MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-116L08
Chromosome	X (Build37)
Map Location	45,920,900 - 45,921,986
singlet/doublet	singlet
Overlap gene	Suhw3
Upstream gene	LOC100040133, LOC100040145, EG624187, Smarca1, LOC676253, Ocrl, LOC270596, LOC665672, Apln, Xpnpep2, 1200013B08Rik, Zdhhc9, Utp14a, LOC637576, Bcorl1, Elf4, Aifm1, Rab33a
Downstream gene	Slc25a14, Gpr119, Rbmx2, LOC665752, Gm595, EG637758, LOC100040295, Enox2, 1100001E04Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040133 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040133
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100040145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG624187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624187 MGI:3647765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Smarca1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93761 MGI:1935127
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC676253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1137 ESTs, 10 Proteins

name	Ocrl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320634 MGI:109589
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC270596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC665672 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 608 ESTs, 74 Proteins pseudo : _no_value

name	Apln (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30878 MGI:1353624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xpnpep2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170745 MGI:2180001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1200013B08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74131 MGI:1921381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zdhhc9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208884 MGI:2444393
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Utp14a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72554 MGI:1919804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637576 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637576
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Bcorl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320376 MGI:2443910
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Elf4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56501 MGI:1928377
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aifm1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26926 MGI:1349419
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab33a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19337 MGI:109493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Suhw3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208968 MGI:2387585
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc25a14 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20523 MGI:1330823
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr119 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236781 MGI:2668412
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbmx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209003 MGI:1919414
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665752 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665752
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Gm595 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209005 MGI:2685441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	EG637758 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637758 MGI:3645144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100040295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Enox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209224 MGI:2384799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624187 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83000999 GeneID:624187 MGI:3647765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624187, transcript variant 2 transcript_id : XM_897035.1

name	Smarca1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340953 GeneID:93761 MGI:1935127
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 transcript_id : NM_053123.3

name	LOC676253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271557 GeneID:676253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1137 ESTs, 10 Proteins product : similar to ribosomal protein L21 transcript_id : XM_001476333.1

name	Ocrl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46195806 GeneID:320634 MGI:109589
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : oculocerebrorenal syndrome of Lowe transcript_id : NM_177215.3

name	Apln (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123702126 GeneID:30878 MGI:1353624
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apelin transcript_id : NM_013912.3

name	Xpnpep2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778993 GeneID:170745 MGI:2180001
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound transcript_id : NM_133213.2

name	1200013B08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142379896 GeneID:74131 MGI:1921381
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1200013B08 gene transcript_id : NM_028773.3

name	Zdhhc9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142363721 GeneID:208884 MGI:2444393
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, DHHC domain containing 9 transcript_id : NM_172465.2

name	Utp14a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51889715 GeneID:72554 MGI:1919804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast) transcript_id : NM_028276.1

name	Bcorl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347763 GeneID:320376 MGI:2443910
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BCL6 co-repressor-like 1 transcript_id : NM_178782.4

name	Elf4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790100 GeneID:56501 MGI:1928377
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : E74-like factor 4 (ets domain transcription factor) transcript_id : NM_019680.1

name	Aifm1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981322 GeneID:26926 MGI:1349419
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apoptosis-inducing factor, mitochondrion-associated 1 transcript_id : NM_012019.2

name	Rab33a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755259 GeneID:19337 MGI:109493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB33A, member of RAS oncogene family transcript_id : NM_011228.1

name	Suhw3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254196 GeneID:208968 MGI:2387585
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of hairy wing homolog 3 (Drosophila) transcript_id : NM_153532.2

name	Slc25a14 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755543 GeneID:20523 MGI:1330823
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 25 (mitochondrial carrier, brain), member 14 transcript_id : NM_011398.1

name	Gpr119 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111186468 GeneID:236781 MGI:2668412
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 119 transcript_id : NM_181751.2

name	Rbmx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142374001 GeneID:209003 MGI:1919414
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein, X-linked 2 transcript_id : NM_173376.2

