MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-088G17
Chromosome	X (Build37)
Map Location	151,642,130 - 151,643,299
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC270665, LOC100040076, 4930524N10Rik, EG434879, LOC667313, 4930542N07Rik, EG434881, LOC100040899, LOC667331, LOC100040925, LOC100040937, Magea6, Magea3, LOC626034, Magea8, Magea2, Magea5, Magea1, 1700042B14Rik, LOC245676, Amd-ps1, LOC667369
Downstream gene	Sat1, Acot9, LOC667383, Prdx4, LOC667394, Ptchd1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC270665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100040076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930524N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75071 MGI:1922321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	EG434879 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434879 MGI:3643220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC667313 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930542N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75185 MGI:1922435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434881 MGI:3646587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC667331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 7 Proteins pseudo : _no_value

name	LOC100040925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein

name	LOC100040937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins

name	Magea6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17142 MGI:1333837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17139 MGI:1333832
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626034 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins pseudo : _no_value

name	Magea8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17144 MGI:1333827
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17138 MGI:1333793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17141 MGI:1333838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17137 MGI:1333834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700042B14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73347 MGI:1920597
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC245676 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:245676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins pseudo : _no_value

name	Amd-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11701 MGI:1310005
definition	gene_synonym : Amd3 note : S-adenosylmethionine decarboxylase, pseudogene 1 pseudo : _no_value

name	LOC667369 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667369
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Sat1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20229 MGI:98233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acot9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56360 MGI:1928939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667383 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	Prdx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53381 MGI:1859815
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 4 Proteins pseudo : _no_value

name	Ptchd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:211612 MGI:2685233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 4 Proteins

name	EG434879 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408465 GeneID:434879 MGI:3643220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : predicted gene, EG434879 transcript_id : XM_486805.3

name	4930542N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802341 GeneID:75185 MGI:1922435
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930542N07 gene transcript_id : NM_029199.2

name	EG434881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81230475 GeneID:434881 MGI:3646587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434881 transcript_id : NM_001037167.1

name	LOC100040899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272513 GeneID:100040899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Predicted gene, EG434881 transcript_id : XM_001475438.1

name	LOC100040925 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272515 GeneID:100040925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 9 ESTs, 1 Protein product : hypothetical protein LOC100040925 transcript_id : XM_001475475.1

name	LOC100040937 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272517 GeneID:100040937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 3 Proteins product : hypothetical protein LOC100040937 transcript_id : XM_001475498.1

name	Magea6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115430104 GeneID:17142 MGI:1333837
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 6 transcript_id : NM_020019.3

name	Magea3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910399 GeneID:17139 MGI:1333832
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 3 transcript_id : NM_020017.1

name	Magea8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142362870 GeneID:17144 MGI:1333827
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 8 transcript_id : NM_020020.3

name	Magea2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426896 GeneID:17138 MGI:1333793
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 2 transcript_id : NM_020016.1

name	Magea5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9910401 GeneID:17141 MGI:1333838
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 5 transcript_id : NM_020018.1

name	Magea1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21426894 GeneID:17137 MGI:1333834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 1 transcript_id : NM_020015.1

name	1700042B14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157452 GeneID:73347 MGI:1920597
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700042B14 gene transcript_id : NM_001081671.1

name	Sat1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476316 GeneID:20229 MGI:98233
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermidine/spermine N1-acetyl transferase 1 transcript_id : NM_009121.3

name	Acot9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980997 GeneID:56360 MGI:1928939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA thioesterase 9 transcript_id : NM_019736.2

name	LOC667383 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408468 GeneID:667383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to ring finger protein 168 transcript_id : XM_990244.1

name	Prdx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387935 GeneID:53381 MGI:1859815
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : peroxiredoxin 4 transcript_id : NM_016764.2

name	Ptchd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408470 GeneID:211612 MGI:2685233
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 7 ESTs, 4 Proteins product : patched domain containing 1, transcript variant 1 transcript_id : XM_142262.5

name	EG434879 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408466 GeneID:434879 MGI:3643220
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486805.3

name	4930542N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386374 CCDS:CCDS30486.1 GeneID:75185 MGI:1922435
definition	codon_start : 1 product : hypothetical protein LOC75185 protein_id : NP_083475.1

name	EG434881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230476 CCDS:CCDS30487.1 GeneID:434881 MGI:3646587
definition	codon_start : 1 product : hypothetical protein LOC434881 protein_id : NP_001032244.1

