MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-077C23
Chromosome	X (Build37)
Map Location	88,362,941 - 88,363,764
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gm370, LOC194615, LOC629471, LOC100041815, Gm44
Downstream gene	LOC670074, LOC667972, LOC667976, Mageb2, EG278167, EG667988, EG667993, EG385489, 1700084M14Rik, EG236891, LOC629542, Mageb5, LOC673766, LOC633484, LOC674396, EG278087, Mageb1, EG236892, EG236893
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm370 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212938 MGI:2685216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC194615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:194615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC629471 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629471
definition	note : ferritin heavy chain 1 pseudogene pseudo : _no_value

name	LOC100041815 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041815
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gm44 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212952 MGI:2684890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	LOC670074 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins

name	LOC667972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC667976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 Proteins pseudo : _no_value

name	Mageb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17146 MGI:105117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG278167 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278167 MGI:3643982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins

name	EG667988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667988 MGI:3646464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins

name	EG667993 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667993 MGI:3643555
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 32 Proteins pseudo : _no_value

name	EG385489 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385489 MGI:3648366
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1700084M14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73487 MGI:1920737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein

name	EG236891 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236891 MGI:3643138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 Proteins

name	LOC629542 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 12 Proteins

name	Mageb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74271 MGI:2148169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 13 Proteins

name	LOC673766 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC633484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633484
definition	note : melanoma antigen, family B pseudogene pseudo : _no_value

name	LOC674396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG278087 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278087 MGI:3645128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mageb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17145 MGI:105118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG236892 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236892 MGI:3643139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins

name	EG236893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236893 MGI:3643140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	Gm370 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20984541 GeneID:212938 MGI:2685216
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : gene model 370, (NCBI) transcript_id : XM_141921.1

name	Gm44 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20349082 GeneID:212952 MGI:2684890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : gene model 44, (NCBI) transcript_id : XM_111953.1

name	LOC670074 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271765 GeneID:670074
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : similar to Predicted gene, EG546347 transcript_id : XM_001477083.1

name	Mageb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13624318 GeneID:17146 MGI:105117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family B, 2 transcript_id : NM_031171.1

name	EG278167 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:25030909 GeneID:278167 MGI:3643982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins product : predicted gene, EG278167 transcript_id : XM_205261.1

name	EG667988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407637 GeneID:667988 MGI:3646464
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 22 Proteins product : predicted gene, EG667988 transcript_id : XM_993696.1

name	EG236891 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38087231 GeneID:236891 MGI:3643138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 43 Proteins product : predicted gene, EG236891 transcript_id : XM_141933.2

name	LOC629542 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407643 GeneID:629542
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 12 Proteins product : similar to Melanoma antigen, family B, 5 transcript_id : XM_204404.3

name	Mageb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407644 GeneID:74271 MGI:2148169
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 8 ESTs, 13 Proteins product : melanoma antigen, family B, 5 transcript_id : XM_284719.3

name	EG278087 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:136255945 GeneID:278087 MGI:3645128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG278087 transcript_id : NM_001083629.1

name	Mageb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:8659569 GeneID:17145 MGI:105118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family B, 1 transcript_id : NM_010759.1

name	EG236892 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407645 GeneID:236892 MGI:3643139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 42 Proteins product : predicted gene, EG236892 transcript_id : XM_141934.2

name	EG236893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20984657 GeneID:236893 MGI:3643140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : predicted gene, EG236893 transcript_id : XM_141935.1

name	Gm370 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984542 GeneID:212938 MGI:2685216
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141921.1

name	Gm44 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20349083 GeneID:212952 MGI:2684890
definition	codon_start : 1 product : similar to MAGE-B3 protein_id : XP_111953.1

name	LOC670074 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271766 GeneID:670074
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_001477133.1

name	Mageb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13624319 GeneID:17146 MGI:105117
definition	codon_start : 1 product : melanoma antigen, family B, 2 protein_id : NP_112448.1

name	EG278167 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:25030910 GeneID:278167 MGI:3643982
definition	codon_start : 1 product : similar to putative novel member of the melanoma antigen, family B (Mageb) gene family protein_id : XP_205261.1

name	EG667988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407638 GeneID:667988 MGI:3646464
definition	codon_start : 1 product : similar to putative novel member of the melanoma antigen, family B (Mageb) gene family protein_id : XP_998790.1

name	EG236891 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38087232 GeneID:236891 MGI:3643138
definition	codon_start : 1 product : similar to putative novel member of the melanoma antigen, family B (Mageb) gene family protein_id : XP_141933.2

name	LOC629542 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:25030920 GeneID:629542
definition	codon_start : 1 product : hypothetical protein protein_id : XP_204404.1