name	Gm595 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407353 GeneID:209005 MGI:2685441
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : gene model 595, (NCBI) transcript_id : XM_150403.6

name	EG637758 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271530 GeneID:637758 MGI:3645144
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : predicted gene, EG637758 transcript_id : XM_979282.2

name	LOC100040295 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271532 GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001474449.1

name	Enox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801702 GeneID:209224 MGI:2384799
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecto-NOX disulfide-thiol exchanger 2 transcript_id : NM_145951.3

name	1100001E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487452 GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001E04 gene transcript_id : NM_001081123.1

name	EG624187 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001000 GeneID:624187 MGI:3647765
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_902128.1

name	Smarca1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30578398 CCDS:CCDS30104.1 GeneID:93761 MGI:1935127
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation product : SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1 protein_id : NP_444353.2

name	LOC676253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271558 GeneID:676253
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476383.1

name	Ocrl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46195807 GeneID:320634 MGI:109589
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0004437 - inositol or phosphatidylinositol phosphatase activity [Evidence IDA]; GO:0004439 - phosphoinositide 5-phosphatase activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : phosphatidylinositol polyphosphate 5-phosphatase protein_id : NP_796189.2

name	Apln (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7304895 GeneID:30878 MGI:1353624
definition	GO_function : GO:0005179 - hormone activity [Evidence IEA]; GO:0005102 - receptor binding [Evidence ISS] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] codon_start : 1 note : preproapelin product : apelin protein_id : NP_038940.1

name	Xpnpep2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778994 CCDS:CCDS30106.1 GeneID:170745 MGI:2180001
definition	GO_function : GO:0004177 - aminopeptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008235 - metalloexopeptidase activity [Evidence IEA]; GO:0008451 - X-Pro aminopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; membrane-bound aminopeptidase P product : X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound isoform 1 protein_id : NP_573476.2

name	1200013B08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311907 GeneID:74131 MGI:1921381
definition	codon_start : 1 note : Novel SH3 and SAM domain containing protein product : hypothetical protein LOC74131 protein_id : NP_083049.1

name	Zdhhc9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369636 GeneID:208884 MGI:2444393
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : zinc finger, DHHC domain containing 9 protein_id : NP_766053.1

name	Utp14a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51889716 CCDS:CCDS30107.1 GeneID:72554 MGI:1919804
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : Jsd-like X-linked product : UTP14, U3 small nucleolar ribonucleoprotein, homolog A protein_id : NP_082552.1

name	Bcorl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347764 GeneID:320376 MGI:2443910
definition	GO_process : GO:0007218 - neuropeptide signaling pathway [Evidence IEA] codon_start : 1 product : BCL6 co-repressor-like 1 protein_id : NP_848897.3

name	Elf4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790101 CCDS:CCDS30108.1 GeneID:56501 MGI:1928377
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0016605 - PML body [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0001787 - natural killer cell proliferation [Evidence IDA]; GO:0001866 - NK T cell proliferation [Evidence IDA]; GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : myeloid elf-1-like factor; myeloid elf-1 like factor product : E74-like factor 4 protein_id : NP_062654.1

name	Aifm1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755004 CCDS:CCDS30109.1 GeneID:26926 MGI:1349419
definition	GO_component : GO:0005829 - cytosol [Evidence TAS]; GO:0005792 - microsome [Evidence IDA]; GO:0005758 - mitochondrial intermembrane space [Evidence TAS]; GO:0005741 - mitochondrial outer membrane [Evidence TAS]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] [Evidence IDA]; GO:0005625 - soluble fraction [Evidence IDA] GO_function : GO:0015036 - disulfide oxidoreductase activity [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004174 - electron-transferring-flavoprotein dehydrogenase activity [Evidence TAS]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0008637 - apoptotic mitochondrial changes [Evidence TAS]; GO:0006309 - DNA fragmentation during apoptosis [Evidence TAS]; GO:0006118 - electron transport [Evidence IEA] codon_start : 1 note : harlequin product : programmed cell death 8 protein_id : NP_036149.1