name	LOC100040899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272514 GeneID:100040899
definition	codon_start : 1 product : similar to Predicted gene, EG434881 protein_id : XP_001475488.1

name	LOC100040925 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272516 GeneID:100040925
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475525.1

name	LOC100040937 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272518 GeneID:100040937
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475548.1

name	Magea6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910404 CCDS:CCDS30488.1 GeneID:17142 MGI:1333837
definition	codon_start : 1 product : melanoma antigen family A, 6 protein_id : NP_064403.1

name	Magea3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910400 CCDS:CCDS30489.1 GeneID:17139 MGI:1333832
definition	codon_start : 1 exception : mismatches in translation product : melanoma antigen family A, 3 protein_id : NP_064401.1

name	Magea8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910406 CCDS:CCDS30490.1 GeneID:17144 MGI:1333827
definition	codon_start : 1 product : melanoma antigen family A, 8 protein_id : NP_064404.1

name	Magea2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426897 CCDS:CCDS30491.1 GeneID:17138 MGI:1333793
definition	codon_start : 1 product : melanoma antigen family A, 2 protein_id : NP_064400.1

name	Magea5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9910402 CCDS:CCDS30492.1 GeneID:17141 MGI:1333838
definition	codon_start : 1 product : melanoma antigen family A, 5 protein_id : NP_064402.1

name	Magea1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21426895 CCDS:CCDS30493.1 GeneID:17137 MGI:1333834
definition	codon_start : 1 product : melanoma antigen family A, 1 protein_id : NP_064399.1

name	1700042B14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157453 GeneID:73347 MGI:1920597
definition	GO_component : GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73347 protein_id : NP_001075140.1

name	Sat1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677849 CCDS:CCDS30495.1 GeneID:20229 MGI:98233
definition	GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0004145 - diamine N-acetyltransferase activity [Evidence IEA]; GO:0008080 - N-acetyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0046208 - spermine catabolism [Evidence TAS] codon_start : 1 product : spermidine/spermine N1-acetyl transferase 1 protein_id : NP_033147.1

name	Acot9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980998 GeneID:56360 MGI:1928939
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0003986 - acetyl-CoA hydrolase activity [Evidence IDA]; GO:0016291 - acyl-CoA thioesterase activity [Evidence IDA]; GO:0016290 - palmitoyl-CoA hydrolase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006637 - acyl-CoA metabolism [Evidence TAS] [Evidence IDA] codon_start : 1 note : mitochondrial acyl-CoA thioesterase product : acyl-Coenzyme A thioesterase 2, mitochondrial protein_id : NP_062710.2

name	LOC667383 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408469 GeneID:667383
definition	codon_start : 1 product : similar to ring finger protein 168 protein_id : XP_995338.1

name	Prdx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7948999 CCDS:CCDS30496.1 GeneID:53381 MGI:1859815
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0016209 - antioxidant activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004601 - peroxidase activity [Evidence IEA]; GO:0051920 - peroxiredoxin activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : antioxidant enzyme AOE372; Prx IV product : peroxiredoxin 4 protein_id : NP_058044.1

name	Ptchd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086898 GeneID:211612 MGI:2685233
definition	codon_start : 1 product : similar to patched domain containing 1 isoform 1 protein_id : XP_142262.3

name	LOC270665 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:270665
definition	number : 1 pseudo : _no_value

name	LOC100040076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040076
definition	number : 2 pseudo : _no_value

name	LOC100040076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040076
definition	number : 1 pseudo : _no_value

name	LOC667313 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667313
definition	number : 1 pseudo : _no_value

name	LOC667313 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667313
definition	number : 2 pseudo : _no_value

name	LOC667369 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667369
definition	number : 1 pseudo : _no_value

name	LOC667369 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667369
definition	number : 2 pseudo : _no_value

name	LOC667369 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667369
definition	number : 3 pseudo : _no_value

name	Amd-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : Amd3 product : S-adenosylmethionine decarboxylase pseudo : _no_value

name	4930524N10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408464 GeneID:75071 MGI:1922321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : RIKEN cDNA 4930524N10 gene transcript_id : XR_001603.1

name	LOC667331 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272486 GeneID:667331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 7 Proteins product : similar to non-imprinted in Prader-Willi/Angelman syndrome 2 pseudo : _no_value transcript_id : XR_031557.1

