaaactgtaatac cacgtgtactgctcgaagttctgcccactgtaaagatttcccttcacctg tgtctttcagggttgtcccaaaaaggggttgtaaatgctgcagctgtcca ctttctgggttggtaccttgtataatgttcagagcatcaataaaaccagg ccctagtcttcttctcttcagtcagctgatcatagggaatatcccatgag gctataagcacctgcttggcagcgaatggcattttgtaacagcggttaaa acataaggcttttcagtaacttc
quality values	Open. Hide. 33 29 32 39 61 61 61 61 61 47 49 61 61 61 61 61 61 61 61 61 52 49 49 47 55 55 23 37 14 22 27 35 29 28 26 31 59 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 59 59 43 43 49 36 27 26 55 55 59 61 61 61 61 61 59 61 61 59 59 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 59 59 61 59 59 61 61 52 52 52 44 52 52 61 55 59 52 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 52 43 61 44 59 59 59 59 59 61 61 61 61 59 59 39 59 44 36 52 61 61 61 61 61 59 61 52 59 59 59 59 59 61 59 61 59 59 61 59 59 52 61 61 52 59 52 59 59 52 61 59 59 59 61 61 61 61 61 61 61 61 59 52 59 59 44 59 59 61 61 61 61 59 61 59 61 61 59 59 59 59 61 59 52 59 59 59 52 59 59 59 52 59 59 61 59 59 59 59 59 52 59 59 52 52 59 61 52 52 59 59 52 59 59 59 59 59 44 59 59 52 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 61 61 45 52 52 52 52 45 61 61 61 59 59 59 59 59 61 61 61 59 59 61 59 49 61 52 59 59 59 59 59 59 61 59 59 52 59 52 49 52 59 61 61 61 59 49 59 59 52 59 59 52 52 59 59 52 59 59 59 59 45 59 52 59 45 59 59 59 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 45 49 52 52 49 52 59 52 59 61 61 61 61 61 61 61 49 59 52 59 59 45 59 61 61 61 61 59 59 59 49 59 45 59 59 59 59 52 52 59 41 37 41 59 59 59 49 52 43 52 52 61 61 61 61 61 52 41 59 41 36 37 43 43 49 49 52 61 52 52 52 41 43 33 61 61 52 49 61 52 52 52 61 61 52 43 55 49 55 52 61 61 61 61 61 61 61 61 49 52 52 49 43 43 41 36 43 52 52 52 61 61 61 61 61 55 55 61 45 43 50 41 35 38 49 49 41 35 38 61 61 61 61 61 61 61 61 55 61 61 47 61 61 61 61 50 49 43 43 37 43 27 37 61 61 61 43 55 37 37 31 43 43 43 37 27 24 43 61 61 61 61 53 45 47 43 50 43 50 47 61 32 35 25 32 43 31 61 53 53 35 52 45 40 39 47 30 33 38 27 39 61 61 61 61 50 52 43 50 32 31 30 38 32 25 28 29 28 40 42 42 40 19 31 31 30 28 27 61 61 61 61 50 61 61 34 39 39 40 31 34 61 52 47 39 38 43 43 24 39 24 28 35 27 27 38 28 30 45 53 47 47 53 47 47 47 57 31 40 42 24 42 30 23 32 20 16 53 47 43 27 17 37 32 34 31 35 34 40 42 42 47 47 43 57 53 57 46 53 57 57 28 52 53 40 47 53 30 42 39 43 45 57 57 33 39 36 30 30 32 24 22 19 27 24 32 47 57 42 17 24 25 32 45 36 22 38 52 39 24 32 27 22 16 11 16 21 42 57 57 35 52 53 38 50 53 24 45 32 25 17 28 47 37 39 22 20 35 24 30 23 22 32 46 37 43 33 13 10 57 41 44 37 36 32 37 35 46 52 57 57 44 47 14 30 42 36 38 16 33 23 32 42 28 18 27 28 50 31 37 27 40 40 40 31 9 34 19 26 29 26 21 23 35 35 27 23 20 20 57 41 38 30 37 22 25 37 16 20 12 16 9 13 8 12 21 11 30 20 29 21 11 37 30 36 27 35 22 35 21 53 22 30 37 12 26 18 20 21 22 14 19 31 30 25 17 21 16 10 34 21 29 28 31 9 20 35 51 30 29 34 32 26 17 36 23 31 7 21 14 29 10 28 47 45 12 29 31 30 28 18 12 30 29 27 18 7 32 33 29 30 26 25 14 29 34 25 29 24 31 22 11 7 10 9 10 29 6 13 9 14 9 46 29 29 20 22 27 27 26 28 12 21 22 28 20 28 28 17 17 28 18 51 25 27 13 9 16 22 13 34 14 26 14 6 29 12 21 29 9 13 17 22 36 18 29 11 7 23 15 29 17 14 16 20 14 22 33 34 33 18 28 10 19 24 9 11 23 23 15 10 8 25 7 16 7 20 8 12 5 5 10 5 9 19 20 28 38 31 30 21 27 20 5 9 22 32 11 5 5 6 27 17 15 30 15 16 19 7 6 10 5 