name	Rab33a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755260 CCDS:CCDS30110.1 GeneID:19337 MGI:109493
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0015031 - protein transport [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAB33A, member of RAS oncogene family protein_id : NP_035358.1

name	Suhw3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254197 CCDS:CCDS30111.1 GeneID:208968 MGI:2387585
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : suppressor of hairy wing homolog 3 protein_id : NP_705760.2

name	Slc25a14 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755544 CCDS:CCDS30112.1 GeneID:20523 MGI:1330823
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005740 - mitochondrial envelope [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005386 - carrier activity [Evidence IEA]; GO:0008430 - selenium binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006839 - mitochondrial transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : solute carrier family 25 (mitochondrial carrier, brain), member 14 protein_id : NP_035528.1

name	Gpr119 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32306530 CCDS:CCDS30113.1 GeneID:236781 MGI:2668412
definition	GO_component : GO:0016021 - integral to membrane [Evidence IC]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0001619 - lysosphingolipid and lysophosphatidic acid receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0030073 - insulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor 119 product : G-protein coupled receptor 119 protein_id : NP_861416.1

name	Rbmx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734072 CCDS:CCDS30114.1 GeneID:209003 MGI:1919414
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein, X-linked 2 protein_id : NP_775552.1

name	Gm595 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001004 GeneID:209005 MGI:2685441
definition	codon_start : 1 product : hypothetical protein protein_id : XP_150403.5

name	EG637758 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271531 GeneID:637758 MGI:3645144
definition	codon_start : 1 product : similar to hCG2001000 protein_id : XP_984376.2

name	LOC100040295 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271533 GeneID:100040295
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001474499.1

name	Enox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122383 CCDS:CCDS30115.1 GeneID:209224 MGI:2384799
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence ISS] [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007624 - ultradian rhythm [Evidence ISS] codon_start : 1 product : cytosolic ovarian carcinoma antigen 1 protein_id : NP_666063.1

name	1100001E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487453 GeneID:75404 MGI:1922654
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Novel RhoGAP domain containing protein product : hypothetical protein LOC75404 protein_id : NP_001074592.1

name	LOC100040133 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040133
definition	number : 1 pseudo : _no_value

name	LOC100040145 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040145
definition	number : 1 pseudo : _no_value

name	LOC100040145 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040145
definition	number : 2 pseudo : _no_value

name	LOC270596 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:270596
definition	number : 1 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 4 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 3 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 2 pseudo : _no_value

name	LOC637576 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637576
definition	number : 1 pseudo : _no_value

name	LOC665752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665752
definition	number : 1 pseudo : _no_value

name	LOC665752 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665752
definition	number : 2 pseudo : _no_value

name	LOC665672 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271559 GeneID:665672
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 608 ESTs, 74 Proteins product : similar to ENSANGP00000012700 pseudo : _no_value transcript_id : XR_032688.1

