MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-069G02
Chromosome	X (Build37)
Map Location	3,194,733 - 3,195,505
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC385516, LOC434721, LOC668957
Downstream gene	LOC100043932, OTTMUSG00000016406, LOC673743, OTTMUSG00000016405, OTTMUSG00000016411, LOC668961, LOC100042159, LOC100042168, LOC627187, LOC100042185, OTTMUSG00000016407, OTTMUSG00000016437, OTTMUSG00000016420, LOC547057, EG546327, EG668965
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC385516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385516
definition	gene_synonym : Gm1547; Gm654 note : hypothetical LOC385516 pseudo : _no_value

name	LOC434721 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC668957 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668957
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC100043932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	OTTMUSG00000016406 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668958 MGI:3709280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins

name	LOC673743 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673743
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	OTTMUSG00000016405 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630022 MGI:3709282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	OTTMUSG00000016411 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668960 MGI:3709278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC668961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins

name	LOC100042159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC100042168 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC627187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC100042185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	OTTMUSG00000016407 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627264 MGI:3709183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 11 ESTs, 10 Proteins

name	OTTMUSG00000016437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668964 MGI:3709272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	OTTMUSG00000016420 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668963 MGI:3709274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC547057 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547057
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins pseudo : _no_value

name	EG546327 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546327 MGI:3704140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST pseudo : _no_value

name	EG668965 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668965 MGI:3646752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs

name	LOC434721 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406944 GeneID:434721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_486606.3

name	OTTMUSG00000016406 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406945 GeneID:668958 MGI:3709280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 14 Proteins product : predicted gene, OTTMUSG00000016406 transcript_id : XM_001006590.1

name	OTTMUSG00000016405 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406948 GeneID:630022 MGI:3709282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016405 transcript_id : XM_895197.2

name	OTTMUSG00000016411 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406949 GeneID:668960 MGI:3709278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016411 transcript_id : XM_001006594.1

name	LOC668961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406951 GeneID:668961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 26 Proteins product : similar to 4930408F14Rik protein transcript_id : XM_001006595.1

name	LOC100042159 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270905 GeneID:100042159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474533.1

name	LOC100042168 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270907 GeneID:100042168
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : similar to mgclh transcript_id : XM_001474553.1

name	LOC100042185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270909 GeneID:100042185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : similar to 4930408F14Rik protein transcript_id : XM_001474570.1

name	OTTMUSG00000016407 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406954 GeneID:627264 MGI:3709183
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 11 ESTs, 10 Proteins product : predicted gene, OTTMUSG00000016407 transcript_id : XM_891923.2

name	OTTMUSG00000016437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406957 GeneID:668964 MGI:3709272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016437 transcript_id : XM_001006598.1

name	OTTMUSG00000016420 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406955 GeneID:668963 MGI:3709274
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016420 transcript_id : XM_001006597.1

name	EG668965 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270911 GeneID:668965 MGI:3646752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs product : predicted gene, EG668965 transcript_id : XM_001474644.1

name	LOC434721 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51771877 GeneID:434721
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_486606.1

name	OTTMUSG00000016406 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406946 GeneID:668958 MGI:3709280
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006590.1

name	OTTMUSG00000016405 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83006307 GeneID:630022 MGI:3709282
definition	codon_start : 1 product : hypothetical protein protein_id : XP_900290.1

name	OTTMUSG00000016411 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406950 GeneID:668960 MGI:3709278
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006594.1

name	LOC668961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94406952 GeneID:668961
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001006595.1

name	LOC100042159 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270906 GeneID:100042159
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474583.1

name	LOC100042168 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270908 GeneID:100042168
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474603.1

name	LOC100042185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270910 GeneID:100042185
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474620.1

name	OTTMUSG00000016407 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999652 GeneID:627264 MGI:3709183
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897016.1

name	OTTMUSG00000016437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406958 GeneID:668964 MGI:3709272
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006598.1

name	OTTMUSG00000016420 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94406956 GeneID:668963 MGI:3709274
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001006597.1

name	EG668965 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270912 GeneID:668965 MGI:3646752
definition	codon_start : 1 product : similar to 4930408F14Rik protein protein_id : XP_001474694.1