name	LOC626034 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272523 GeneID:626034
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 27 ESTs, 2 Proteins product : similar to Transmembrane and TPR repeat-containing protein 3 pseudo : _no_value transcript_id : XR_032305.1

name	LOC245676 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272524 GeneID:245676
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 4 Proteins product : similar to ribosomal protein S20 pseudo : _no_value transcript_id : XR_032431.1

name	LOC667394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272525 GeneID:667394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 4 Proteins product : similar to ribosomal protein L6 pseudo : _no_value transcript_id : XR_032467.1

clone name	MSMg01-307M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483N03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-315D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434H02
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-082F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-425D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343D11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-434I01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-084F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296A07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-423A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-430G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294K20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-121C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-517C01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-369F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-297O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255M21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344P19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-344J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-338A05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-055M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155N09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-088G17.b	B6Ng01-088G17.g
ACC	DH901274	DH901275
length	1,176	965
definition	DH901274\|Mus musculus domesticus DNA, BAC clone: B6Ng01-088G17, 5' end.	DH901275\|Mus musculus domesticus DNA, BAC clone: B6Ng01-088G17, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcacagctttctattttgataatgtcagaggcacagcagggagagc cttttcaatggaggctctgagtggggccattcactccaggattgcggagg gtgggttccatcaacagtgccgcctttcacctggtactcaactgctttca tctagcaaatccaaaacaaaaatagtttcacaacagccaaatcagcgagt gtatggacatatgcctatgatgctctggaaactacagtaagaagatctat agttaaaggccagttgaggtaacatggaaagattccactgcaacaagcaa acaaacaaacgaattacaaaagcaaacaaacaaaaacagtggtaacgtct gaaacaaatgtaaaaggcagctaaatgaattagtccctttttctggcaaa gagacatagtccagaagcactttgggtctggtgaatatttgactttgtgt caaacaaatttaaactagatcctggctctttatggtaataaaaataaact tcattgaacttttgagatgactccagacgttaaggcacttgccacacagc ctgacaacctcagttgtatccctgggaccccactcaggggaaggagagaa tcaactcccacaagttgtctgtgctctgccacacacacacacacacacac acacacacacacacgtaaacttttaaaatttctgaaactaaaaataaatt gctagagttcctgtgataattaaatgagaacatgaattcagaatgcatat tactactatattttttatcacttctctttcctttcttccttccttcttta ggacagggttctgtatattccaggttggccttggacttgttatgtagctt tagatgatcatggttaaatcacctgcattgactcctggaagcctccccta tcccaggtctctgggacttcctagagatttcccctactccccaaccccta ctccctggcagctgcagatttccagtcattctcctggccctttggggttt ctctcctgtcctctctccaccacctgatcttactccccaatctcctcctc atcagctttcccaccccacttccttcctagtttgcctctttctgaactat ttttattccccccttctaagtaagatcatgcaatcttgccttgccccttt ccttcctgtttagcttctttgggttt	gaattctctgccctaccttaaccacttgttgacatgtgaaaaggaacaaa aaggcttctaacactggagaaagttcaaggccagacatccctcgtaaagc tgtaatgtcccgcagttctggttcgcgaacgagggatctcccttgcgcca gtgtgatggtagttcccgggttcctcggcgccacttattgcccgagcttt tgtccccaccggcaagaacacactcaggaaaaacggaatcttctgcggca aagcttttattgcttacttatcaggagggaagaccccaaaccgggaaaat ggcgctgcttatatagcccgaagcgtgacgtttcatcacctgatgtggcc tgacagctcctgatttcttgctcgcccatcaccccattactaccccgaga tatgggcagtgactatgagtgagttcactcttgcacttgtgcataaggct tgttcactagttaggtgcagtggaagccagcgccatcttataatggcgat tgctcacagcgcgcacatgattgctcgtggcacagctctccacagagaag gattctcacagccaaccattggactgagtgtggggccccagatgaaatag taagaaatgggctgatgaagcagatgcagccccatgattggagccacagt gtcaaagtccaaatccccaagagttcctggagactggactaaaaaacaaa tagtatatatgaagggactagttcatatgaggtagaggatggccttgctg gacatcagtgggaggataggcccttgggcctgtgggggtttgatgcccca gtttaggagaatctcagagatggaaggtgcaagtgagtagatgagaggag gagcaccctcattgagcagtggagggaggaggggatagggatttccatcg ggagactgaagggaaacttttgaatataataagaaaatccaaaaggaaag attatttctccttct