clone name	MSMg01-193C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-328D13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-371F20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375C15
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-379E08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-356M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-338B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500C03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-336B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-128P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107L17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208A20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116L08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-205F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146K08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B18
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-116L08.b	B6Ng01-116L08.g
ACC	DH921639	DH921640
length	1,232	1,082
definition	DH921639\|Mus musculus domesticus DNA, BAC clone: B6Ng01-116L08, 5' end.	DH921640\|Mus musculus domesticus DNA, BAC clone: B6Ng01-116L08, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctaccagaccttcaaagaagacctgataccaattttcctcaaact attccataaaatagaaacagaaggagctgacagaaaactaaccagtacaa cttctcttcataagtttccctcactaccttcctcattttgcagtaaaaac cttttcccccaaaagttttgaaaatacaacttattttattgtatttttat ctatactacctaactcattctatgaagccacaattactctgatacctaaa ccacacaaggatccaacccaaaaaaaaaaaaaagagagagagagaacgtc agaccaatcaatctcacttatgaatatcgatgcaaaaatactcaatataa tttttgcaaaccaaatccaagaacacatcaaaaccatctttcgccatgat caagtaggcttcatcccagggatgcaaggttggtttaatatatgaaaatc cattaacataatccactatataaacaaactcaaagaaaaaaatctcatga tcatctccttagatgctgaaaaggtatttggcaaaatacaacaccccttc atgttaaaagtattggagagatcaggaattcaagtcccatgcataaacat aataacaacaatttactgcaaaccaacagtcaatatcaaattaaatggag acatacttgaagcaatcccactgaaatcaggaacaagacaaggatgtcga ctctctccatatctattcaatatagtattcgaagtgttagctagaacaat agacaacaaaaagaaatcaaggggatacaaattggtaaagaagaaataaa ggtatcactatttacagatgatatgttagcatacatgagtaaccccaaaa attctactagagaacttctccagctgataaacaacttcagcaaagtggcc ggagataaaattaactcaaataaatcaagatatatcctttattcaaagga taaacaggctgaggaagaaattagggaaacaactcccttcaaaatagcca caaataatataaatatcttgggtactctacccaacagtgaaagactatat ggcatacttcaagtctctcaagaaaattgagagatctcagaaaatggaga gatctccatgctctgatgccaataactagtagaattgcatctacaagtaa tcttgagtcatgcaatcccatcaatgaccaatctcagactgaagaggcaa ttctcattcactggaaatcgcgacgacccaac	gaattctttaaaagtgttttaaaaatcttgatatctaataaaaattgaat ttggtcttctcacaactaataatccgacaaatggtttatttggttgtccc ttatgtaggtaggggaaacaaaagtaattcactcattcagaatttccaca gtggccttccaattattatgctctgagttaattaaatataatgggcaatt cagacaaagcctttccttttatggtttttttttgtgtgtgattttctttc ttttttttctatttattacgtattttcctcaattacatttccaatgctat cccaaaagttccctataccctcccccccgactcccctacccacccattcc cattttttggccctggcgttcccctgtactggggcatataaagtttgcct gtccaataggcatctctttccagtgatggccgactaggccatcttttgat acatatgcagctagagtcaagagctccggggtactggttagtacataatg ttgcacctacagggttgcagatctctttagctccttggatactttctcta gctcctccattgggggccgtgtgacccatccaatagctgactgtgagcat ccacttctgtgtttgctaggccccggcatagtcttacaagagacagctat atcacggtccttgcaacaaacgcttgctagggtatgcaatggtgtcatcg tttggaggctaattatgggatggatccctggatatggcagtctctagatg gtccatccttttgtctcagctccaaactttgtctctgtaactccttccat gggtgattgtttccaattctaaagaaggggcaaagtgtccacactttggt cttcgttcttcttcagtttcatgtgttttgcaaattgtatcttatatctc gggtatactaagtttctgggctaatatccacctatcagtgagtacatatc atgtgagttcttttgtgtcctttatgtttatatgactttgtagtttgaaa attgaaagtatgtgtaagttgtatgggtgagtacatacatacggggtaat cttggaggagctagaggacaaccctttagagc
quality values	Open. Hide. 61 47 32 38 61 55 61 55 61 49 36 61 61 61 61 61 61 40 37 61 61 61 61 61 61 27 15 27 12 27 14 26 23 21 27 23 50 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 59 49 59 49 28 44 44 36 37 59 59 59 59 59 59 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 59 59 59 59 61 59 55 55 59 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 59 61 61 61 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 44 59 39 59 49 59 30 55 50 55 43 59 61 61 61 61 59 52 52 61 59 61 59 61 61 61 61 59 59 59 59 59 59 59 59 59 59 59 59 61 59 59 59 59 59 61 61 61 61 61 61 61 61 59 59 59 61 61 59 59 49 52 44 43 59 52 52 61 61 61 61 61 61 61 59 59 61 61 61 59 59 59 61 59 59 59 59 59 59 59 59 61 61 59 61 61 61 59 61 61 61 59 52 59 59 59 59 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 59 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 55 