MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-106P23
Chromosome	X (Build37)
Map Location	17,774,734 - 17,775,854
singlet/doublet	singlet
Overlap gene	Utx
Upstream gene	Efhc2, Fundc1, EG278181, EG668994, EG436196, EG331391, Dusp21, LOC100043951
Downstream gene	LOC100043952, 4930578C19Rik, LOC100043098, EG628855, LOC385333, EG628871
Link	Open Mouse BAC browser

Click to get alignment info.

name	Efhc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74405 MGI:1921655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fundc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72018 MGI:1919268
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG278181 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278181 MGI:3643718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	EG668994 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668994 MGI:3645165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 15 Proteins pseudo : _no_value

name	EG436196 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436196 MGI:3646107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	EG331391 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331391 MGI:3643621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins

name	Dusp21 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73547 MGI:1920797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043951 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Utx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22289 MGI:1095419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043952 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043952
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930578C19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75905 MGI:1923155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	EG628855 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628855 MGI:3647357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC385333 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG628871 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628871 MGI:3645666
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Efhc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348726 GeneID:74405 MGI:1921655
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand domain (C-terminal) containing 2 transcript_id : NM_028916.2

name	Fundc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142381937 GeneID:72018 MGI:1919268
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUN14 domain containing 1 transcript_id : NM_028058.2

name	EG278181 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271052 GeneID:278181 MGI:3643718
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG278181 transcript_id : XM_205276.2

name	EG436196 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271054 GeneID:436196 MGI:3646107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG436196 transcript_id : XM_488332.2

name	EG331391 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271056 GeneID:331391 MGI:3643621
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 12 Proteins product : predicted gene, EG331391 transcript_id : XM_285437.3

name	Dusp21 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58037324 GeneID:73547 MGI:1920797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 21 transcript_id : NM_028568.1

name	Utx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859491 GeneID:22289 MGI:1095419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitously transcribed tetratricopeptide repeat gene, X chromosome transcript_id : NM_009483.1

name	4930578C19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347804 GeneID:75905 MGI:1923155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930578C19 gene transcript_id : NM_175228.3

name	LOC100043098 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271001 GeneID:100043098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : hypothetical protein LOC100043098 transcript_id : XM_001477741.1

name	EG628855 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271058 GeneID:628855 MGI:3647357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG628855 transcript_id : XM_893647.3

name	Efhc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037365 GeneID:74405 MGI:1921655
definition	codon_start : 1 exception : mismatches in translation product : EF-hand domain (C-terminal) containing 2 protein_id : NP_083192.1

name	Fundc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312526 CCDS:CCDS30035.1 GeneID:72018 MGI:1919268
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : FUN14 domain containing 1 protein_id : NP_082334.1

name	EG278181 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271053 GeneID:278181 MGI:3643718
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_205276.2

name	EG436196 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271055 GeneID:436196 MGI:3646107
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_488332.2

name	EG331391 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271057 GeneID:331391 MGI:3643621
definition	codon_start : 1 product : similar to KIAA0026 protein_id : XP_285437.3

name	Dusp21 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037325 CCDS:CCDS30036.1 GeneID:73547 MGI:1920797
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008138 - protein tyrosine/serine/threonine phosphatase activity [Evidence IEA] GO_process : GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : novel dual specificity phosphatase, catalytic domain containing protein product : dual specificity phosphatase 21 protein_id : NP_082844.1

name	Utx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859492 CCDS:CCDS30037.1 GeneID:22289 MGI:1095419
definition	GO_component : GO:0005742 - mitochondrial outer membrane translocase complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] GO_process : GO:0006605 - protein targeting [Evidence IEA] codon_start : 1 product : ubiquitously transcribed tetratricopeptide repeat gene, X chromosome protein_id : NP_033509.1

name	4930578C19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424860 CCDS:CCDS30038.1 GeneID:75905 MGI:1923155
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC75905 protein_id : NP_780437.1

name	LOC100043098 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271002 GeneID:100043098
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477791.1

name	EG628855 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271059 GeneID:628855 MGI:3647357
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898740.3

name	LOC100043951 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043951
definition	number : 1 pseudo : _no_value

name	LOC100043952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043952
definition	number : 2 pseudo : _no_value

name	LOC100043952 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043952
definition	number : 1 pseudo : _no_value

name	LOC385333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385333
definition	number : 1 pseudo : _no_value

name	LOC385333 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385333
definition	number : 2 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 1 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 2 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 3 pseudo : _no_value

name	EG628871 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628871
definition	number : 4 pseudo : _no_value