14 19 23 24 23 19 14 30 11 28 14 34 15 9 5 18 19 30 7 7 13 6 6 21 17 18 33 25 8 8 8 29 11 5 3 4 6 6 4 6 3 5 7 5 9 5 5 5 22 6 8 7 16 42 14 17 12 11 21 8 11 19 2 3 4 8 10 23 5 5 8 7 5 17 12 15 4 14 6	Open. Hide. 61 61 41 38 55 24 27 10 19 20 15 19 20 22 18 52 61 61 61 61 59 59 59 59 59 55 59 49 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 52 30 28 44 35 35 36 61 61 59 61 61 59 61 61 61 61 61 59 59 59 59 59 61 59 61 61 61 61 61 61 61 61 59 59 55 59 61 61 59 61 61 61 61 59 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 41 59 59 59 52 59 61 59 59 59 61 61 59 59 61 61 61 61 59 59 52 59 59 44 59 52 61 59 59 59 52 52 52 39 59 61 59 59 49 59 61 61 61 59 61 59 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 59 61 61 61 59 59 59 61 59 43 39 30 32 32 36 59 52 44 35 41 52 52 59 44 39 41 49 43 59 59 59 61 61 61 61 61 52 49 45 45 49 43 43 61 61 59 59 52 59 59 59 59 59 59 59 61 59 59 59 59 59 59 52 61 52 59 61 59 59 59 61 59 59 61 61 59 59 52 55 55 44 59 45 59 59 61 61 59 59 61 59 49 59 52 59 43 59 59 61 59 61 61 59 59 59 59 59 59 52 43 59 61 59 59 61 61 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 52 61 59 59 59 59 61 61 59 59 59 59 52 45 59 59 49 52 45 43 52 59 59 59 43 34 49 52 43 49 52 52 52 52 52 52 59 59 61 61 61 59 61 61 59 59 59 59 59 59 45 52 49 52 38 52 61 59 59 59 59 59 52 59 28 39 43 39 36 36 59 59 59 59 59 59 59 59 52 59 36 36 52 52 49 45 59 49 52 52 49 59 52 45 59 59 59 49 59 52 59 59 59 61 59 59 59 59 52 59 59 52 52 49 52 52 52 59 61 59 59 43 59 52 52 59 59 59 59 52 52 61 61 59 49 43 43 36 37 49 61 61 61 61 61 61 61 61 59 61 59 36 43 52 43 52 52 43 41 41 36 43 36 36 61 61 55 55 61 55 52 55 55 55 55 61 49 49 49 49 49 43 52 52 52 55 55 55 55 55 55 55 52 52 52 52 43 49 33 39 49 43 39 49 43 52 49 52 52 61 43 36 49 49 41 52 49 41 49 55 55 47 47 55 50 50 37 37 32 36 43 41 38 43 32 49 61 41 43 55 49 49 49 55 55 47 55 61 61 55 55 55 55 50 55 37 50 49 24 24 50 49 49 37 43 43 37 39 55 55 55 55 61 49 61 47 55 55 53 35 35 35 24 24 18 32 50 61 43 45 43 35 27 16 24 35 31 53 31 35 32 23 24 31 25 30 24 24 21 24 27 23 30 53 61 50 36 30 37 33 50 37 47 61 43 47 61 50 40 52 31 27 27 35 31 39 39 39 34 31 27 31 43 43 43 47 31 39 30 39 24 24 27 30 33 33 61 50 31 31 47 33 39 39 39 45 45 45 30 31 30 27 32 32 32 45 53 29 20 31 53 45 50 27 53 53 30 24 36 35 45 38 42 45 45 38 40 50 52 52 30 22 26 21 24 18 22 14 10 9 10 9 16 36 40 16 30 28 38 28 38 31 28 27 33 11 8 16 30 30 18 23 20 23 15 32 37 45 23 30 28 38 20 20 22 28 35 37 38 36 43 31 30 27 14 18 18 16 26 30 45 23 38 28 26 19 31 17 14 10 11 13 14 27 45 31 24 19 21 30 39 38 32 35 36 17 10 8 7 8 10 57 17 26 18 29 18 18 18 19 8 7 17 25 19 13 21 17 35 23 26 21 24 24 34 17 27 36 17 37 36 19 29 16 38 21 19 35 27 20 23 17 14 53 22 17 24 52 45 53 13 13 31 39 9 25 25 21 7 9 28 20 16 31 29 37 35 40 16 33 21 17 5 17 8 20 19 36 24 14 6 12 12 14 27 17 13 19 23 18 30 27 31 20 8 22 13 19 28 20 14 18 15 6 9 13 14 29 25 22 14 14 10 8 14 9 13 15 18 20 16 11 15 18 34 20 39 17 20 29 16 18 8 17 8 19 10 23 8 23 18 13 6 31 28 34 18 12 5 9 8 10 11 14 28 25 14 29 22 18 11 22 11 23 6 12 11 7 26 23 14 6 16 10 25 13 9 7 19 6 7 7 5 26 18 17 8 12 10 14 36 17 21 7 9 7 16 5 21 10 9 29 13 29 10 10 11 6 8 12 7 5 7 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_77809221_77810350
seq2: B6Ng01-061B02.b_47_1166 (reverse)