55 61 61 61 61 61 61 61 61 61 61 61 55 55 55 61 61 61 61 50 50 55 55 50 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 47 43 61 61 43 61 61 61 61 53 53 61 61 61 61 61 43 43 61 53 52 61 61 61 61 61 61 53 61 61 61 61 53 61 61 61 61 53 61 61 61 61 61 61 61 61 61 57 45 57 53 53 53 53 47 53 57 57 53 47 47 57 53 39 57 57 47 57 57 57 53 53 53 53 53 53 53 57 57 53 52 53 57 46 47 57 57 53 53 47 52 39 53 50 53 53 53 57 53 57 53 53 43 52 53 53 47 46 45 52 57 57 41 46 46 50 53 53 50 57 47 47 45 53 52 50 57 42 53 52 50 57 43 33 57 42 52 52 57 47 57 53 53 47 30 41 52 41 52 53 43 45 52 52 32 46 26 8 46 52 50 41 53 52 43 41 42 50 41 34 57 46 37 52 53 53 47 32 33 53 53 31 30 34 33 35 24 39 39 50 52 53 34 16 52 35 17 57 57 57 57 37 53 57 43 31 40 37 32 33 57 57 44 33 24 33 41 33 42 31 33 40 47 47 33 52 57 34 31 53 53 25 40 57 40 37 25 57 37 39 40 28 20 38 37 37 41 33 33 37 53 41 27 40 21 30 35 29 37 39 22 32 38 48 48 31 33 27 47 23 34 27 30 20 30 32 29 11 13 10 25 19 44 44 39 15 48 48 51 27 29 29 29 28 28 29 25 28 28 47 17 25 23 20 33 31 35 29 37 43 21 28 28 39 36 31 17 24 51 29 29 17 46 28 38 35 34 30 24 32 25 51 27 22 28 43 23 16 29 13 51 24 16 33 8 14 33 30 24 19 28 39 24 26 28 33 29 51 29 27 18 51 25 26 28 27 26 24 28 18 26 26 17 28 11 17 12 43 29 26 22 19 22 22 36 16 14 38 23 11 10 44 18 25 18 27 27 34 34 34 35 16 19 33 27 22 35 51 28 16 14 12 11 29 12 24 51 21 19 5 23 25 28 28 33 20 15 27 28 26 51 51 23 23 26 11 21 17 11 16 13 34 29 13 28 7 10 12 9 7 6 7 19 18 22 13 6 13 39 44 29 10 12 14 17 12 20 23 9 35 7 30 18 15 35 21 13 28 20 35 27 15 21 25 12 16 21 17 25 23 23 12 30 19 30 10 10 12 20 13 15 9 5 9 15 13 8 15 16 18 7 8 42 21 22 5 14 16 29 9 30 7 12 6 7 9 15 6 8 23 32 26 23 12 22 7 12 7 16 8 24 23 13 24 16 23 8 11 23 11 11 20 11 11 4 5 14 4 4 11 4 4 3 4 3 2 2 9 10 20 7 11 9 3 5 2 3 3 7 10 18 4 6 5 10 5 4 3 4 3 4 4 4 3 3 5 19 14 11 3 4 8 10 13 4 12 22 13 4 12 5 7 13 4 4 3 3 2 2 4 21 4 7 9 4 3 4 4 6 4 4 1 4 10 4 4 4 9 6 14 8 6 7 5 12 5 4 4 5 17 5 6 7 20 10 14 5 5 4 6 7 5 4 2 4 4 3 3 6 3 1	Open. Hide. 61 59 59 59 61 19 17 13 11 12 12 12 19 12 12 30 30 43 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 59 59 44 32 37 59 59 59 59 61 61 61 61 61 55 44 55 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 59 59 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 59 61 61 59 59 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 59 59 55 55 61 61 59 61 61 61 61 61 61 61 59 59 61 61 61 61 61 59 61 59 55 59 61 61 61 61 59 61 59 59 61 61 36 55 44 61 61 61 61 61 61 61 61 61 61 61 61 59 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 55 44 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 55 55 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 55 61 61 61 61 49 61 61 55 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 50 61 61 61 61 61 61 61 61 61 61 61 61 61 53 50 61 61 61 61 61 61 61 61 61 61 47 31 61 61 47 61 61 61 47 43 61 61 47 61 61 43 39 61 61 61 61 61 61 61 61 43 61 61 53 61 43 45 61 53 61 61 43 43 61 61 61 52 61 61 39 61 50 61 61 47 39 61 53 35 42 24 61 61 61 53 61 42 31 47 53 53 61 53 53 39 53 50 34 53 47 57 30 53 45 39 39 53 53 45 52 42 41 53 45 45 53 47 47 47 39 43 53 38 19 6 47 52 28 53 57 50 28 53 53 53 50 45 53 52 47 42 57 30 43 32 47 42 46 53 43 47 53 45 53 50 43 28 52 52 39 40 57 52 52 53 52 20 47 28 39 34 53 37 37 45 42 52 57 47 36 20 50 44 33 33 30 43 38 47 46 37 24 17 40 42 45 53 23 45 23 33 41 28 42 32 52 24 53 34 53 57 16 35 34 27 40 30 40 29 57 57 53 42 28 40 30 27 30 21 40 38 29 39 21 57 39 25 14 57 33 50 31 47 33 44 35 52 21 17 33 35 42 29 42 23 52 36 29 17 28 57 57 34 28 40 32 19 25 22 10 57 37 28 48 29 40 25 38 37 16 5 57 21 18 53 13 10 33 44 30 17 28 43 33 24 22 28 17 32 40 24 30 25 30 30 47 30 24 18 7 24 25 23 30 29 47 17 35 11 46 38 23 20 13 12 17 12 45 51 29 23 25 22 14 11 6 45 46 29 36 29 43 46 29 10 46 36 23 33 28 29 14 39 34 28 25 29 28 28 35 21 51 35 15 26 25 18 28 28 34 30 25 31 51 23 27 23 43 51 33 28 27 34 24 21 21 25 29 26 17 6 12 46 24 28 25 24 15 19 24 28 17 21 33 29 22 26 28 20 34 25 13 17 6 29 25 9 20 25 24 21 38 38 16 29 14 31 8 12 25 34 29 6 9 14 7 20 41 28 9 14 19 28 20 33 16 32 17 26 6 7 7 8 10 38 18 21 25 38 29 32 11 19 6 5 30 20 16 17 22 17 17 7 6 6 14 11 10 5 10 5 11 18 9 9 7 12 13 5 4 5 9 8 21 6 14 13 22 7 11 9 31 6 7 15 21 6 17 15 6 8 14 17 21 14 11 6 6 6 6 15 11 6 5 16 9 17 12 8 8 5 8 30 18 4 3 4 7 4 5 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_45920900_45921986
seq2: B6Ng01-116L08.g_69_1149

