MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-095M06
Chromosome	X (Build37)
Map Location	13,572,497 - 13,573,653
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Usp9x, LOC100043000, LOC100043002, LOC675380, Ddx3x, LOC385326, LOC634019, LOC668990, LOC100043947, LOC100043948, Nyx, LOC675416, Cask, Gpr34, Gpr82, LOC385327
Downstream gene	EG385328, LOC668991
Link	Open Mouse BAC browser

Click to get alignment info.

name	Usp9x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 2589 ESTs, 8 Proteins

name	LOC100043002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins

name	LOC675380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ddx3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins pseudo : _no_value

name	LOC634019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins pseudo : _no_value

name	LOC668990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Nyx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236690 MGI:2448607
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675416 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins pseudo : _no_value

name	Cask (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12361 MGI:1309489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23890 MGI:1346334
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr82 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319200 MGI:2441734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385327 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385327
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG385328 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385328 MGI:3643774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668991 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	Usp9x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511017 GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 9, X chromosome transcript_id : NM_009481.2

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270990 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 2286 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 2 transcript_id : XM_001477279.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270992 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1965 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 3 transcript_id : XM_001477304.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270988 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1391 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 1 transcript_id : XM_001477264.1

name	LOC100043002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270994 GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins product : hypothetical protein LOC100043002 transcript_id : XM_001477326.1

name	Ddx3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129795 GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked transcript_id : NM_010028.2

name	LOC100043947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271049 GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to preferentially expressed antigen in melanoma like 7 transcript_id : XM_001481255.1

name	Nyx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352047 GeneID:236690 MGI:2448607
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nyctalopin transcript_id : NM_173415.3

name	Cask (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133504494 GeneID:12361 MGI:1309489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : calcium/calmodulin-dependent serine protein kinase (MAGUK family) transcript_id : NM_009806.2

name	Gpr34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142358042 GeneID:23890 MGI:1346334
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 34 transcript_id : NM_011823.3

name	Gpr82 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802746 GeneID:319200 MGI:2441734
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 82 transcript_id : NM_175669.3

name	EG385328 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:77539461 GeneID:385328 MGI:3643774
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG385328 transcript_id : NM_001034100.1

name	Usp9x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511018 GeneID:22284 MGI:894681
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : fats facets protein related, X; ubiquitin specific protease 9 SSSRF- isoform product : ubiquitin specific protease 9, X chromosome protein_id : NP_033507.2

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270989 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 1 protein_id : XP_001477314.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270991 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 2 protein_id : XP_001477329.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270993 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 3 protein_id : XP_001477354.1

name	LOC100043002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270995 GeneID:100043002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477376.1

name	Ddx3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753620 CCDS:CCDS30027.1 GeneID:13205 MGI:103064
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 3; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 3; embryonic RNA helicase; fibroblast growth factor inducible 14 product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked protein_id : NP_034158.1

name	LOC100043947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271050 GeneID:100043947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481305.1

name	Nyx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734150 GeneID:236690 MGI:2448607
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence IMP] codon_start : 1 note : no b wave product : nyctalopin protein_id : NP_775591.1

name	Cask (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133504495 GeneID:12361 MGI:1309489
definition	GO_component : GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005829 - cytosol [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0045202 - synapse [Evidence IDA]; GO:0019717 - synaptosome [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : calcium/calmodulin-dependent serine protein kinase protein_id : NP_033936.2

name	Gpr34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560528 CCDS:CCDS30028.1 GeneID:23890 MGI:1346334
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : G-protein-coupled receptor product : G protein-coupled receptor 34 protein_id : NP_035953.2

name	Gpr82 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28316782 CCDS:CCDS30029.1 GeneID:319200 MGI:2441734
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR82 product : G protein-coupled receptor 82 protein_id : NP_783600.1

name	EG385328 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77539462 GeneID:385328 MGI:3643774
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 note : novel protein similar to histone 1, H2a Hist1h2a product : hypothetical protein LOC385328 protein_id : NP_001029272.1