name	EG668994 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407022 GeneID:668994 MGI:3645165
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 15 Proteins product : predicted gene, EG668994 pseudo : _no_value transcript_id : XR_002283.1

clone name	MSMg01-518C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-429A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525A08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-170K04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-093E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-409I01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-276K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-345M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-212A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357O23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-326J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-151H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-127M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-295M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-462M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489C16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-175G22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348A08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-387O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048J01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-541P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446A11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-037N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198A19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-059E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105E16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-106P23.b	B6Ng01-106P23.g
ACC	DH914583	DH914584
length	1,217	1,096
definition	DH914583\|Mus musculus domesticus DNA, BAC clone: B6Ng01-106P23, 5' end.	DH914584\|Mus musculus domesticus DNA, BAC clone: B6Ng01-106P23, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaattctgaatatctatgctccaaatgcaaaggcagtcacatt tattaaagaaacgttagtaaagctcaaagcacacattccaccacacacaa tagtaatgggaaactttaacacaccactctgatctatggacagatcatgg aaacagaaagtaaacaaagacacagtgaaagtaacagaagttatgaaaca aatagatttaacagatatctatagaacagtttatcctaaaacaaaaggat atatcttcttctcagcacctcatggtaccttctccaaaattgaccatata atcgatcacaaagcatgcctcaacacatccaaaattattaaaattatccc atgcatcgtaccagatcaccacagactaaggctgatcttcagtaacaaca taaataatacaaaattcacatacaggaggaagcttaacaacactctactc aatgatatcttggtcaagaaagaaattaaagactttttagagtttaatga aaatgaagccacagcatacccaaagttatgggacacaatgaaagcagtcc ttagaggaaaactcatagctctgattgctgccaaaaagaaactagagaga acacacactagcagcttgatggcacacctaaaatttctagaagaaaagga aggaaattcacccaagaggggtaggcagcaggaaataatcaaactcaggg ctaaaatcaaccaagtagaaacaaaaagaactataaaaaagaatcaaccc aaaccaggagatggttttttgagaaaaatcaacaagatatataaaccctt aggcagacaaactagagatcacagggacagtatcctaatgaacagaatca gaaatgaaaagggagatataacaacagaacctatggaaattcaaagcatc atcagattctactacaaaagctatacctcacaaaactggaaatcctggat gaaatggaaaatttttctagacagataccaggttaccaaatttaaatccg gatcagattaacattcttaatcacccccataccccctaaaagattagagc agtcataataagtctcaaactagaaaaaaaacaaactaaaaaagcctaga acggttagggcaagtctatcaaacctcaagagactaatcaatttctctac