seq1  GAATTCTTTAAAAGTGTTTTAAAAATCTTGATATCTAATAAAAATTGAAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTAAAAGTGTTTTAAAAATCTTGATATCTAATAAAAATTGAAT  50

seq1  TTGGTCTTCTCACAACTAATAATCCGACAAATGGTTTATTTGGTTGTCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTCTTCTCACAACTAATAATCCGACAAATGGTTTATTTGGTTGTCCC  100

seq1  TTATGTAGGTAGGGGAAACAAAAGTAATTCACTCATTCAGAATTTCCACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATGTAGGTAGGGGAAACAAAAGTAATTCACTCATTCAGAATTTCCACA  150

seq1  GTGGCCTTCCAATTATTATGCTCTGAGTTAATTAAATATAATGGGCAATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGCCTTCCAATTATTATGCTCTGAGTTAATTAAATATAATGGGCAATT  200

seq1  CAGACAAAGCCTTTCCTTTTATGGTTTTTTTTTGTGTGTGATTTTCTTTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAAAGCCTTTCCTTTTATGGTTTTTTTTTGTGTGTGATTTTCTTTC  250

seq1  TTTTTTTTCTATTTATTACGTATTTTCCTCAATTACATTTCCAATGCTAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTTCTATTTATTACGTATTTTCCTCAATTACATTTCCAATGCTAT  300

