MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-071N16
Chromosome	X (Build37)
Map Location	16,972,902 - 16,974,134
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Cypt6, LOC100038939, LOC668993, Maoa, Maob, Ndph, LOC100043063, Efhc2
Downstream gene	Fundc1, EG278181, EG668994, EG436196, EG331391, Dusp21, LOC100043951, Utx, LOC100043952
Link	Open Mouse BAC browser

Click to get alignment info.

name	Cypt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66742 MGI:3616444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 22 Proteins pseudo : _no_value

name	Maoa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17161 MGI:96915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maob (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109731 MGI:96916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17986 MGI:102570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Efhc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74405 MGI:1921655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fundc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72018 MGI:1919268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG278181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278181 MGI:3643718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	EG668994 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668994 MGI:3645165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 15 Proteins pseudo : _no_value

name	EG436196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436196 MGI:3646107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	EG331391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331391 MGI:3643621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	Dusp21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73547 MGI:1920797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Utx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22289 MGI:1095419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Cypt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842378 GeneID:66742 MGI:3616444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich perinuclear theca 6 transcript_id : NM_025738.2

name	LOC100038939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270941 GeneID:100038939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038939, transcript variant 1 transcript_id : XM_001471577.1

name	LOC100038939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270939 GeneID:100038939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038939, transcript variant 2 transcript_id : XM_001471579.1

name	Maoa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579838 GeneID:17161 MGI:96915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoamine oxidase A transcript_id : NM_173740.2

name	Maob (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370153 GeneID:109731 MGI:96916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoamine oxidase B transcript_id : NM_172778.1

name	Ndph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098076 GeneID:17986 MGI:102570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Norrie disease homolog transcript_id : NM_010883.2

name	LOC100043063 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270999 GeneID:100043063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043063 transcript_id : XM_001477606.1

name	Efhc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348726 GeneID:74405 MGI:1921655
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand domain (C-terminal) containing 2 transcript_id : NM_028916.2

name	Fundc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381937 GeneID:72018 MGI:1919268
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUN14 domain containing 1 transcript_id : NM_028058.2

name	EG278181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271052 GeneID:278181 MGI:3643718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG278181 transcript_id : XM_205276.2

name	EG436196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271054 GeneID:436196 MGI:3646107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG436196 transcript_id : XM_488332.2

name	EG331391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271056 GeneID:331391 MGI:3643621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG331391 transcript_id : XM_285437.3

name	Dusp21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037324 GeneID:73547 MGI:1920797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 21 transcript_id : NM_028568.1

name	Utx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859491 GeneID:22289 MGI:1095419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitously transcribed tetratricopeptide repeat gene, X chromosome transcript_id : NM_009483.1

name	Cypt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842379 GeneID:66742 MGI:3616444
definition	GO_component : GO:0001669 - acrosome [Evidence IDA] codon_start : 1 note : basic protein CKT1R3; cysteine-rich postacrosomal PT protein; cysteine-rich perinuclear theca protein 5; cysteine-rich perinuclear theca protein 1; cysteine-rich perinuclear theca protein 6; cysteine-rich postacrosomal perinuclear theca protein; cysteine-rich perinuclear theca 1 product : cysteine-rich perinuclear theca 5 protein_id : NP_080014.2

name	LOC100038939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270942 GeneID:100038939
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001471627.1

name	LOC100038939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270940 GeneID:100038939
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001471629.1

name	Maoa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579839 CCDS:CCDS30033.1 GeneID:17161 MGI:96915
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0008131 - amine oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006584 - catecholamine metabolism [Evidence IEA]; GO:0042420 - dopamine catabolism [Evidence IDA]; GO:0006118 - electron transport [Evidence IEA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : monoamine oxidase A protein_id : NP_776101.2

name	Maob (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370154 GeneID:109731 MGI:96916
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 exception : mismatches in translation product : amine oxidase (flavin-containing) protein_id : NP_766366.1

name	Ndph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754808 CCDS:CCDS30034.1 GeneID:17986 MGI:102570
definition	GO_process : GO:0001890 - placenta development [Evidence IMP] codon_start : 1 product : Norrie disease homolog protein_id : NP_035013.1