name	LOC668957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668957
definition	number : 1 pseudo : _no_value

name	LOC668957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668957
definition	number : 2 pseudo : _no_value

name	LOC668957 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668957
definition	number : 3 pseudo : _no_value

name	LOC100043932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043932
definition	number : 2 pseudo : _no_value

name	LOC100043932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043932
definition	number : 1 pseudo : _no_value

name	LOC673743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673743
definition	number : 3 pseudo : _no_value

name	LOC673743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673743
definition	number : 2 pseudo : _no_value

name	LOC673743 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673743
definition	number : 1 pseudo : _no_value

name	LOC627187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627187
definition	number : 2 pseudo : _no_value

name	LOC627187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627187
definition	number : 1 pseudo : _no_value

name	LOC547057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547057
definition	number : 2 pseudo : _no_value

name	LOC547057 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547057
definition	number : 1 pseudo : _no_value

name	EG546327 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270924 GeneID:546327 MGI:3704140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : predicted gene, EG546327 pseudo : _no_value transcript_id : XR_035060.1

clone name	MSMg01-358N14
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-197A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-229A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-079M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184J14
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-069G02.b	B6Ng01-069G02.g
ACC	DH887707	DH887708
length	1,143	996
definition	DH887707\|Mus musculus domesticus DNA, BAC clone: B6Ng01-069G02, 5' end.	DH887708\|Mus musculus domesticus DNA, BAC clone: B6Ng01-069G02, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttaattagcaccacagcagccttataataggatgttaaaacatt gaggtgaagaaggatgattttacattaatgtttatttttgccaaaaaaat agctatagacacatttaataaaaataactaggatatataactaatatttg attaccaccaattacaattgataccaatagattacagacgtttcttctac tttctgttaaagccttttttcttcccaccagttaattggaatctcacttg atagcacctaacaaaggcttaggttctcctgtggcaagtttaaggtgagg tcttagccaattaacatatcctgtaagcttttggaaataaaattttgaag taaatttgtaccaattttccagtatgattgaaaccctaattattaaaaaa gatattgcctctgaaacttatgaagcaacaattattccccagaactttaa acttccctttagagacattagctaataaaatacttttcacttaggaaaca atatatactgaaagatttaaaccttttgctttttgtattgaagctgataa taatttttttttacatattgttaagctatgttaaccatacccaggggcaa aagcctttaatggtcaccagttcactagaagtaaactctttacaaattga aataattaaacttttaaatctataacaattttatatgaagtaggcaagtt attttgaaatgcctttataagttttatagcctaattgaacttttttaaac ttttgaatttaaattttatttagaacaacatctggctaggtgtgtaataa ggctctgagaagtgtcacacaagccgagctgaagctgctccccttttgag ctctgcctcaacccaaatgcaaacttttttttcaatataaacactctgtc