seq1  CCCAAAAGTTCCCTATACCCTCCCCCCCGACTCCCCTACCCACCCATTCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAAAGTTCCCTATACCCTCCCCCCCGACTCCCCTACCCACCCATTCC  350

seq1  CATTTTTTGGCCCTGGCGTTCCCCTGTACTGGGGCATATAAAGTTTGCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTTTTGGCCCTGGCGTTCCCCTGTACTGGGGCATATAAAGTTTGCCT  400

seq1  GTCCAATAGGCATCTCTTTCCAGTGATGGCCGACTAGGCCATCTTTTGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCAATAGGCATCTCTTTCCAGTGATGGCCGACTAGGCCATCTTTTGAT  450

seq1  ACATATGCAGCTAGAGTCAAGAGCTCCGGGGTACTGGTTAGTACATAATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATATGCAGCTAGAGTCAAGAGCTCCGGGGTACTGGTTAGTACATAATG  500

seq1  TTGCACCTACAGGGTTGCAGATCTCTTTAGCTCCTTGGATACTTTCTCTA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCACCTACAGGGTTGCAGATCTCTTTAGCTCCTTGGATACTTTCTCTA  550

seq1  GCTCCTCCATTGGGGGCCGTGTGACCCATCCAATAGCTGACTGTGAGCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTCCTCCATTGGGGGCCGTGTGACCCATCCAATAGCTGACTGTGAGCAT  600

seq1  CCACTTCTGTGTTTGCTAGGCCCCGGCATAGTCTTACAAGAGACAGCTAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACTTCTGTGTTTGCTAGGCCCCGGCATAGTCTTACAAGAGACAGCTAT  650

seq1  ATCACGGTCCTTGCAACAAACGCTTGCTAGGGTATGCAATGGTGTCATCG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCACGGTCCTTGCAACAAACGCTTGCTAGGGTATGCAATGGTGTCATCG  700

seq1  TTTGGAGGCTAATTATGGGATGGATCCCTGGATATGGCAGTCTCTAGATG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGAGGCTAATTATGGGATGGATCCCTGGATATGGCAGTCTCTAGATG  750

seq1  GTCCATCCTTTTGTCTCAGCTCCAAACTTTGTCTCTGTAACTCCTTCCAT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCATCCTTTTGTCTCAGCTCCAAACTTTGTCTCTGTAACTCCTTCCAT  800

seq1  GGGTGATTGTTTCCAATTCT-AAGAAGGGGCAAAGTGTCCACACTTTGGT  849
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GGGTGATTGTTTCCAATTCTAAAGAAGGGGCAAAGTGTCCACACTTTGGT  850

seq1  CTTCGTTCTTCTTCAGTTTCATGTGTTTTGCAAATTGTATCTTATATCTC  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCGTTCTTCTTCAGTTTCATGTGTTTTGCAAATTGTATCTTATATCTC  900

seq1  GGGTATACTAAGTTTCTGGGCTAATATCCACTTATCAGTGAGTACATATC  949
      ||||||||||||||||||||||||||||||| ||||||||||||||||||
seq2  GGGTATACTAAGTTTCTGGGCTAATATCCACCTATCAGTGAGTACATATC  950

seq1  ATGTGAGTTCTTTTGTGTCCTTTTATGTTTTATATGACTTTTGTAGTTTG  999
      |||||||||||||||||||| |||||| |||||||||| |||||||||||
seq2  ATGTGAGTTCTTTTGTGTCC-TTTATG-TTTATATGAC-TTTGTAGTTTG  997

seq1  AAAAATTGTAAAGTATGTGTAAGTATGTATGTGTGAGTACATACATACCG  1049
       ||||||| ||||||||||||||| |||||| ||||||||||||||| ||
seq2  -AAAATTG-AAAGTATGTGTAAGT-TGTATGGGTGAGTACATACATA-CG  1043

seq1  TGGTATACTTGTA-GAGCTCAGAGGACAACCCTTTAGAG  1087
       ||||  |||| | ||||| |||||||||||||||||||
seq2  GGGTAATCTTGGAGGAGCT-AGAGGACAACCCTTTAGAG  1081

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information