tatttccagatgaacagaagtacctcataccaatcattctagagaagacc ccaaattatccctctga	gaattcatacaatctctgtaataagaacaactaccatttatattcaatgg ttcactttagccaaaatctataccagattaaaaattcttttgtcttttcc ttgttatgaacttcagtcaaacacattaattctatcttacacttccaaaa tatttatatacccttgctctcacatttcctttctcggaaaagaaaaaaaa agctattaattcttttgaactcttaaaaaaaaaaaaaaacaaatgagagc caggcagatttctgagttcgaggacaggctggtctacaaagtgagttcca ggacagccagggctacacagagaaaccctgtctcgaaagaaagaaagaaa gaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaagaaaga agaaaaaaaaaaaagtttggtgacatattccagttgtaatatgctacaga tcttgaggaacttcgcttaccttaattttaagagtcctgacaaaatgatt aagatctcaaaactggaccctgagatagatcagtaagtgcttgcaacata agtctgacaacctgaattacgatctccagaatccatataagaaagtcaga ctgtcctatgacctcccgaattgcacataagtaccctcatacacaagcat gtacacacacaaacagataagagaggggaaaggaatgaagaaaaatttct gtaacagaagacctgtacaaactccagccaaacaaaatcctagactagaa ggcagaagataggaaatcctaccacgagctaaggctctattagcatttca tgactgcagaaagaaggaaagtcagatgttttgctttgttttaatgatgt gacccactatagaatacccccacacaccagagcaggtcccatcccaaact agatggcaacacaaactggactcatggggaaagggggaagggtatctcaa agctgggtagagtagggaaaaatattaatcacttgatgagacttaggtag atacactgcattttagatttctagtttctatgagctatgtataaccctta gatttattggagaaagactgtaatgtgaacttaacttagagtcgtt
quality values	Open. Hide. 21 47 27 29 57 61 61 33 31 43 61 53 43 31 18 47 50 61 61 47 61 61 61 61 25 25 22 29 14 9 14 21 17 17 33 33 27 20 36 61 59 49 59 59 59 59 61 59 61 61 61 61 61 55 59 59 59 61 61 61 61 61 61 61 61 59 61 59 49 59 59 59 59 59 59 59 59 59 59 59 59 61 59 61 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 50 61 50 61 61 61 61 61 61 61 61 39 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 53 47 53 53 57 57 53 53 57 50 57 47 47 53 57 57 47 53 53 53 50 53 53 53 53 57 53 57 57 57 53 57 53 47 53 57 53 47 29 45 50 45 47 43 53 53 37 47 53 38 53 57 47 47 50 57 52 53 50 57 50 57 53 39 32 24 10 32 30 50 52 52 41 50 42 52 52 43 34 50 50 35 32 43 45 35 43 43 47 38 57 43 47 45 38 52 46 57 45 57 57 57 57 24 53 37 35 40 57 40 53 50 40 52 38 38 39 37 17 5 37 50 47 10 57 57 52 35 37 33 53 28 39 50 50 38 24 57 52 57 33 29 13 53 39 34 14 57 57 40 52 35 35 20 57 57 35 40 20 57 57 42 41 42 40 37 28 31 31 33 48 48 40 40 53 53 40 53 31 45 53 53 27 36 37 43 35 47 34 40 22 57 57 57 57 41 31 31 30 31 31 13 45 12 47 30 21 39 41 47 31 19 33 33 32 36 48 30 48 38 9 51 51 51 51 31 30 26 28 44 51 51 51 30 29 29 32 24 20 7 7 20 39 25 29 28 28 39 29 46 47 27 39 30 23 48 29 16 46 26 33 28 44 17 29 39 24 29 28 28 23 29 27 27 32 28 25 29 10 13 46 17 27 25 19 21 26 28 29 23 27 34 25 32 33 29 29 7 15 15 13 16 16 28 15 7 8 26 46 7 9 23 26 39 41 29 36 51 29 29 29 29 23 16 20 20 18 41 20 21 30 12 20 29 25 23 20 23 21 18 7 51 23 44 15 29 30 25 29 51 12 23 26 23 16 20 16 39 28 15 15 28 20 29 24 24 31 35 27 15 21 7 38 38 8 7 7 20 20 30 17 20 9 11 5 16 5 6 38 51 26 17 9 19 23 28 51 28 25 15 28 29 35 22 35 15 9 13 38 38 23 25 13 18 6 5 17 9 35 37 32 23 22 24 26 23 33 14 7 11 31 15 13 17 20 11 9 9 28 20 26 27 22 6 26 19 16 35 22 8 35 5 9 11 30 11 14 10 23 23 19 14 30 12 12 22 6 5 9 5 4 12 8 9 30 22 8 7 6 13 11 30 16 26 6 7 12 21 33 30 33 26 7 6 26 30 8 6 29 5 14 15 5 16 5 16 6 5 12 21 6 17 3 10 11 7 13 9 9 5 15 6 3 11 7 7 5 4 4 18 11 15 20 13 27 4 4 1 4 12 4 1 1 4 4 4 23 