agagtcttggctcaaagattatcccttatgttgaagtatccttaaaagac ctgttttcttgtgttggtcatgttgtttggaaagactctaccttgagttc caaattaagctaactttctgttacagcgaaagttgcctgcccctttagag ccctttgtaatcgcctctcttgcaagctggtcagctgtactgtccagcac aggtgcagcctactatcagcttgtacgtgtaataactgctttt	gaattctaactcttacatatttgtaattaagaaaaaatctggtaggtgga gattgttgcagggtttgcaaaaggttaatgagactattgaacttgtagag gcattaaaaactggcctgcctactccattatagaattattatggatttgt aagatagttctttattcctttgcatcctgatgattgtaaaggttttgctt ttagtgagcttgcttgtaattttagagaacccatgaagcgatatcattgg aaagttttgcctcaaggaaaggctaatagccctacattatgtaaaaattt tttgtcactgcttcaatacagtgtatattattgattatatgggtatttta ttagctggttcctctgatggaattttactatgaggctttgcacttacaca aagagctttaaaattttggagtagttgttgctccagaaaagattcaaagg agaattcctttttcaatatttggaacataagttatatcctaaacaaattt cagcacaaaaaaattcaagtacgaaaaaataatttacttactctaaatga ttttcaatggttgttaggagatattaattgactaagacctcaccttaagc ttactacaggagaacttaaacctctatttgatgccctcaaggggagtgca aaatcctaattccccttgacaattaacagatgagggatgaatagcttttg cagaaagtagaggaagctattagccaacaacagatacattatatagacta tgatcagttgttggctgcttgcattattgctacaactcatgagtccacag cagtcctttgggataagggaccgttaaatgtggattcatctttcttggtc tccaaagaaagtttttattgctttcttatgaggcttgttgctgtgttaat cagaattggaagaatagagtcacaaaaaattttggaaagacctgatgaaa tatttctccctttattccatacagcaattaaatgggttattgccaa
quality values	Open. Hide. 61 30 20 36 53 47 47 55 50 50 50 50 38 30 43 43 61 49 49 61 55 55 49 49 61 61 52 30 28 23 23 22 22 32 27 26 37 59 43 59 61 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 61 61 59 61 61 61 52 59 37 44 35 36 43 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 61 59 59 59 59 59 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 59 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 59 61 59 61 59 55 61 61 61 61 61 61 59 61 59 61 61 61 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 59 59 59 61 59 59 61 59 59 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 55 61 61 61 55 55 61 61 55 50 55 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 38 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 47 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 53 50 50 61 61 61 43 61 61 61 39 43 61 61 61 61 53 53 53 61 61 45 61 52 61 61 52 50 53 61 61 52 61 61 61 38 53 53 52 42 43 61 47 61 61 61 45 53 61 61 61 38 42 42 39 61 61 53 61 47 52 57 42 40 40 39 47 47 53 53 57 57 53 43 53 47 53 57 53 34 47 45 45 53 33 20 36 57 57 53 40 52 40 42 36 53 57 30 36 53 52 53 52 32 53 57 45 57 40 57 53 53 47 28 53 53 52 40 52 28 47 42 57 57 38 53 36 46 34 52 53 53 32 38 40 37 30 30 37 36 39 47 47 38 41 37 37 36 21 53 53 53 57 32 37 53 52 53 38 53 53 43 45 53 30 33 53 41 36 52 34 34 53 57 52 38 19 57 38 45 38 41 53 33 29 26 34 23 40 50 38 57 46 37 42 38 34 37 34 50 37 50 22 38 53 34 40 38 34 53 19 53 53 33 37 46 10 25 38 16 25 53 12 18 19 31 40 48 36 42 35 44 26 24 32 11 23 29 37 40 30 16 40 29 37 35 44 37 39 37 27 9 53 57 8 9 32 24 29 36 23 29 25 15 29 29 33 19 7 31 23 32 18 24 32 20 47 28 17 44 26 13 10 51 46 46 46 46 51 13 29 26 18 23 25 30 30 39 33 25 18 38 25 23 21 46 27 28 15 9 44 9 28 27 13 29 24 33 25 29 29 15 48 32 16 36 28 15 17 23 35 46 13 5 10 10 17 29 29 9 11 19 