name	LOC100043063 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271000 GeneID:100043063
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477656.1

name	Efhc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037365 GeneID:74405 MGI:1921655
definition	codon_start : 1 exception : mismatches in translation product : EF-hand domain (C-terminal) containing 2 protein_id : NP_083192.1

name	Fundc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312526 CCDS:CCDS30035.1 GeneID:72018 MGI:1919268
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : FUN14 domain containing 1 protein_id : NP_082334.1

name	EG278181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271053 GeneID:278181 MGI:3643718
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_205276.2

name	EG436196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271055 GeneID:436196 MGI:3646107
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_488332.2

name	EG331391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271057 GeneID:331391 MGI:3643621
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_285437.3

name	Dusp21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037325 CCDS:CCDS30036.1 GeneID:73547 MGI:1920797
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : novel dual specificity phosphatase, catalytic domain containing protein product : dual specificity phosphatase 21 protein_id : NP_082844.1

name	Utx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859492 CCDS:CCDS30037.1 GeneID:22289 MGI:1095419
definition	GO_component : GO:0005742 - mitochondrial outer membrane translocase complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 product : ubiquitously transcribed tetratricopeptide repeat gene, X chromosome protein_id : NP_033509.1

name	LOC100043951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043951
definition	number : 1 pseudo : _no_value

name	LOC100043952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043952
definition	number : 2 pseudo : _no_value

name	LOC100043952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043952
definition	number : 1 pseudo : _no_value

name	LOC668993 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270998 GeneID:668993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 22 Proteins product : similar to casein kinase II alpha subunit pseudo : _no_value transcript_id : XR_033273.1

name	EG668994 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407022 GeneID:668994 MGI:3645165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 15 Proteins product : predicted gene, EG668994 pseudo : _no_value transcript_id : XR_002283.1