seq1  TTGCCTTTTGTACCTCTCC-AGGTATTTTCTCATCTATCCATTTGTCTCT  49
      ||||| |||| |||||||| |||||||||| |||||||||| | ||||||
seq2  TTGCC-TTTGAACCTCTCCAAGGTATTTTC-CATCTATCCA-TAGTCTCT  47

seq1  CCTCTTTTACTGTCTAAGTGTCACTATGCAACTGTCTGCTTTGTCTACTT  99
      |||| |||||||||||||||||||||||||||||||||||||||||||  
seq2  CCTC-TTTACTGTCTAAGTGTCACTATGCAACTGTCTGCTTTGTCTAC--  94

seq1  TTATTACAAAAGCCATACTGGTATGCCAGTAAGCTTCTCATCATGCTGGG  149
      ||||||| ||||||||||| ||||||||||||||||||||||||||| ||
seq2  TTATTAC-AAAGCCATACT-GTATGCCAGTAAGCTTCTCATCATGCT-GG  141

seq1  CCCTCATTACTTGTCCTCTGCTCTGTGATTTGAGACATTTCTCAATGACA  199
      |||||| ||| |||||||||||||||||||||||||||||||||||||| 
seq2  CCCTCA-TAC-TGTCCTCTGCTCTGTGATTTGAGACATTTCTCAATGAC-  188

seq1  AATCTCTTAATCTGTTTATCGTTGCCCTAGATTGAAATTTTTGTTACCAT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTCTTAATCTGTTTATCGTTGCCCTAGATTGAAATTTTTGTTACCAT  238

seq1  GACATTTATCCACTCTGGTCATTCATGACTCCTCTCAGTTCCTTCATGGA  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATTTATCCACTCTGGTCATTCATGACTCCTCTCAGTTCCTTCATGGA  288