39 19 28 30 29 35 29 14 23 5 27 38 21 9 29 6 14 15 12 7 5 46 23 43 21 22 43 13 36 27 38 20 13 29 13 12 12 11 6 19 20 6 39 29 29 28 24 38 28 10 26 19 13 13 7 27 14 33 20 22 17 17 13 19 9 46 38 9 43 9 26 11 14 22 17 18 11 10 10 9 28 39 9 19 10 16 20 6 15 9 30 15 17 15 23 39 13 31 7 11 23 28 24 17 33 9 51 31 16 17 25 13 30 9 26 6 6 12 25 12 35 30 21 19 26 34 20 24 28 6 8 13 20 11 8 6 5 6 12 22 5 30 7 22 8 14 31 7 6 17 22 26 5 4 5 15 27 14 4 4 3 4 4 20 4 4 10 17 13 9 11 12 12 10 13 12 5 21 9 13 4 3 4 5 5 9 9 6 6 6 5 5 4 5 21 4 11 8 26 21 22 11 7 25 8 19 32 32 19	Open. Hide. 55 49 52 49 55 43 43 15 12 21 20 13 12 11 12 9 12 39 59 61 59 61 59 61 59 59 61 61 59 59 49 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 52 59 59 52 34 30 43 59 52 45 49 61 61 59 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 59 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 59 59 59 59 59 59 55 61 61 61 61 59 52 59 52 35 44 43 59 59 59 59 59 59 61 52 52 44 27 59 59 55 59 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 59 61 59 61 61 49 59 49 37 59 59 59 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 59 61 61 59 61 55 59 59 61 59 61 61 61 61 61 59 61 61 59 59 52 59 59 52 59 59 59 59 59 61 59 59 59 61 61 49 52 52 59 52 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 43 61 52 61 49 52 52 49 36 43 59 59 59 61 59 59 59 59 59 59 61 59 61 61 61 61 59 59 59 61 59 61 61 61 61 52 61 41 52 59 38 59 59 59 59 59 59 59 59 59 61 61 36 59 45 52 59 45 61 61 61 61 59 59 61 45 59 59 39 59 61 61 61 61 61 59 61 59 61 61 61 59 59 59 59 61 59 59 59 59 61 61 59 59 59 59 59 59 59 61 59 61 59 61 59 61 59 59 61 61 61 61 61 20 28 13 18 23 13 38 59 59 61 59 52 59 59 59 61 59 61 61 61 61 59 49 59 45 43 25 61 59 59 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 59 55 59 59 61 61 59 61 61 61 61 59 61 59 61 59 59 59 61 61 61 59 52 61 61 52 61 52 61 38 55 52 52 55 55 49 55 55 49 49 55 41 61 49 55 55 52 36 52 52 52 49 52 52 41 52 52 43 37 32 21 37 43 49 43 28 37 13 34 31 28 37 30 37 43 52 52 50 55 61 47 61 32 50 50 50 55 39 61 55 55 47 47 43 19 35 38 61 47 50 61 38 55 61 38 17 50 43 61 55 61 61 13 17 10 8 12 14 39 47 47 40 55 50 55 39 55 55 61 55 31 31 29 26 19 50 50 43 47 14 37 50 50 28 50 61 53 50 61 43 61 33 61 43 31 43 45 39 12 43 61 36 43 27 31 10 50 32 53 47 32 24 45 40 24 40 43 39 39 52 32 13 50 50 31 42 50 38 19 50 23 28 50 27 50 31 31 45 50 50 39 29 33 45 24 47 25 42 50 42 61 39 45 47 39 47 14 30 31 20 23 20 27 20 27 52 31 31 31 32 39 34 17 34 38 45 36 37 34 6 16 21 25 27 35 21 40 45 13 24 27 36 24 53 27 28 34 30 19 39 26 23 32 53 36 14 23 9 7 7 27 35 42 47 32 20 8 46 43 31 32 20 52 18 28 52 37 40 10 35 14 30 30 8 18 18 22 26 23 32 42 23 7 12 22 22 13 27 21 17 43 38 14 36 53 29 14 12 28 25 22 14 33 32 14 17 8 8 17 21 18 23 23 14 16 17 29 6 17 6 24 16 17 14 52 45 22 21 22 32 26 16 34 22 18 9 9 10 23 41 33 28 30 11 19 12 21 8 8 31 12 33 17 37 14 15 33 6 15 26 30 11 19 7 8 19 17 23 17 22 9 14 44 38 13 38 8 30 17 10 17 11 5 24 24 14 6 19 22 20 10 19 24 30 36 37 8 34 14 24 16 36 38 25 19 32 21 21 9 10 25 20 20 21 22 33 16 22 19 11 14 25 29 20 40 17 25 14 9 9 11 10