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 1 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 3 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 4 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 5 pseudo : _no_value

name	LOC100043948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043948
definition	number : 1 pseudo : _no_value

name	LOC385327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385327
definition	number : 3 pseudo : _no_value

name	LOC385327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385327
definition	number : 2 pseudo : _no_value

name	LOC385327 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385327
definition	number : 1 pseudo : _no_value

name	LOC385326 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271047 GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins product : similar to Chaperonin subunit 7 (eta) pseudo : _no_value transcript_id : XR_035070.1

name	LOC634019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270996 GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_033207.1

name	LOC668990 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271048 GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to vitamin D receptor interacting protein pseudo : _no_value transcript_id : XR_035071.1

name	LOC675416 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271051 GeneID:675416
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 5 Proteins product : similar to E1B 19K/Bcl-2-binding protein homolog pseudo : _no_value transcript_id : XR_035072.1

name	LOC668991 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270997 GeneID:668991
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to ribosomal protein L6 pseudo : _no_value transcript_id : XR_033255.1

clone name	MSMg01-147B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-527G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-196F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-111G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536J11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-440F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143M01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-453D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510I16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-068C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-090D02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459E17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-526H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-344F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065M07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-262J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-090I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-068A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-074L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126N19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-085F10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-292J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327G16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-095M06.b	B6Ng01-095M06.g
ACC	DH906616	DH906617
length	1,145	1,156
definition	DH906616\|Mus musculus domesticus DNA, BAC clone: B6Ng01-095M06, 5' end.	DH906617\|Mus musculus domesticus DNA, BAC clone: B6Ng01-095M06, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctgaactgactgtgtcaaaaaaaatcatattcctgttgaatgtta cagagcttggcaacagcaggagacttggcctggcagccagaaaaagcaag tcccttcattgacatgttacaattagcacccatggagacagcagcttatg tacagtccactgtttgtaactactagttgggagttttggcatgaaggcat ttcctatggtacagtgcttagcagctagaagtcagaaatttacttcttta taatgcaaaatttaaggcttttcctgattaagtacaaagactcattaaag caaaaagcaaaaagcaatacatttggaacaagagactacttacaggatac aaaaatgaggtcagcagggcagtaaagaaatgaaaacaattatataaaga cttctgacttattacttaaggtttctgatgctaagaggtcagccatgaaa gcatacataaaagtaatattatatgacctgaccaggttatatttaggaat atataggtatgtacatatatgcatgtaataaaagtgatgaaaaaagagac catgaatttgaaggagagcaaggtttggagaggataaagtgaagggatga atattataattaagttataatctcaaaaataacaaaaataaaaagctaga ctagttactaacacttagttcccttcatgtgtactatgtttccttcagat ttctgattctaacattctgttttggtgtgtattattgaacacacctaacc