name	Mageb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28528822 GeneID:74271 MGI:2148169
definition	codon_start : 1 product : melanoma antigen, family B, 5 protein_id : XP_284719.1

name	EG278087 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:136255946 GeneID:278087 MGI:3645128
definition	codon_start : 1 note : melanoma antigen, family B, 2 product : predicted gene, EG278087 protein_id : NP_001077098.1

name	Mageb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8659570 CCDS:CCDS30267.1 GeneID:17145 MGI:105118
definition	codon_start : 1 product : melanoma antigen, family B, 1 protein_id : NP_034889.1

name	EG236892 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407646 GeneID:236892 MGI:3643139
definition	codon_start : 1 product : similar to MAGE-B3 protein_id : XP_141934.2

name	EG236893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984658 GeneID:236893 MGI:3643140
definition	codon_start : 1 product : similar to melanoma antigen, family B, 1 protein_id : XP_141935.1

name	LOC194615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194615
definition	number : 2 pseudo : _no_value

name	LOC194615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:194615
definition	number : 1 pseudo : _no_value

name	LOC100041815 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041815
definition	number : 2 pseudo : _no_value

name	LOC100041815 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041815
definition	number : 1 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 1 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 2 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 3 pseudo : _no_value

name	LOC667972 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667972
definition	number : 4 pseudo : _no_value

name	LOC667976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667976
definition	number : 3 pseudo : _no_value

name	LOC667976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667976
definition	number : 2 pseudo : _no_value

name	LOC667976 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667976
definition	number : 1 pseudo : _no_value

name	EG667993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667993
definition	number : 2 pseudo : _no_value

name	EG667993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667993
definition	number : 1 pseudo : _no_value

name	EG385489 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385489
definition	number : 1 pseudo : _no_value

name	LOC673766 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673766
definition	number : 1 pseudo : _no_value

name	LOC674396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674396
definition	number : 2 pseudo : _no_value

name	LOC674396 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674396
definition	number : 1 pseudo : _no_value

name	1700084M14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271818 GeneID:73487 MGI:1920737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 10 ESTs, 1 Protein product : RIKEN cDNA 1700084M14 gene transcript_id : XR_001621.2

clone name	MSMg01-422E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349M06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408I21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354I07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-503B07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-382K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-447M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-502I13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-150J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534F17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209A05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425F10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-457M24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-184D09
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-037I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310J08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073A16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-117G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308A21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064F20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168I02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-217F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name		B6Ng01-077C23.g
ACC		DH893228
length		825
definition		DH893228\|Mus musculus domesticus DNA, BAC clone: B6Ng01-077C23, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence		gaattcatctagattctaatttctaccttgatttaacaccctgtttcttt ctttctttctttctttctttctttctttctttctttctttctttctttct ttctttctttctttctttcttcctttctaagacagggtttctctgtatat ccctggctgtcctagaactcactttgtagaccaggctggccttgaactca gaaatctgcctgcctctgcctcccgagtgctaggattaaaggcttatgcc accacacctttttttttattattattattaaaaagtccaattttagtttt ttttttcttttattacctagaggaagttttcaaaaagactaaaaaatggc gtgcttcagagtaaatatctaaaaggtctgaaaatttgtaaatcacttta gtgctttatatagtagaacattgaattttatcattattcagtgtgttatc aatattcaggtttaatcagcagaggtgtcatctgaattttttgagtcttg cagcttttattctgacccatttttaaattttttctatgttaattaatgat tactttttgcctgtaaacagaaaatcacttggaaatcacttggatagtct gcctcttattattaggctggtagaatcaaacatcttactatatatttgca tgtagtaataatggtgccacaaattatttgtactgaatccaaataattaa aatttgaaaagataaattttattttattatcaggtatttactttttttga agagttctatgaccatgaactaggtaatatatatatatatatatatatat atatatatatatatatatatagttt
quality values		Open. Hide. 61 61 43 49 59 49 38 43 43 27 22 21 28 27 37 59 59 59 61 61 59 59 59 59 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 59 59 44 44 37 44 59 59 61 61 61 61 55 55 59 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 59 59 59 59 61 59 55 44 55 55 55 55 59 61 61 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 59 59 59 59 59 61 61 61 61 59 59 59 50 59 59 59 59 55 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 61 61 61 61 61 61 61 59 59 52 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 59 43 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 47 47 50 53 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 61 52 61 61 61 61 61 61 61 61 61 61 61 61 61 57 43 53 57 53 53 53 53 53 47 53 47 57 57 57 57 57 57 57 57 57 50 57 57 57 53 57 57 57 57 57 53 57 57 57 53 53 57 53 53 57 53 53 47 57 57 57 53 57 45 57 57 57 57 57 46 38 53 52 52 53 52 53 53 52 53 50 57 26 53 38 39 53 38 38 47 38 34 27 52 52 57 33 50 41 52 53 45 53 53 57 57 53 42 57 53 57 57 47 52 43 53 50 53 52 37 34 57 57 52 50 37 50 57 50 53 40 36 57 34 40 53 50 34 57 57 38 53 40 52 31 53 35 53 53 40 57 35 40 57 53 44 36 37 52 43 53 53 57 33 52 52 23 57 53 43 32 48 48 47 53 57 53 45 32 57 57 53 53 57 57 45 37 40 27 40 57 33 32 57 57 33 37 38 57 51 30 35 30 47 44 44 40 29 18 46 29 30 34 51 47 30 40 28 51 51 51 46 51 30 30 32 48 30 47 25 34 28 33 29 31 31 29 30 29 47 24 29 41 45 43 41 29 29 29 51 28 31 39 33 37 33 29 43 43 46 41 46 43 43 46 43 29 32 39 43 29 46 22 18 24 27 16 21 22 39 30 39 27 39 29 36 26 31 19 31 25 21 19 30 10 39 23 12 7 26 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_88362941_88363764
seq2: B6Ng01-077C23.g_69_893 (reverse)