quality values	Open. Hide. 57 42 39 33 61 23 17 39 33 61 61 61 61 50 61 61 61 61 61 61 61 35 61 47 61 16 12 7 6 9 11 14 17 10 30 27 25 36 32 36 59 61 61 61 61 37 59 61 61 61 61 59 61 61 61 59 59 61 61 61 59 59 61 61 61 59 61 61 18 17 10 13 18 12 18 20 11 35 30 35 36 44 52 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 52 52 41 19 29 34 36 43 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 52 55 52 29 52 50 36 34 37 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 37 61 47 61 61 52 61 61 61 52 52 61 61 47 61 61 61 61 61 61 53 61 61 61 61 61 61 61 53 61 53 57 53 53 53 57 57 57 57 53 47 53 57 47 53 53 57 53 57 57 57 53 53 57 53 47 47 57 47 42 57 42 43 53 53 57 50 53 57 53 50 47 47 47 57 57 47 24 47 57 47 57 50 57 53 43 53 53 57 53 57 53 47 47 50 50 53 57 53 57 57 57 57 57 57 57 50 57 53 57 53 57 57 53 53 53 53 57 53 57 57 52 57 57 57 57 52 41 52 57 53 57 57 52 57 57 57 57 57 57 57 53 52 57 53 53 46 53 53 50 53 53 52 52 39 57 57 57 39 40 57 57 39 50 57 53 44 53 37 57 33 33 35 50 38 57 57 57 57 37 39 57 37 33 57 52 31 38 52 37 52 33 52 39 26 53 53 53 48 53 31 31 53 28 38 26 24 57 40 37 53 44 29 53 33 29 28 41 53 52 32 41 43 37 24 24 43 37 34 53 34 36 53 40 53 36 39 37 33 33 53 37 41 48 39 31 57 57 57 57 41 36 32 41 27 33 46 48 48 30 44 30 51 30 22 33 33 51 32 39 34 31 30 38 29 29 21 30 30 32 34 39 51 39 25 8 30 30 17 29 14 51 41 28 29 29 34 36 28 39 37 34 33 30 29 27 29 14 38 30 31 29 47 21 31 29 29 32 31 20 23 14 22 29 22 29 22 25 33 33 28 28 28 39 51 38 29 28 41 30 36 35 26 30 30 33 29 46 28 22 51 51 51 31 38 30 29 32 29 43 30 28 28 32 26 28 35 29 28 29 28 36 28 39 31 23 31 26 34 23 32 26 28 28 38 33 28 46 26 28 26 26 27 28 29 23 24 33 51 29 27 19 27 31 18 31 23 27 19 39 23 20 11 44 29 33 46 38 29 34 31 30 34 34 46 36 20 18 23 30 30 26 32 26 31 28 29 26 36 27 23 20 22 14 28 31 28 28 19 21 28 15 28 14 51 30 9 17 27 26 28 34 27 20 28 27 12 6 32 25 24 17 14 44 25 24 44 17 14 42 39 12 22 36 15 15 15 18 16 8 39 14 30 17 17 5 4 4 6 14 18 24 11 7 5 7 6 10 25 11 23 30 17 17 17 28 8 5 4 8 42 30 31 8 7 29 10 14 9 19 4 8 15 4 6 8 16 28 21 7 19 11 28 14 7 29 9 14 16 29 30 14 13 13 12 8 14 11 7 12 31 26 4 15 6 18 32 19 9 20 24 11 8 6 21 16 14 8 9 24 5 5 9 16 15 20 26 27 14 11 10 17 9 21 35 30 30 13 5 5 23 8 21 24 5 3 13 20 9 19 11 10 14 14 25 11 5 6 4 6 3 8 16 7 10 11 7 6 1 4 14 7 15 8 6 10 16 13 16 7 16 6 15 4 13 3 7 10 9 3 6 8 13 21 7 10 13 7 17 24 7	Open. Hide. 55 61 59 59 61 61 17 13 12 11 12 12 13 23 12 12 36 36 44 59 59 61 59 49 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 39 34 39 44 36 43 59 43 44 49 49 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 55 59 61 61 61 61 61 61 61 59 59 59 55 59 61 61 61 61 61 61 61 59 61 61 55 55 59 61 61 61 61 61 61 61 61 61 61 61 59 59 59 55 59 61 61 61 59 61 61 59 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 50 55 55 47 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 50 55 55 50 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 53 61 47 61 53 61 61 61 61 61 61 61 61 61 53 53 61 61 61 53 52 61 52 61 61 61 61 53 61 52 61 61 45 61 50 61 61 31 61 39 30 61 61 61 61 53 61 53 53 53 24 27 61 61 61 53 61 61 61 50 47 34 53 53 57 52 53 57 45 57 57 53 42 31 47 25 47 52 40 53 50 53 53 46 57 52 53 45 43 53 57 45 57 57 53 52 57 57 53 53 57 53 53 43 47 57 57 38 53 57 35 53 30 52 53 50 36 38 50 45 52 26 52 52 52 50 53 57 41 53 45 47 38 32 53 38 53 53 57 50 52 41 28 41 38 47 35 32 32 37 52 53 21 32 32 43 28 53 40 57 23 47 38 35 47 30 53 57 53 40 53 42 45 53 37 39 37 38 30 57 57 57 53 50 37 34 19 37 52 52 31 31 52 53 53 40 34 31 39 53 23 13 57 47 36 25 37 44 30 53 52 32 37 42 43 41 42 33 6 25 21 52 36 53 28 47 33 12 52 41 13 29 29 40 40 35 44 38 40 35 28 29 40 28 33 28 34 37 57 37 26 10 37 40 17 29 13 29 18 37 35 19 20 31 53 45 28 37 30 44 15 17 51 46 46 37 27 51 43 29 36 25 29 28 31 30 32 17 24 36 51 33 28 12 30 48 25 39 24 36 33 35 27 18 5 45 10 21 19 43 25 23 48 16 41 18 34 18 18 26 24 29 29 47 17 21 29 14 30 20 20 36 10 30 25 14 27 28 28 29 20 26 12 25 21 21 27 25 23 28 33 29 10 7 8 6 6 6 22 29 33 24 46 31 29 24 29 31 32 41 39 29 7 6 21 27 38 24 17 14 14 19 15 6 5 4 5 5 6 30 23 8 5 22 25 30 17 15 7 20 8 7 5 7 10 8 24 26 24 5 7 7 8 16 11 8 6 9 6 10 21 18 12 9 6 12 17 13 7 5 6 6 12 11 7 7 13 5 12 6 14 5 8 12 7 5 14 8 14 10 8 6 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_151642130_151643299
seq2: B6Ng01-088G17.b_43_1218 (reverse)