seq1  ACTTGCTCACCTCCCTATAGGAGCTGCCTACATGCTCTTGAGTGTGTAGC  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGCTCACCTCCCTATAGGAGCTGCCTACATGCTCTTGAGTGTGTAGC  338

seq1  TTTTTCATTGACCCCTTTTCCTTGGAGCTATTTGTTCTATCA-TTTCTTG  398
      |||||||||||||||||||||||||||||||||||||||||| |||||||
seq2  TTTTTCATTGACCCCTTTTCCTTGGAGCTATTTGTTCTATCATTTTCTTG  388

seq1  TACTGTCCTAGGCCCACATGTTGCAGGATTTCTTGCTCCTCACCCCCAAG  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGTCCTAGGCCCACATGTTGCAGGATTTCTTGCTCCTCACCCCCAAG  438

seq1  ATCTATGTGAAATGTCCTGCTGCTTCTCTAAGCCCTTGTGGTTTCTGTGA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTATGTGAAATGTCCTGCTGCTTCTCTAAGCCCTTGTGGTTTCTGTGA  488

seq1  TATTGGAACCCTCAATTGGGTGGAGTTACTGCTTGTTCCTCCTTGTCTCT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGGAACCCTCAATTGGGTGGAGTTACTGCTTGTTCCTCCTTGTCTCT  538

seq1  GTCTCTTAGCTGCATTAGTCTCCCAATGGAAGTGTTCTTTTTGTGACCCA  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTCTTAGCTGCATTAGTCTCCCAATGGAAGTGTTCTTTTTGTGACCCA  588

seq1  CCCTTCTTTTCTCCTTGGATTGAATTCCTTTCTCAGACTGAGAATTTTTC  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTCTTTTCTCCTTGGATTGAATTCCTTTCTCAGACTGAGAATTTTTC  638

seq1  TTAAAGCCTCATTGTCTTACTGAAAATTGCTTGGTCTCAATATAGGTCAA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAGCCTCATTGTCTTACTGAAAATTGCTTGGTCTCAATATAGGTCAA  688

seq1  TGGTCAAAGATGGCCACACTTTAGTTCCAATTTCTTGCAGATTTTAACAA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTCAAAGATGGCCACACTTTAGTTCCAATTTCTTGCAGATTTTAACAA  738

seq1  CTTCTCCTATTACACAAGCAAATGATGTATGGGAGCATAGGAGAGCCATC  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCCTATTACACAAGCAAATGATGTATGGGAGCATAGGAGAGCCATC  788

seq1  TAGGTAATAAGTAAGCCTTTGCCATAGAACATTAGATTATATTTCCTGCT  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTAATAAGTAAGCCTTTGCCATAGAACATTAGATTATATTTCCTGCT  838

seq1  ATAATTTATTCTTTCTAGGTGATATTGACTGACTGGCTTTAGCAGTATCA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATTTATTCTTTCTAGGTGATATTGACTGACTGGCTTTAGCAGTATCA  888

seq1  AGCACCTAGCTCCTCTGCCAAGGATTCAACTGCCTTCTTAGTTTTTCTGC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCACCTAGCTCCTCTGCCAAGGATTCAACTGCCTTCTTAGTTTTTCTGC  938

seq1  CTTCTCAGTTCTCTTCATATGATAAAAAATCCAGGCCTTAGATCTCACTT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTCAGTTCTCTTCATATGATAAAAAATCCAGGCCTTAGATCTCACTT  988

seq1  ATCTAGAGCTACTAGGAACCTAGCTGAGACAGTTTACTTGCCTTGTTACC  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTAGAGCTACTAGGAACCTAGCTGAGACAGTTTACTTGCCTTGTTACC  1038

seq1  AGATTCTGAAAAGAGATAAATTCACAAAACAATAAAAAAGGTCTCAAAGT  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATTCTGAAAAGAGATAAATTCACAAAACAATAAAAAAGGTCTCAAAGT  1088

seq1  AACTGTTACTATTCCTTTATTTAAAAGAATTC  1130
      ||||||||||||||||||||||||||||||||
seq2  AACTGTTACTATTCCTTTATTTAAAAGAATTC  1120

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information