agactcccctgtctatgttgctcaatctttgctgtattcaccacttactt tccctggacttagttctctatgctctttgagtaccttcctctgaagatgt ggatttgatatctgctatttgtcttttcagcattcattatacagatccgg aatccaatctgagtttgcaagctcactgtgcccactgtcatattcttaat agataagatgccatagagctttgattaaatcttggtagattaagtgcatg tttaaaatgaatatacaaaatgtataatatttcaagagatgagaacagga ctaacatccctcttctgtaactcatattagtatggagaaaattttttgac gacatctcccaatctattcttcaactggcctttcttctatccagc	gaattctcacctgaggaataccgaatggcagagaagcacttgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtcagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggagtgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaactggacatagtactaccagaggatccagcaatacctctcctgggc atatatccagaagatgccccaacaggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacctagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctagccaa atggatggacctggagggcatcatcctgagtgaggtaacacattcacaaa gaaactcacacaatatgtattcactgataagtggatattagccccaaacc taggatacccaagatataagatataatttgctaaacacatgaaactcaag gagaatgaagactgaagtgtggacactatgcccctccttagatttgggaa caaaacacccatggaaggagttacagagacggagtttggagctgagatga aaggatggaccatgtagagactgccatagccagggatccaccccataatc agcatccaaacgctgacaccattgcatacactagcaagattttattgaaa ggacgcagatgtagctgtctcttgtgagactatgccggggcccagcaaac acagaagtggatgctcacagtcagctaatggatggatcatagggctccca tggagagctagagaagtagccaggagctaaagggatctgcaaccctatag tgaacaaatttatgagctaccagtacccagagcttcttgactctagctgc atatatatcaaagatgctagtcggcatcactgtaagagagcccaattgac tgcactttattgccaagtaatggcatccaggccaaaataggtgaatggtg tgctac
quality values	Open. Hide. 53 47 35 43 55 55 47 35 55 50 55 61 61 55 55 61 61 61 61 55 43 37 52 59 23 27 28 28 31 32 15 21 31 31 61 61 55 61 61 59 59 61 59 61 59 59 59 59 61 59 61 59 59 61 59 55 61 61 61 59 59 59 59 61 49 52 59 52 52 59 59 44 59 43 59 59 59 59 59 59 59 61 59 59 59 59 59 59 59 59 61 59 59 61 59 59 59 59 59 61 61 59 61 61 59 59 59 59 59 59 61 59 59 59 61 61 55 59 59 61 59 59 59 59 59 52 59 59 59 59 59 52 59 61 59 59 52 61 59 52 59 59 52 49 59 59 59 59 59 59 59 52 59 59 59 59 59 59 59 59 59 61 59 59 59 59 59 52 59 59 59 59 59 59 59 59 59 61 61 59 59 55 59 61 61 55 55 59 61 59 59 61 61 59 59 59 61 59 59 61 59 55 61 61 61 61 61 61 61 59 61 61 59 59 59 61 59 61 59 59 52 59 59 59 59 61 59 59 61 61 59 59 59 59 52 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 59 59 61 59 59 59 59 59 59 59 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 59 59 59 59 49 59 59 61 59 59 59 52 61 61 59 59 59 59 59 59 59 59 59 59 59 59 61 59 61 55 55 55 55 61 55 61 55 55 52 52 55 55 55 52 55 55 55 55 55 61 61 61 55 55 55 61 52 61 55 55 55 55 55 55 55 55 52 52 61 61 61 61 55 52 55 55 55 52 55 55 55 49 61 55 61 55 55 55 55 55 61 61 50 55 50 50 55 61 55 50 61 61 55 55 55 61 55 55 61 61 55 61 61 61 61 61 55 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 53 53 53 61 53 61 61 53 53 50 61 53 61 61 61 47 50 43 61 53 61 53 53 53 50 53 61 50 61 61 61 50 50 50 53 50 61 53 61 50 61 50 53 50 50 50 53 50 50 53 53 61 61 61 61 61 61 61 61 61 53 53 61 47 53 47 53 53 53 61 61 61 61 61 61 61 61 61 53 61 47 57 57 57 57 53 57 53 47 57 53 53 53 57 57 53 57 53 57 53 57 52 53 57 57 53 57 57 53 53 57 53 52 53 47 42 47 53 57 57 38 57 57 57 53 47 47 53 53 57 53 53 43 57 53 53 47 47 53 53 53 57 53 57 57 39 57 57 32 57 53 53 53 53 53 57 40 57 53 57 57 57 45 57 45 57 37 23 50 57 57 47 38 57 53 57 35 57 57 41 27 44 57 53 50 50 47 52 45 53 53 53 50 53 50 57 52 53 37 38 50 47 57 43 57 57 53 53 57 57 57 45 50 37 52 53 52 57 41 57 38 50 35 38 26 16 33 34 33 53 50 50 50 38 41 34 33 37 46 36 52 42 37 47 38 30 52 53 44 40 39 41 53 40 57 52 52 53 41 30 42 57 47 53 34 31 52 37 44 40 52 21 57 47 40 38 52 34 40 23 24 40 21 57 44 53 37 43 48 33 37 57 41 32 40 41 29 38 33 43 37 48 29 57 57 41 41 48 40 48 40 53 36 24 45 24 34 29 53 40 30 44 30 33 40 36 40 48 39 29 37 25 48 27 28 32 25 48 30 51 51 48 32 32 29 48 30 27 30 30 32 48 31 21 44 34 27 22 23 34 24 51 48 29 28 29 40 25 28 28 29 29 23 33 39 33 43 30 29 30 37 28 51 48 36 51 36 27 29 28 31 28 29 30 28 31 29 48 29 29 29 29 28 25 29 24 28 43 26 46 21 29 33 23 24 25 28 39 29 27 39 41 29 30 29 29 27 33 22 35 16 36 18 28 27 34 19 51 30 26 38 28 21 21 43 25 30 29 23 28 26 30 20 33 22 35 24 51 51 33 26 29 25 31 27 34 23 29 29 34 33 29 28 31 34 21 17 28 