MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-144H05
Chromosome	X (Build37)
Map Location	66,485,429 - 66,486,715
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG236844, LOC385372, LOC627888, LOC434788, Fmr1, Fmr1nb, LOC100040244, EG627927, LOC666882, LOC671950, LOC100040255
Downstream gene	Aff2, EG666577, 1700020N15Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG236844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236844 MGI:3645886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	LOC385372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	LOC627888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC434788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins pseudo : _no_value

name	Fmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14265 MGI:95564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmr1nb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207854 MGI:2672032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 139 ESTs, 6 Proteins

name	EG627927 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627927 MGI:3704138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC666882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC671950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100040255 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Aff2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14266 MGI:1202294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666577 MGI:3644930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1891 ESTs, 7 Proteins

name	1700020N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG236844 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20984062 GeneID:236844 MGI:3645886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : predicted gene, EG236844 transcript_id : XM_141816.1

name	Fmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51036612 GeneID:14265 MGI:95564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation syndrome 1 homolog transcript_id : NM_008031.2

name	Fmr1nb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29135262 GeneID:207854 MGI:2672032
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation 1 neighbor transcript_id : NM_174993.1

name	LOC100040244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271669 GeneID:100040244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 139 ESTs, 6 Proteins product : similar to phosphoserine/threonine/tyrosine interaction protein transcript_id : XM_001473727.1

name	EG627927 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407523 GeneID:627927 MGI:3704138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627927 transcript_id : XM_110770.5

name	LOC671950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271673 GeneID:671950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical LOC671950 transcript_id : XM_001473776.1

name	LOC100040255 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271671 GeneID:100040255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040255 transcript_id : XM_001474363.1

name	Aff2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351744 GeneID:14266 MGI:1202294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AF4/FMR2 family, member 2 transcript_id : NM_008032.2

name	EG666577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271677 GeneID:666577 MGI:3644930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1891 ESTs, 7 Proteins product : predicted gene, EG666577 transcript_id : XM_984280.2

name	1700020N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271679 GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700020N15 gene transcript_id : XM_001473869.1

name	EG236844 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984063 GeneID:236844 MGI:3645886
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141816.1

name	Fmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036613 CCDS:CCDS30171.1 GeneID:14265 MGI:95564
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007417 - central nervous system development [Evidence IMP]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fragile X mental retardation-1 protein product : fragile X mental retardation protein 1 protein_id : NP_032057.2

name	Fmr1nb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29135263 CCDS:CCDS30172.1 GeneID:207854 MGI:2672032
definition	codon_start : 1 exception : mismatches in translation product : fragile X mental retardation 1 neighbor protein_id : NP_778158.1

name	LOC100040244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271670 GeneID:100040244
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473777.1

name	EG627927 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086331 GeneID:627927 MGI:3704138
definition	codon_start : 1 product : hypothetical protein protein_id : XP_110770.2

name	LOC671950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271674 GeneID:671950
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473826.1

name	LOC100040255 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271672 GeneID:100040255
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474413.1

name	Aff2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679819 CCDS:CCDS30173.1 GeneID:14266 MGI:1202294
definition	GO_process : GO:0007611 - learning and/or memory [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Ox19 homolog; fragile X mental retardation 2 homolog; fragile X mental retardation protein 2 homolog product : AF4/FMR2 family, member 2 protein_id : NP_032058.1

name	EG666577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271678 GeneID:666577 MGI:3644930
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989374.2

name	1700020N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271680 GeneID:75509 MGI:1922759
definition	codon_start : 1 product : hypothetical protein LOC75509 protein_id : XP_001473919.1

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 1 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 2 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 3 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 4 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 5 pseudo : _no_value

name	LOC666882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666882
definition	number : 1 pseudo : _no_value

name	LOC385372 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271667 GeneID:385372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Ranbp1 protein pseudo : _no_value transcript_id : XR_031303.1

name	LOC434788 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271668 GeneID:434788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : similar to S-adenosylhomocysteine hydrolase pseudo : _no_value transcript_id : XR_031704.1