clone name	MSMg01-513H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-151H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-127M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053B01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-071N16.b	B6Ng01-071N16.g
ACC	DH889431	DH889432
length	1,237	1,213
definition	DH889431\|Mus musculus domesticus DNA, BAC clone: B6Ng01-071N16, 5' end.	DH889432\|Mus musculus domesticus DNA, BAC clone: B6Ng01-071N16, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcactggataacaataaattcaaagtatcataggttttgttggcag caatttgtcaagtactttcacttttccttggtagctggctattgacaaat acaagttcttttatacttgtattgattactaatattaatttttatatcac attatacataacaccgtaatcatatttgtcaattttctatctacatgtct gtatttctagttagccatctatattttggttacaaaatggttacggctga agcagggttcagggagttcaagggcacttcaacagagggagatacagagc tcataggaatgaagaaaatccctgcagtgttcaggtattaatgaattaag ttggagaaatgttagaggcacagaacaatgaagttgagctgcagaggctg caaggtcaccgagttgagctgggtgttagggcagagttgagctccagaga gaagttgtgagcttgtggaagtgaaagtcatggattctaaatgcctgaat gcagcaccatggcaggacaagttgcaagactgatccagaatgttgactag gtcgatggaaatcagtttgcatgaactatatcaacagtgggaatctaagt taaactgatgcccccccaccccttcccctacaaccaggtacagtttggtc ctttgatgtacacattggctggtcagatgacatggtggtgggagctgtca ccagtgcagtgttagatacccccttcttaatggggtcttgcactcttggt tagtctattgtgtttcagaactttgggggcctggcattctgatgtgactt tcgtatacccatatgttctgatctattctgataagtttatctattttggt agtaccttctgttctttttcattgttcttaaaataaattatttatttatt tatttattatttatttatttattatttatttaatgtgactgttgagtgac tgcatggtgcctatatacaacctgtgtgtctggtgtctacagaggaaaga agaggaatatcagattccctggaactgggagttacaaacagttgtagctg ctgtgtgggtactggaaattggaccaacgttcctagaagagcagcccaat gttactttaagccacacctggagcccctctcccagcccccagggtcggta ctacttactttagtccaaggttacaagtctgtgccttgagtgcgtcgctg gccagaattgtgtcggtgcacaagtggaagtttgaat	gaattctgtactaaaaccataagctctggtttggttttggtagggagact tttaaacattacttctgtaggactgtttaaattgcctctctgatattgat ttaatttttgtcagtggtaggcatcacaaaaattatccatttcttttaga ctttccaatttgatggaatatgggcttttaaagtatgtccttatgattct ctagacttcctccatgtctgttgttttgtcccccttttatttctaatttt gttaatttgcatacttgcactgcattgtagttaatttaaataaggctttg tctatcatattaattttttcgaagaaccaactctttgtttcattgaatct ttgtaaatattattattttgtttctatttaatttattgtggtcctgagtt tgattatttcttgccatctacttctcttgggtttgattacttcttttgtt ctagatttttcaggtgtgttgtgaggtggctagtattagatatctttttt ttctttctttctttctttctttctttctttctttctttcttcctttcttt ctttctttctttcttttttttttaagtgtgtgcttagtgctatggacttt tgtcttattcattgtgtcccataagtttggatatgctgggtgttcatttt ttattgaattctaggaaaattttagttttttcttaacttctatcttgatc tatatttcattcagtccaagagttgtttggtttccatgaatttttaagct ttctgatgtttttcatgttgttaatatccgtctttaaactgtgatggtct gataggatgcagggaattacttgaattttcttgtatctgttgaggcttgc tttgtgaccaagtatgtagacaattttggaggtagttccaggaagtgcag agaagaagtatattcttttgtgcttgttctataaatatctgttagtccat ttgctttgtaatatctgttagcttcatattctctgtatttgtctggatga ctcatccattggtggagagtaggtattgagtctccattatcatgtggagg gttgattttgatttagctgtagagtttactcttacaactttgagtgctct gcatcggatgatgttaaaataagaattgaatcgtgggaattcctagagag ttgattcacagtcctgaaacctgagccattggctagggtaaagtatatta taccatggctctg
quality values	Open. Hide. 61 47 21 30 61 33 35 61 61 61 61 38 36 61 61 49 38 61 61 61 61 61 61 61 59 59 59 59 14 15 19 16 27 12 23 21 13 23 32 43 59 59 59 59 61 61 59 59 61 61 61 61 59 61 61 61 59 61 59 61 61 61 61 61 61 59 61 61 59 61 61 61 61 59 59 59 59 55 55 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 59 59 61 61 59 59 61 61 59 61 61 59 59 61 55 44 61 59 59 61 55 55 61 61 59 61 59 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 55 44 59 61 61 61 61 61 61 59 55 44 37 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 55 61 61 59 61 61 61 61 59 61 61 61 61 55 59 59 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 61 52 61 61 47 61 61 61 61 61 61 53 61 61 53 61 61 61 61 61 50 57 57 57 57 57 52 57 57 53 57 57 57 57 53 57 57 57 57 53 57 57 53 57 57 57 47 47 57 57 53 57 57 57 57 57 57 57 47 57 53 53 57 53 57 53 53 57 53 53 57 57 57 45 53 53 57 57 57 57 57 53 45 52 57 57 57 47 57 57 57 57 57 53 