23 22 28 11 10 15 29 29 27 26 21 25 28 30 24 29 36 16 41 51 28 29 28 21 23 28 28 23 28 23 11 16 29 20 29 24 51 28 31 30 28 29 20 31 26 31 30 20 20 38 20 20 32 22 21 16 17 35 20 38 21 10 36 17 36 20 24 9 20 24 10 30 14 23 22 51 25 24 28 15 28 21 44 24 29 38 12 16 22 25 15 44 10 30 17 14 15 5 5 4 25 22 20 23 18 13 35 25 17 44 44 23 20 26 23 19 13 12 10 11 12 4 44 34 22 12 29 5 18 8 5 4 9 12 11 36 25 22 28 17 14 16 9 30 18 22 15 29 7 12 30 6 8 7 30 16 16 29 6 13 6 12 21 30 8 12 13 16 18 18 5 7 10 16 23 7 10 12 12 7 6 14 12 20 7 15 6 2 3 6 24 6 7 26 18 9 8 6 5 8 32 24 23 24 13 9 23 5 6 17 19 4 4 25 20 5 8 9 7 8 7 17 7 19 15 19 8 6 14 15 5 14 5 13 15 6 11 6 6 8 15 5 3 3 5 8 16 10 5 15	Open. Hide. 50 55 32 38 49 43 39 38 26 30 31 37 36 47 36 55 55 49 59 59 59 59 52 59 59 59 61 61 52 59 49 61 49 59 59 45 59 52 59 59 61 61 59 59 59 59 59 59 59 59 59 52 40 44 49 52 52 61 61 61 59 61 59 59 59 59 59 59 59 59 52 59 55 44 55 61 59 61 59 59 59 61 61 59 59 59 61 59 61 59 59 61 61 59 59 59 59 44 61 59 59 59 59 59 59 59 59 59 59 59 59 59 59 59 49 59 59 59 52 61 59 59 61 61 59 59 59 59 38 61 59 59 52 52 59 44 59 59 59 59 59 52 61 59 61 61 59 59 52 59 59 39 61 59 59 59 59 59 59 59 52 61 59 59 59 59 59 59 55 59 61 59 61 59 59 59 61 59 61 61 59 59 59 59 59 59 59 59 59 59 49 59 59 61 59 59 59 59 59 61 61 59 61 59 59 59 59 59 52 61 59 59 59 61 59 59 59 59 59 59 59 52 59 59 61 61 61 61 61 59 61 61 59 59 52 59 59 61 61 61 59 59 61 59 61 61 61 59 61 59 49 61 59 59 59 59 59 61 61 61 59 59 59 59 43 52 59 59 59 59 61 59 59 52 61 52 61 47 61 55 61 52 52 55 52 52 61 55 61 61 61 61 55 61 55 55 61 55 55 52 52 55 52 61 61 61 55 61 52 52 61 55 49 61 55 55 55 55 55 61 52 52 52 49 49 55 52 55 55 50 61 55 50 61 61 55 50 55 43 55 55 50 55 55 61 55 55 61 61 55 61 55 55 55 50 55 50 55 55 55 50 61 61 61 61 61 61 61 61 55 61 55 61 61 55 50 55 61 55 50 61 55 50 55 61 61 61 53 50 50 50 61 61 47 50 50 50 43 61 61 61 61 61 61 50 61 53 50 52 53 50 50 61 39 50 61 53 53 61 61 61 61 53 61 53 53 61 50 50 61 47 61 53 61 50 50 53 61 53 61 61 61 53 61 53 61 52 61 61 61 53 61 50 53 53 61 61 53 61 61 61 47 53 61 61 53 61 37 52 61 61 61 47 47 57 47 42 53 57 53 53 53 57 53 47 47 47 42 47 53 53 57 53 53 53 47 53 47 39 53 53 53 57 53 53 53 57 57 37 47 53 57 47 47 47 36 47 33 32 53 57 53 53 57 53 52 53 53 53 47 53 53 47 30 57 42 47 57 52 50 53 50 52 57 57 45 53 43 47 57 53 57 57 47 53 57 57 50 53 53 53 39 53 53 53 53 53 53 39 43 46 52 30 53 53 57 38 50 34 53 45 45 46 38 43 37 34 41 53 47 35 53 52 53 57 33 46 46 50 53 52 34 42 53 31 31 40 50 57 53 33 46 37 47 50 42 47 50 57 37 52 33 36 50 39 37 47 57 53 50 42 52 33 53 57 50 44 53 32 53 52 41 46 53 48 57 48 31 39 22 52 52 33 53 35 33 40 33 52 33 34 27 42 53 34 29 25 43 52 37 57 40 27 31 35 42 44 34 47 47 37 57 57 53 37 27 46 30 37 33 23 40 25 53 35 29 53 37 29 45 37 24 37 25 35 36 33 40 48 48 37 37 35 46 30 34 29 44 32 24 31 30 29 39 25 29 47 20 29 28 8 34 30 16 18 46 30 45 26 27 17 36 39 32 48 14 29 19 28 44 51 29 25 25 23 23 28 43 19 14 27 24 29 33 34 39 20 38 21 24 28 31 39 34 38 14 29 20 24 38 30 24 29 27 39 24 28 32 36 14 29 51 51 43 25 29 14 26 29 29 26 27 24 27 28 31 31 29 41 32 29 27 38 35 33 27 12 13 23 51 28 33 23 34 24 20 29 29 29 15 29 28 33 24 38 27 27 21 28 25 43 51 28 26 33 38 26 21 46 20 25 21 17 10 17 28 12 6 29 31 34 29 19 23 29 33 29 28 28 33 28 29 13 29 18 19 31 14 20 13 20 16 26 29 23 18 11 30 30 9 6 42 23 21 13 29 29 41 9 6 8 23 23 19 26 23 21 14 14 20 5 10 17 23 25 34 23 33 23 33 23 30 13 18 29 34 17 15 21 30 16 29 22 29 23 13 12 28 19 28 13 17 44 16 23 21 8 44 21 16 7 16 22 11 6 10 13 29 29 11 16 26 14 35 33 20 28 19 14 28 12 31 18 6 13 15 28 25 14 42 9 11 35 15 11 11 16 11 22 28 11 15 22 42 15 23 11 14 9 29 14 29 13 23 8 10 6 5 6 10 9 12 9 13 29 12 29 14 30 6 21 18 17 26 9 33 42 29 6 6 22 7 10 6 7 5 14 22 23 12 5 9 13 19 10 20 25 10 17 23 9 10 5 10 11 22 6 4 9 8 31 10 11 25 11 13 6 5 14 13 5 14 15 5 9 4 10 10 6 10 14 3 1 4 6 9 9 6 3 4 4 10 20 5 6 19 6 4 3 4 18 12 6 17 4 16 21 17 5 4 13 6 12 13 6 4 4 5 4 3 3 13 4 1 6 20 5 7 8 14 13 5 7 12 19 6 8 4 7 4 6 6 5 6 14 10 9 15 6 17 4 9 7 6 13 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_13572497_13573653
seq2: B6Ng01-095M06.b_50_1194