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_3194733_3195505
seq2: B6Ng01-069G02.b_430_1186

seq1  TAATTATTAAAAAAGATATTGCCTCTGAAACTTATGAAGCAACAATTATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTATTAAAAAAGATATTGCCTCTGAAACTTATGAAGCAACAATTATT  50

seq1  CCCCAGAACTTTAAACTTCCCTTTAGAGACATTAGCTAATAAAATACTTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAGAACTTTAAACTTCCCTTTAGAGACATTAGCTAATAAAATACTTT  100

seq1  TCACTTAGGAAACAATATATACTGAAAGATTTAAACCTTTTGCTTTTTGT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTAGGAAACAATATATACTGAAAGATTTAAACCTTTTGCTTTTTGT  150

seq1  ATTGAAGCTGATAATAATTTTTTTTTACATATTGTTAAGCTATGTTAACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGAAGCTGATAATAATTTTTTTTTACATATTGTTAAGCTATGTTAACC  200

seq1  ATACCCAGGGGCAAAAGCCTTTAATGGTCACCAGTTCACTAGAAGTAAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACCCAGGGGCAAAAGCCTTTAATGGTCACCAGTTCACTAGAAGTAAAC  250

seq1  TCTTTACAAATTGAAAAAATTAAACTTTTAAATCTATAACAATTTTATAT  300
      |||||||||||||||| |||||||||||||||||||||||||||||||||
seq2  TCTTTACAAATTGAAATAATTAAACTTTTAAATCTATAACAATTTTATAT  300

seq1  GAAGTAGGCAAGTTATTTTGAAATGCCTTTATAAGTTTTATAGCCTAATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTAGGCAAGTTATTTTGAAATGCCTTTATAAGTTTTATAGCCTAATT  350

seq1  GAACTTTTTTAAACTTTTGAATTTAAATTTTATTTAGAACAACATCTGGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTTTTTTAAACTTTTGAATTTAAATTTTATTTAGAACAACATCTGGC  400

seq1  TAGGTGTGTAATAAGGCTCTGAGAAGTGTCACACAAGCCGAGCTGAAGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTGTGTAATAAGGCTCTGAGAAGTGTCACACAAGCCGAGCTGAAGCT  450

seq1  GCTCCCC-TTTGAGCTCTGCCTCAACCCAAATGCAAAC-TTTTTTTCAAT  498
      ||||||| |||||||||||||||||||||||||||||| |||||||||||
seq2  GCTCCCCTTTTGAGCTCTGCCTCAACCCAAATGCAAACTTTTTTTTCAAT  500

seq1  ATAAACACTCTGTCAGAGTCTTGGCTCAAAGATTATCCC-TATGTTGAAG  547
      ||||||||||||||||||||||||||||||||||||||| ||||||||||
seq2  ATAAACACTCTGTCAGAGTCTTGGCTCAAAGATTATCCCTTATGTTGAAG  550

seq1  TATCCTT-AAAGACTTGTTTTCTTGTGTTTGTTCATGTTGTTTGGAAAGA  596
      ||||||| |||||| |||||||||||| ||| ||||||||||||||||||
seq2  TATCCTTAAAAGACCTGTTTTCTTGTG-TTGGTCATGTTGTTTGGAAAGA  599

seq1  CTCTAACCTTGAGTTCCCAATTTTAAGCTAACTTTCTGTTACAAGCGAAA  646
      |||| |||||||||||| ||  |||||||||||||||||||| |||||||
seq2  CTCT-ACCTTGAGTTCCAAA--TTAAGCTAACTTTCTGTTAC-AGCGAAA  645

seq1  GGTTGCCTGCTCCTTTAAGAGCTCCTTTTGTAATCGGCTCTC-TGCAAGG  695
       ||||||||| ||||| ||||  || |||||||||| ||||| |||||| 
seq2  -GTTGCCTGCCCCTTT-AGAG--CCCTTTGTAATCGCCTCTCTTGCAAG-  690

seq1  CTTGTTCAGCTGTACTTGGCTCCCAGCCACA-GTGCAGCTAACTTATCAG  744
        || |||||||||||      |||| |||| |||||||  || ||||||
seq2  -CTGGTCAGCTGTACT----GTCCAG-CACAGGTGCAGCCTAC-TATCAG  733

seq1  CTTGTACTGTGTAAATTAAAACTGCTTTT  773
      ||||||| |||||    | ||||||||||
seq2  CTTGTAC-GTGTA----ATAACTGCTTTT  757

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information