seq1  AAACTATATATATATATATATATATATATATATATATATATATATATATT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTATATATATATATATATATATATATATATATATATATATATATATT  50

seq1  ACCTAGTTCATGGTCATAGAACTCTTC-AAAAAAGTAAATACCTGATAAT  99
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  ACCTAGTTCATGGTCATAGAACTCTTCAAAAAAAGTAAATACCTGATAAT  100

seq1  AAAATAAAATTTATCTTTTCAAATTTTAATTATTTGGATTCAGTACAAAT  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAAAATTTATCTTTTCAAATTTTAATTATTTGGATTCAGTACAAAT  150

seq1  AATTTGTGGCACCATTATTACTACATGCAAATATATAGTAAGATGTTTGA  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTGTGGCACCATTATTACTACATGCAAATATATAGTAAGATGTTTGA  200

seq1  TTCTACCAGCCTAATAATAAGAGGCAGACTATCCAAGTGATTTCCAAGTG  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTACCAGCCTAATAATAAGAGGCAGACTATCCAAGTGATTTCCAAGTG  250

seq1  ATTTTCTGTTTACAGGCAAAAAGTAATCATTAATTAACATAGAAAAAATT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCTGTTTACAGGCAAAAAGTAATCATTAATTAACATAGAAAAAATT  300

seq1  TAAAAATGGGTCAGAATAAAAGCTGCAAGACTCAAAAAATTCAGATGACA  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAATGGGTCAGAATAAAAGCTGCAAGACTCAAAAAATTCAGATGACA  350

seq1  CCTCTGCTGATTAAACCTGAATATTGATAACACACTGAATAATGATAAAA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGCTGATTAAACCTGAATATTGATAACACACTGAATAATGATAAAA  400

seq1  TTCAATGTTCTACTATATAAAGCACTAAAGTGATTTACAAATTTTCAGAC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAATGTTCTACTATATAAAGCACTAAAGTGATTTACAAATTTTCAGAC  450

seq1  CTTTTAGATATTTACTCTGAAGCACGCCATTTTTTAGTCTTTTTGAAAAC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTAGATATTTACTCTGAAGCACGCCATTTTTTAGTCTTTTTGAAAAC  500

seq1  TTCCTCTAGGTAATAAAAGAAAAAAAAAACTAAAATTGGACTTTTTAATA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCTAGGTAATAAAAGAAAAAAAAAACTAAAATTGGACTTTTTAATA  550

seq1  ATAATAATAAAAAAAAAGGTGTGGTGGCATAAGCCTTTAATCCTAGCACT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAATAATAAAAAAAAAGGTGTGGTGGCATAAGCCTTTAATCCTAGCACT  600

seq1  CGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCAAGGCCAGCCTGGTCTAC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGGGAGGCAGAGGCAGGCAGATTTCTGAGTTCAAGGCCAGCCTGGTCTAC  650

seq1  AAAGTGAGTTCTAGGACAGCCAGGGATATACAGAGAAACCCTGTCTTAGA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGTGAGTTCTAGGACAGCCAGGGATATACAGAGAAACCCTGTCTTAGA  700

seq1  AAGGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA  750

seq1  GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACAGGGTGTTAAATCAAGG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAACAGGGTGTTAAATCAAGG  800

seq1  TAGAAATTAGAATCTAGATGAATTC  824
      |||||||||||||||||||||||||
seq2  TAGAAATTAGAATCTAGATGAATTC  825

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information