seq1  GAATTCTGAACTGACTGTGTCAAAAAAAATCATATTCCTGTTGAATGTTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTGAACTGACTGTGTCAAAAAAAATCATATTCCTGTTGAATGTTA  50

seq1  CAGAGCTTGGCAACAGCAGGAGACTTGGCCTGGCAGCCAGAAAAAGCAAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGCTTGGCAACAGCAGGAGACTTGGCCTGGCAGCCAGAAAAAGCAAG  100

seq1  TCCCTTCATTGACATGTTACAATTAGCACCCATGGAGACAGCAGCTTATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTTCATTGACATGTTACAATTAGCACCCATGGAGACAGCAGCTTATG  150

seq1  TACAGTCCACTGTTTGTAACTACTAGTTGGGAGTTTTGGCATGAAGGCAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACAGTCCACTGTTTGTAACTACTAGTTGGGAGTTTTGGCATGAAGGCAT  200

seq1  TTCCTATGGTACAGTGCTTAGCAGCTAGAAGTCAGAAATTTACTTCTTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTATGGTACAGTGCTTAGCAGCTAGAAGTCAGAAATTTACTTCTTTA  250

seq1  TAATGCAAAATTTAAGGCTTTTCCTGATTAAGTACAAAGACTCATTAAAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGCAAAATTTAAGGCTTTTCCTGATTAAGTACAAAGACTCATTAAAG  300