53 53 37 53 53 52 45 57 53 53 53 53 52 57 52 57 57 57 37 39 57 57 52 57 57 53 48 33 52 45 50 53 50 53 50 52 57 57 43 47 57 53 52 33 53 53 36 53 33 53 52 45 45 53 57 57 43 57 52 50 52 57 53 52 32 53 53 53 50 53 34 42 52 34 52 53 53 43 42 50 52 53 37 37 38 39 50 42 50 52 57 57 57 57 42 53 52 35 42 44 39 33 57 34 41 34 33 53 40 53 53 42 40 47 52 53 40 37 52 57 28 40 42 37 33 53 36 37 35 32 46 33 40 29 57 53 37 30 20 43 37 37 37 57 53 40 57 57 57 33 25 53 36 47 40 36 30 37 39 36 31 31 39 29 48 40 32 36 30 39 51 40 39 38 30 31 30 30 31 51 48 35 30 44 31 44 30 47 47 30 31 29 25 30 29 36 28 47 46 29 30 33 24 41 48 37 48 51 48 35 35 48 29 31 29 51 51 27 27 27 29 41 28 37 29 23 33 28 37 31 29 43 26 30 43 29 51 46 46 39 35 23 29 30 43 22 24 29 29 27 33 51 51 30 29 29 51 34 23 35 43 26 51 33 39 20 46 30 25 19 36 25 19 27 41 32 29 23 21 16 27 51 32 39 25 39 25 31 28 46 22 30 24 17 19 18 46 24 15 17 44 29 29 30 23 46 14 26 33 29 30 46 38 51 18 30 23 28 28 28 24 28 29 24 24 29 33 46 22 30 21 38 26 31 27 26 23 19 21 17 28 19 28 24 32 23 35 28 29 22 28 20 38 35 14 19 17 27 20 26 34 28 15 29 15 13 24 6 5 4 5 29 10 23 9 9 34 30 15 31 33 19 10 7 33 11 17 17 44 24 15 19 12 8 18 23 19 14 25 5 8 17 19 22 5 5 6 34 30 13 17 14 25 5 6 11 3 8 25 26 29 29 29 18 5 6 3 4 12 21 5 16 29 16 18 12 20 42 14 10 14 10 10 6 10 27 8 13 16 17 16 23 9 5 6 3 4 26 23 6 23 6 9 16 7 14 12 6 15 12 9 20 11 11 9 6 6 27 14 9 9 5 10 20 8 13 9 7 23 22 20 11 23 12 6 5 5 6 7 4 6 5 11 21 5 7 9 24 36 27 21 7 16 27 17 6 17 10 13 9 19 10 5 15 10 10 7 4 3 3 1 2 3 4 1 1 3 5 4 3 7 3 3 1 10 8 6 2 1 2 5 8 8 3 3 10 4 4 3 2 3 4 4 9 4 8 6 4 9 4 5 13 2 3 21 8 27 4 4 2 5 4 3 4 1 2 10 6 17 10 3 5 8 9 4 8 4 7 7 4 3 4 19 3 1 3 18 3	Open. Hide. 61 49 61 49 61 61 61 49 18 17 29 10 10 11 12 13 12 11 19 28 43 52 59 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 59 59 61 59 49 45 37 28 28 30 36 59 52 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 59 59 61 61 59 61 59 55 59 61 61 61 55 55 59 59 55 59 59 61 61 61 59 59 59 59 59 61 61 59 61 61 59 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 59 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 55 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 53 61 61 39 61 47 61 53 61 61 61 61 52 57 53 57 53 53 57 57 53 50 57 57 57 57 57 53 53 53 53 53 47 57 53 45 53 57 57 50 57 52 47 47 53 53 53 52 53 50 53 57 57 57 47 53 42 53 41 53 53 57 57 57 57 50 53 38 57 52 42 53 57 53 57 57 53 45 47 57 41 47 52 37 57 53 50 53 32 47 52 57 57 32 32 57 57 52 52 52 47 57 57 57 57 57 50 53 50 50 57 50 52 52 57 45 53 53 57 39 57 46 47 50 53 53 50 53 50 52 52 50 53 41 30 52 53 39 50 38 53 50 28 53 30 57 36 40 52 38 28 57 37 53 25 18 57 34 26 18 24 50 52 57 38 40 57 57 57 35 43 37 32 37 37 57 38 33 36 31 48 25 40 23 57 57 57 24 38 22 36 53 23 37 40 27 33 32 53 37 37 41 37 53 33 40 41 48 57 43 37 57 41 40 33 44 32 40 41 27 47 47 24 33 30 30 33 27 30 29 36 29 23 30 30 14 4 33 44 48 41 28 39 36 29 25 30 29 36 29 30 51 51 34 38 29 31 30 22 25 29 29 29 31 17 39 28 39 19 29 22 29 30 31 23 33 51 43 43 26 26 29 20 30 27 31 21 29 29 35 35 28 32 15 29 19 22 28 27 51 51 30 31 27 29 16 29 13 29 29 30 28 29 29 20 23 18 32 33 23 26 19 20 21 14 40 19 29 30 15 30 8 6 4 16 16 23 29 20 30 27 51 44 32 29 24 26 23 27 28 32 21 28 28 22 15 16 14 51 26 24 21 19 19 20 29 13 24 18 13 8 28 26 23 30 44 30 20 25 14 44 17 19 14 33 10 6 10 19 29 11 18 15 17 30 12 33 15 7 25 23 15 9 8 14 8 7 9 10 5 5 5 4 4 6 3 6 12 4 13 17 14 11 13 29 7 9 21 18 24 21 20 17 17 11 18 14 7 15 8 9 5 6 7 11 7 7 15 6 6 7 22 10 17 6 4 2 5 26 27 11 23 11 15 14 14 21 11 19 11 13 6 13 11 27 15 5 4 5 10 6 6 5 8 4 12 11 26 6 18 5 25 8 6 7 16 8 3 3 1 2 5 8 18 9 18 8 20 7 9 4 16 4 7 21 6 15 5 3 3 3 3 6 8 12 4 1 1 4 1 4 4 4 1 3 16 4 8 3 3 4 21 14 4 3 13 12 5 11 17 5 4 17 7 17 5 9 4 5 9 24 11 3 5 14 14 8 5 15 8 3 4 5 6 4 3 5 2 2 3 6 4 1 4 2 2 4 8 6 10 10 5 20 10 3 5 5 3 3 1 5 5 10 18 22 4 5 7 1 3 1 7 7 4 13 20 4 6 4 8 9 4 16 20 4 8 4 20 14 1 2 1 7 5 10 5 6 1