31 18 20 7 12 7 6 7 5 15 5 18 18 15 18 14 5 8 3 4 5 6 3 16 4 6 8 20 16 16 15 10 6 7 17 7 16 9 6 8 4 9 15 7 13 8 14 7 8 14 13 10 4 10 7 15 2 4 1 8 6 18 24 16 5 7 6 7 14 6 9 14 7 5 4 5 5 4 14 4 9 13 4 5 6 12 11 4 9 13 10 6 7 2 3 3 7 7 5 4 5 3 4 11 9 8 3 10 29 21 5 9 3 8 9 9 4 9 5 5 12 6 7 9 7 7	Open. Hide. 61 59 61 59 52 49 32 30 28 30 26 28 30 41 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 59 59 61 61 61 59 59 61 61 61 61 59 59 61 55 35 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 55 61 61 59 61 59 61 61 61 61 61 61 61 59 59 55 55 59 59 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 59 59 59 55 59 61 61 61 61 55 55 61 61 59 59 59 59 59 59 59 59 59 61 61 52 59 59 59 61 59 61 61 59 45 36 55 59 59 59 52 59 59 61 59 59 59 59 49 59 59 61 59 61 59 59 61 59 59 59 59 52 59 59 52 59 61 61 59 59 52 59 55 59 59 59 61 61 59 61 61 61 61 59 61 59 61 59 59 59 61 59 61 59 61 59 59 49 43 59 49 59 59 52 59 59 59 59 61 59 59 59 59 52 61 61 61 61 61 61 61 61 61 61 59 55 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 55 55 61 55 55 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 43 45 50 49 55 55 43 55 55 55 55 61 55 61 61 61 61 55 50 55 61 61 47 61 55 55 55 55 61 55 61 53 53 47 50 61 53 52 50 50 50 50 50 50 53 50 61 61 61 61 50 53 61 61 52 53 61 61 61 61 61 61 61 61 39 39 50 50 61 47 53 61 61 50 61 61 53 50 52 53 47 47 61 53 53 53 46 47 38 61 53 53 52 50 50 61 53 52 46 47 61 61 47 53 53 53 52 47 31 29 35 36 57 43 53 40 52 52 47 53 50 45 47 42 53 52 57 53 53 47 42 50 50 45 52 57 57 53 47 46 53 53 57 45 45 52 47 47 53 53 53 46 53 53 53 53 47 53 53 50 53 53 47 33 38 57 38 50 39 43 32 53 50 52 38 57 38 57 47 47 53 52 52 50 34 53 26 32 46 39 53 53 50 45 52 53 47 43 43 50 50 46 46 45 53 53 32 57 53 53 39 47 37 53 53 53 38 47 38 41 52 38 47 39 37 53 40 52 17 47 32 53 52 52 37 37 53 40 33 53 38 53 38 57 36 53 53 57 53 53 42 53 41 37 40 53 34 53 31 36 38 57 57 34 41 57 30 37 53 30 34 27 37 38 53 25 35 44 37 45 20 23 53 51 33 37 40 27 27 35 35 33 18 57 26 29 41 19 37 35 41 29 24 35 27 39 33 36 40 32 26 20 29 29 16 10 30 23 30 32 39 44 28 30 30 14 15 32 30 22 24 37 39 38 44 31 15 47 12 29 28 33 33 25 29 16 16 10 47 31 51 29 28 29 38 29 28 18 34 14 29 25 25 24 31 39 31 22 14 43 25 29 28 41 34 34 35 35 14 31 29 43 51 29 28 33 33 41 34 29 29 29 25 24 24 43 51 29 28 51 12 9 29 23 51 36 24 28 29 29 13 28 13 30 31 51 51 21 29 27 29 51 39 29 30 51 46 34 23 23 23 34 33 31 38 22 21 21 30 38 29 20 15 17 21 24 28 31 31 31 21 25 28 28 24 30 10 7 11 23 25 19 31 29 23 20 32 14 28 14 31 20 23 26 38 13 15 8 24 38 15 7 31 20 26 24 20 27 24 27 33 30 22 29 10 19 8 28 19 38 25 19 25 19 26 5 14 26 26 19 7 32 44 44 25 13 30 13 25 44 42 44 17 15 7 11 42 28 18 30 8 18 29 31 15 22 12 18 23 33 23 42 21 17 12 10 10 8 12 11 29 31 17 6 29 37 42 29 7 13 25 14 21 24 4 17 7 14 11 15 11 21 27 21 18 9 20 10 29 24 9 16 17 11 23 9 20 7 11 11 4 10 5 15 17 17 24 32 18 4 4 4 16 13 31 11 4 9 5 4 4 17 11 9 10 9 22 11 4 1 2 3 7 14 23 5 3 5 14 18 3 20 13 12 11 3 5 22 5 23 6 11 10 4 12 7 16 7 13 29 16 9 12 15 4 7 6 7 10 4 12 6 6 11 4 1 6 13 4 4 17 5 4 18 6 19 9 16 21 3 4 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_17774734_17775854
seq2: B6Ng01-106P23.g_68_1163 (reverse)