seq1  AAACCCAAAGAAGCTAAACAGGAAGGAA--GGGCCAAGCAAGGATGCATG  48
      ||||||||||||||||||||||||||||  |||| | |||||  ||||||
seq2  AAACCCAAAGAAGCTAAACAGGAAGGAAAGGGGCAAGGCAAGATTGCATG  50

seq1  AATCTTACTTAGAA-GGGGGAAT-AAAATAG-TCAG-AAGAGGCAAAACT  94
       ||||||||||||| |||||||| ||||||| |||| ||||||| |||||
seq2  -ATCTTACTTAGAAGGGGGGAATAAAAATAGTTCAGAAAGAGGC-AAACT  98

seq1  AGGGAGGGAAGT-GGGTGGGAAAGCTGATGAGGAGGAGAATGGGGAGTAA  143
      | ||| |||||| |||||||||||||||||||||||||| ||||||||||
seq2  A-GGAAGGAAGTGGGGTGGGAAAGCTGATGAGGAGGAGATTGGGGAGTAA  147

seq1  GATCAGGT-GTGGAGAGA-GACAGGAGAGAAA-CCCAAAGGGCCAGGAGA  190
      |||||||| ||||||||| ||||||||||||| |||||||||||||||||
seq2  GATCAGGTGGTGGAGAGAGGACAGGAGAGAAACCCCAAAGGGCCAGGAGA  197

seq1  ATGACTGGAAATCTGCAGCTGCCAGGGAGTAGGGGTTGGGGAGTAGGGGA  240
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACTGGAAATCTGCAGCTGCCAGGGAGTAGGGGTTGGGGAGTAGGGGA  247