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_16972902_16974134
seq2: B6Ng01-071N16.b_42_1279

seq1  GGAATTCACTGGATAACAATAAATTCAAAGTATCATAGGTTTTGTTGGCA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATTCACTGGATAACAATAAATTCAAAGTATCATAGGTTTTGTTGGCA  50

seq1  GCAATTTGTCAAGTACTTTCACTTTTCCTTGGTAGCTGGCTATTGACAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAATTTGTCAAGTACTTTCACTTTTCCTTGGTAGCTGGCTATTGACAAA  100

seq1  TACAAGTTCTTTTATACTTGTATTGATTACTAATATTAATTTTTATATCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAAGTTCTTTTATACTTGTATTGATTACTAATATTAATTTTTATATCA  150

seq1  CATTATACATAACACCGTAATCATATTTGTCAATTTTCTATCTACATGTC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTATACATAACACCGTAATCATATTTGTCAATTTTCTATCTACATGTC  200

seq1  TGTATTTCTAGTTAGCCATCTATATTTTGGTTACAAAATGGTTACGGCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTTCTAGTTAGCCATCTATATTTTGGTTACAAAATGGTTACGGCTG  250

seq1  AAGCAGGGTTCAGGGAGTTCAAGGGCACTTCAACAGAGGGAGATACAGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGGGTTCAGGGAGTTCAAGGGCACTTCAACAGAGGGAGATACAGAG  300

seq1  CTCATAGGAATGAAGAAAATCCCTGCAGTGTTCAGGTATTAATGAATTAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCATAGGAATGAAGAAAATCCCTGCAGTGTTCAGGTATTAATGAATTAA  350

seq1  GTTGGAGAAATGTTAGAGGCACAGAACAATGAAGTTGAGCTGCAGAGGCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGAGAAATGTTAGAGGCACAGAACAATGAAGTTGAGCTGCAGAGGCT  400

seq1  GCAAGGTCACCGAGTTGAGCTGGGTGTTAGGGCAGAGTTGAGCTCCAGAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGGTCACCGAGTTGAGCTGGGTGTTAGGGCAGAGTTGAGCTCCAGAG  450

seq1  AGAAGTTGTGAGCTTGTGGAAGTGAAAGTCATGGATTCTAAATGCCTGAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGTTGTGAGCTTGTGGAAGTGAAAGTCATGGATTCTAAATGCCTGAA  500