seq1  CAAAAAGCAAAAAGCAATACATTTGGAACAAGAGACTACTTACAGGATAC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAAGCAAAAAGCAATACATTTGGAACAAGAGACTACTTACAGGATAC  350

seq1  AAAAATGAGGTCAGCAGGGCAGTAAAGAAATGAAAACAATTATATAAAGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATGAGGTCAGCAGGGCAGTAAAGAAATGAAAACAATTATATAAAGA  400

seq1  CTTCTGACTTATTACTTAAGGTTTCTGATGCTAAGAGGTCAGCCATGAAA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTGACTTATTACTTAAGGTTTCTGATGCTAAGAGGTCAGCCATGAAA  450

seq1  GCATACATAAAAGTAATATTATATGACCTGACCAGGTTATATTTAGGAAT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATACATAAAAGTAATATTATATGACCTGACCAGGTTATATTTAGGAAT  500

seq1  ATATAGGTATGTACATATATGCATGTAATAAAAGTGATGAAAAAAGAGAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAGGTATGTACATATATGCATGTAATAAAAGTGATGAAAAAAGAGAC  550

seq1  CATGAATTTGAAGGAGAGCAAGGTTTGGAGAGGATAAAGTGAAGGGATGA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAATTTGAAGGAGAGCAAGGTTTGGAGAGGATAAAGTGAAGGGATGA  600

seq1  ATATTATAATTAAGTTATAATCTCAAAAATAACAAAAATAAAAAGCTAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTATAATTAAGTTATAATCTCAAAAATAACAAAAATAAAAAGCTAGA  650

seq1  CTAGTTACTAACACTTAGTTCCCTTCATGTGTACTATGTTTCCTTCAGAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGTTACTAACACTTAGTTCCCTTCATGTGTACTATGTTTCCTTCAGAT  700

seq1  TTCTGATTCTAACATTCTGTTTTGGTGTGTATTATTGAACACACCTAACC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGATTCTAACATTCTGTTTTGGTGTGTATTATTGAACACACCTAACC  750

seq1  AGACTCCCCTGTCTATGTTGCTCAATCTTTGCTGTATTCACCACTTACTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACTCCCCTGTCTATGTTGCTCAATCTTTGCTGTATTCACCACTTACTT  800

seq1  TCCCTGGACTTAGTTCTCTATGCTCTTTGAGTACCTTCCTCTGAAGATGT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCTGGACTTAGTTCTCTATGCTCTTTGAGTACCTTCCTCTGAAGATGT  850

seq1  GGATTTGATATCTGCTATTTGTCTTTTCAGCATTCATTATACAGATCCGG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATTTGATATCTGCTATTTGTCTTTTCAGCATTCATTATACAGATCCGG  900

seq1  AATCCAATCTGAGTTTGCAAGCTCACTGTGCCCACTGTCATATTCTTAAT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCAATCTGAGTTTGCAAGCTCACTGTGCCCACTGTCATATTCTTAAT  950

seq1  AGATAAGATGCCATAGAGCTTTGATTAAATCTTGGTAAGATTAAGGTGCA  1000
      |||||||||||||||||||||||||||||||||||| ||||||| |||||
seq2  AGATAAGATGCCATAGAGCTTTGATTAAATCTTGGT-AGATTAA-GTGCA  998

seq1  TGTTTAAAATGAATATACAAAATGGTAT-ATATTTCAAGAGATGAGGAAC  1049
      ||||||||||||||||||||||| |||| |||||||||||||||||  | 
seq2  TGTTTAAAATGAATATACAAAAT-GTATAATATTTCAAGAGATGAG--AA  1045

seq1  CAGAACTAACATCCCTCTTCTGTAAACTCAATTATTAAGTAGTGGAGAAA  1099
      ||| ||||||||||||||||||| ||||||  |||| |||| ||||||||
seq2  CAGGACTAACATCCCTCTTCTGT-AACTCA--TATT-AGTA-TGGAGAAA  1090

seq1  ATGTTTTGACGACATCCTTCCCCATCTATTCTTTCAACTGCCCTTTCTTC  1149
      || |||||||||||||  |||| |||||||| |||||||| |||||||||
seq2  ATTTTTTGACGACATC--TCCCAATCTATTC-TTCAACTGGCCTTTCTTC  1137

seq1  TATCCAGC  1157
      ||||||||
seq2  TATCCAGC  1145

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information