seq1  AATCTCTAGGAAGTCCCAGAGACCTGGGATAGGGGAGGCTTCCAGGAGTC  290
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCTCTAGGAAGTCCCAGAGACCTGGGATAGGGGAGGCTTCCAGGAGTC  297

seq1  AATGCAGGTGATTTTAACCATGATCATCTAAAGCTACATAACAAGTCCAA  340
      ||||||||||| ||||||||||||||||||||||||||||||||||||||
seq2  AATGCAGGTGA-TTTAACCATGATCATCTAAAGCTACATAACAAGTCCAA  346

seq1  GGCCAACCTGGAATATACAGAACCCTGTCCTAAAGAAGGAAGGAAGAAAG  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCAACCTGGAATATACAGAACCCTGTCCTAAAGAAGGAAGGAAGAAAG  396

seq1  GAAAGAGAAGTGATAAAAAATATAGTAGTAATATGCATTCTGAATTCATG  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAGAAGTGATAAAAAATATAGTAGTAATATGCATTCTGAATTCATG  446

seq1  TTCTCATTTAATTATCACAGGAACTCTAGCAATTTATTTTTAGTTTCAGA  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCATTTAATTATCACAGGAACTCTAGCAATTTATTTTTAGTTTCAGA  496

seq1  AATTTTAAAAGTTTACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTAAAAGTTTACGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT  546

seq1  GGCAGAGCACAGACAACTTGTGGGAGTTGATTCTCTCCTTCCCCTGAGTG  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAGAGCACAGACAACTTGTGGGAGTTGATTCTCTCCTTCCCCTGAGTG  596

seq1  GGGTCCCAGGGATACAACTGAGGTTGTCAGGCTGTGTGGCAAGTGCCTTA  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTCCCAGGGATACAACTGAGGTTGTCAGGCTGTGTGGCAAGTGCCTTA  646

seq1  ACGTCTGGAGTCATCTCAAAAGTTCAATGAAGTTTATTTTTATTACCATA  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGTCTGGAGTCATCTCAAAAGTTCAATGAAGTTTATTTTTATTACCATA  696

seq1  AAGAGCCAGGATCTAGTTTAAATTTGTTTGACACAAAGTCAAATATTCAC  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGCCAGGATCTAGTTTAAATTTGTTTGACACAAAGTCAAATATTCAC  746

seq1  CAGACCCAAAGTGCTTCTGGACTATGTCTCTTTGCCAGAAAAAGGGACTA  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACCCAAAGTGCTTCTGGACTATGTCTCTTTGCCAGAAAAAGGGACTA  796

seq1  ATTCATTTAGCTGCCTTTTACATTTGTTTCAGACGTTACCACTGTTTTTG  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCATTTAGCTGCCTTTTACATTTGTTTCAGACGTTACCACTGTTTTTG  846

seq1  TTTGTTTGCTTTTGTAATTCGTTTGTTTGTTTGCTTGTTGCAGTGGAATC  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGTTTGCTTTTGTAATTCGTTTGTTTGTTTGCTTGTTGCAGTGGAATC  896

seq1  TTTCCATGTTACCTCAACTGGCCTTTAACTATAGATCTTCTTACTGTAGT  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCATGTTACCTCAACTGGCCTTTAACTATAGATCTTCTTACTGTAGT  946

seq1  TTCCAGAGCATCATAGGCATATGTCCATACACTCGCTGATTTGGCTGTTG  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAGAGCATCATAGGCATATGTCCATACACTCGCTGATTTGGCTGTTG  996

seq1  TGAAACTATTTTTGTTTTGGATTTGCTAGATGAAAGCAGTTGAGTACCAG  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAACTATTTTTGTTTTGGATTTGCTAGATGAAAGCAGTTGAGTACCAG  1046

seq1  GTGAAAGGCGGCACTGTTGATGGAACCCACCCTCCGCAATCCTGGAGTGA  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAAGGCGGCACTGTTGATGGAACCCACCCTCCGCAATCCTGGAGTGA  1096

seq1  ATGGCCCCACTCAGAGCCTCCATTGAAAAGGCTCTCCCTGCTGTGCCTCT  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCCCACTCAGAGCCTCCATTGAAAAGGCTCTCCCTGCTGTGCCTCT  1146

seq1  GACATTATCAAAATAGAAAGCTGTGAATTC  1170
      ||||||||||||||||||||||||||||||
seq2  GACATTATCAAAATAGAAAGCTGTGAATTC  1176

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information