seq1  TGCAGCACCATGGCAGGACAAGTTGCAAGACTGATCCAGAATGTTGACTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGCACCATGGCAGGACAAGTTGCAAGACTGATCCAGAATGTTGACTA  550

seq1  GGTCGATGGAAATCAGTTTGCATGAACTATATCAACAGTGGGAATCTAAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCGATGGAAATCAGTTTGCATGAACTATATCAACAGTGGGAATCTAAG  600

seq1  TTAAACTGATGCCCCCCCACCCCTTCCCCTACAACCAGGTACAGTTTGGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAACTGATGCCCCCCCACCCCTTCCCCTACAACCAGGTACAGTTTGGT  650

seq1  CCTTTGATGTACACATTGGCTGGTCAGATGACATGGTGGTGGGAGCTGTC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTGATGTACACATTGGCTGGTCAGATGACATGGTGGTGGGAGCTGTC  700

seq1  ACCAGTGCAGTGTTAGATACCCCCTTCTTAATGGGGTCTTGCACTCTTGG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGTGCAGTGTTAGATACCCCCTTCTTAATGGGGTCTTGCACTCTTGG  750

seq1  TTAGTCTATTGTGTTTCAGAACTTTGGGGGCCTGGCATTCTGATGTGACT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGTCTATTGTGTTTCAGAACTTTGGGGGCCTGGCATTCTGATGTGACT  800

seq1  TTCGTATACCCATATGTTCTGATCTATTCTGATAAGTTTATCTATTTTGG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCGTATACCCATATGTTCTGATCTATTCTGATAAGTTTATCTATTTTGG  850

seq1  TAGTACCTTCTGTTCTTTTTCATTGTTCTTAAAATAAATTATTTATTTAT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTACCTTCTGTTCTTTTTCATTGTTCTTAAAATAAATTATTTATTTAT  900

seq1  TTATTTATTTATTTATTTATTTATTTATTTATTTAATGTGACTGTTTGAG  950
      ||||||| ||||||||||||||| |||||||||||||||||||| |||||
seq2  TTATTTA-TTATTTATTTATTTA-TTATTTATTTAATGTGACTG-TTGAG  947

seq1  TGACTGCATGGTGCCTATATACAACCTGTGTGTCTGGTGTCTACAGAGGA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTGCATGGTGCCTATATACAACCTGTGTGTCTGGTGTCTACAGAGGA  997

seq1  CAGAAGA-GAATATCAGATTCCCTGGAACT-GGAGTTACAAACAGTTGTT  1048
       |||||| |||||||||||||||||||||| ||||||||||||||||| |
seq2  AAGAAGAGGAATATCAGATTCCCTGGAACTGGGAGTTACAAACAGTTG-T  1046

seq1  AGCTGCTGTGTGGGTACTGAAAATTGGACCAACGTTCTTTAGAAGAGCAG  1098
      ||||||||||||||||||| |||||||||||||||||  |||||||||||
seq2  AGCTGCTGTGTGGGTACTGGAAATTGGACCAACGTTC-CTAGAAGAGCAG  1095

seq1  -CCAATG-TAC-TTAAG-CACAC--TGAG-CACTCT-CCAGCCCC--AGG  1138
       |||||| ||| ||||| |||||   ||| | |||| ||||||||   ||
seq2  CCCAATGTTACTTTAAGCCACACCTGGAGCCCCTCTCCCAGCCCCCAGGG  1145

seq1  TC-GTACTACTTACTTATAGGTACAAGG-TACCAGTCTGTGCCTTATGGA  1186
      || ||||||||||||| || || ||||| ||| ||||||||||||  |  
seq2  TCGGTACTACTTACTT-TA-GTCCAAGGTTACAAGTCTGTGCCTTGAGTG  1193

seq1  TGCTGCTGGGCAAGTAATGTTGTTTGTGTGCACAA--TGAAGTTTGAAT  1233
       |  ||||| ||   ||  |||| |  ||||||||   |||||||||||
seq2  CGTCGCTGGCCA--GAA--TTGTGTCGGTGCACAAGTGGAAGTTTGAAT  1238

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information