seq1  AACGACTCTTAGGTAAATTTTCACATTACAGTCTTTTCTCATATAATTCT  50
      ||||||||| || |||   |||||||||||||| ||||||  |||| |||
seq2  AACGACTCTAAGTTAA--GTTCACATTACAGTC-TTTCTCCAATAAATCT  47

seq1  TAAAGGGTTTATACATAGATTCATAGAAACCTAAGAAATCTTTAAAAATG  100
        ||||| ||||||||||  ||||||||||   ||||||||   ||||||
seq2  --AAGGG-TTATACATAG-CTCATAGAAAC--TAGAAATCT---AAAATG  88

seq1  CAGTGTATCTTACCTAAAGTCTCAATCAAGTGGTTTAATATTTTTTTCCC  150
      ||||||||| ||||| ||||||| ||||||| | |||||||||||   ||
seq2  CAGTGTATC-TACCT-AAGTCTC-ATCAAGT-GATTAATATTTTT---CC  131

seq1  CTACTTCCTACCCAGCTTTGAGATTACCCCTTCCCCCTTTCCCCATTGAG  200
      |||||  |||||||||||||||||   |||||||||||||||||| ||||
seq2  CTACT--CTACCCAGCTTTGAGAT--ACCCTTCCCCCTTTCCCCA-TGAG  176

seq1  TCCAGTTTGTGTTGCCATCTAGTTTTGGGATTGGGACCTGCTCTGGTGTG  250
      |||||||||||||||||||||| ||||||| |||||||||||||||||||
seq2  TCCAGTTTGTGTTGCCATCTAG-TTTGGGA-TGGGACCTGCTCTGGTGTG  224

seq1  T-GGGGTATTCTATAGTGGGTCACATCATTAAAACAAAGCAAAACATCTG  299
      | ||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGGTATTCTATAGTGGGTCACATCATTAAAACAAAGCAAAACATCTG  274

seq1  ACTTTCCTTCTTTCTGCAGTCATGAAATGCTAATAGAGCCTTAGCTCGTG  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTCCTTCTTTCTGCAGTCATGAAATGCTAATAGAGCCTTAGCTCGTG  324

seq1  GTAGGATTTCCTATCTTCTGCCTTCTAGTCTAGGATTTTGTTTGGCTGGA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGGATTTCCTATCTTCTGCCTTCTAGTCTAGGATTTTGTTTGGCTGGA  374

seq1  GTTTGTACAGGTCTTCTGTTACAGAAATTTTTCTTCATTCCTTTCCCCTC  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGTACAGGTCTTCTGTTACAGAAATTTTTCTTCATTCCTTTCCCCTC  424

seq1  TCTTATCTGTTTGTGTGTGTACATGCTTGTGTATGAGGGTACTTATGTGC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTATCTGTTTGTGTGTGTACATGCTTGTGTATGAGGGTACTTATGTGC  474

seq1  AATTCGGGAGGTCATAGGACAGTCTGACTTTCTTATATGGATTCTGGAGA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTCGGGAGGTCATAGGACAGTCTGACTTTCTTATATGGATTCTGGAGA  524

seq1  TCGTAATTCAGGTTGTCAGACTTATGTTGCAAGCACTTACTGATCTATCT  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTAATTCAGGTTGTCAGACTTATGTTGCAAGCACTTACTGATCTATCT  574

seq1  CAGGGTCCAGTTTTGAGATCTTAATCATTTTGTCAGGACTCTTAAAATTA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGTCCAGTTTTGAGATCTTAATCATTTTGTCAGGACTCTTAAAATTA  624

seq1  AGGTAAGCGAAGTTCCTCAAGATCTGTAGCATATTACAACTGGAATATGT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTAAGCGAAGTTCCTCAAGATCTGTAGCATATTACAACTGGAATATGT  674

seq1  CACCAAACTTTTTTTTTTTTCTTCTTTCTTTCTTTCTTTCTTTCTTTCTT  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCAAACTTTTTTTTTTTTCTTCTTTCTTTCTTTCTTTCTTTCTTTCTT  724

seq1  TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCGAGACAGGGTTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCGAGACAGGGTTT  774

seq1  CTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGCCTGTC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTGTGTAGCCCTGGCTGTCCTGGAACTCACTTTGTAGACCAGCCTGTC  824

seq1  CTCGAACTCAGAAATCTGCCTGGCTCTCATTTGTTTTTTTTTTTTTTTAA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGAACTCAGAAATCTGCCTGGCTCTCATTTGTTTTTTTTTTTTTTTAA  874

seq1  GAGTTCAAAAGAATTAATAGCTTTTTTTTTCTTTTCCGAGAAAGGAAATG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTCAAAAGAATTAATAGCTTTTTTTTTCTTTTCCGAGAAAGGAAATG  924

seq1  TGAGAGCAAGGGTATATAAATATTTTGGAAGTGTAAGATAGAATTAATGT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGCAAGGGTATATAAATATTTTGGAAGTGTAAGATAGAATTAATGT  974

seq1  GTTTGACTGAAGTTCATAACAAGGAAAAGACAAAAGAATTTTTAATCTGG  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGACTGAAGTTCATAACAAGGAAAAGACAAAAGAATTTTTAATCTGG  1024

seq1  TATAGATTTTGGCTAAAGTGAACCATTGAATATAAATGGTAGTTGTTCTT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAGATTTTGGCTAAAGTGAACCATTGAATATAAATGGTAGTTGTTCTT  1074

seq1  ATTACAGAGATTGTATGAATTC  1121
      ||||||||||||||||||||||
seq2  ATTACAGAGATTGTATGAATTC  1096

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information