clone name	MSMg01-092J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-144H05.b	B6Ng01-144H05.g
ACC	DH942125	DH942126
length	1,235	1,194
definition	DH942125\|Mus musculus domesticus DNA, BAC clone: B6Ng01-144H05, 5' end.	DH942126\|Mus musculus domesticus DNA, BAC clone: B6Ng01-144H05, 3' end.
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttttgagatgagaaaagctcagagaaaccctttattgtttggta gcttcaactaccaaatttataatatttgttagaaagtatcacattgtttt tgaaattatcattaagggaatatttttaaaaattgtcttatagtacataa cacctgttctcttaaaaatttacacaggaacaattcaaactattttccat ctgacccctaagcaataatgtctgggacgaaagaagaatagagcaagatc gtttttacaatctgattctttaaagtatttgagtggggaacagagtagga tagaaagccattttctttactaatttggaagaaggaagccaaataattgt caatgagcaaagattagaaaaaaataggaaaatgcttgcctcagactcac atgctaatttagggtgtttcaatagaagcagctacaacacacacctatgg gttgaagcaacttaatatacagaaaagtggaagattaacaaattggaaca ttcctgctatttacatctaagctattgttaaatttttctactggaaatgg gtacaattggattagatcatgttcatcttgagtttgcttgccactcttgc aaacttttctgtgagaaaactttctccaaattattgaagaaattcttacc agtgaccaaatgtacgcatgccaagaaacaccttatcaggaaggcatata catctgaatgcttaatagtgtcacaaacacatgttggacaaagcaagagc tctgcctcacttgatgcaaacatttcttatcactgagggagatggtacat aatcaacagcagctgtttatttgtgtatcagcattagccacacaagctga ctcttcttccaattccaagccttttctgattttcactttccagttcacac agcatggcactgcttctgattctgtctgttgccataggaatcaactttca tatcaatatgtagtggcaccgactcacttctagtgagaaaaagctgtcag gacatcttctttcaaaagcatcagatacttacacagatgttccctgcgta gagaatgtgaaacccaaatttttctggtacttatgtcatagcataggcta tgcttttcttcccattcttcatgaacatgtcagtaaaaatgtgaagcctt atacattcattaactgtacctatggcttaagcatactacacttcatgagt ggagatagattgatgtttctcaacgtcctagtgct	gaattcatctctactgactagtgttcatggtacgggacagcactttgtct tttaagaggggagaaagtcaattaccactccaggtacaaatcccatgaac tgtactgatgacctgcctgcattaccatgctggcacagtagtggcagaaa cgttgagcaagtaaccacccactattttattggatttaaggaacactcca tgagattgaacccatgccttatgctgctaatgtggccaaaaaacatgaaa ctaaacaggctattagtctaggggtaaaccaaatactgtcttactaaagg aacacaacaataaaatgacttcaaatgacattctcaaactatatccacag gaagtatctcttgctcatccaccatcagagaaaacacttattacaataga tagaaataacacagagccccacagctggaaaatacacaaagagtgaaact ttggaatacccaatcttaaatggaatatcttcataaaacctttactctca gggctatgaggagtaggaggcagagagattgaaaaagccagagagaattg atgacactaaggaaatggtgtctttttttcttttctttttattagatatt ttctttatttacatttcaaatgttatccactttcctagtttcctctctgg gaatccccatttcctcaccccctgctcaccaacccaccaactcctgcttc ctggccctggcattcccctacactggggcatagaaccttcacaggaccaa gggcttctctcccattgatgatttacaaggctattctctgctacatatgt ggctggagcaatgagacccaccatgtgtactctttggtgggtggtttagt ccctgggaactctgggtatactggtaagttcatattgttgttcctcctat cgagctgcaaacaccttcagctccttggttctttctctagctcctcatgg ggacccatgctcagtcctatggatggctgcaagcatcacctctgtattta tcaggcactggtagagctctagagacagctataacaggctctgtcagtag cactttgggcatccacatattgcctgggtgtgaattaattggaatggaat tcctatggcgctctgaagtcttcttacgatctgatcaggctgttctggac ttcaaggattgtgcatcgaatgacgagagtccacctggctcttc
quality values	Open. Hide. 61 47 35 38 61 61 61 61 55 55 47 61 61 39 26 49 61 61 61 61 61 61 49 61 61 59 59 52 55 59 59 55 59 59 59 61 61 61 61 61 61 61 59 61 61 55 55 59 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 55 55 55 59 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 43 61 61 61 61 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 48 61 61 61 61 61 61 61 61 57 57 57 57 57 57 57 57 57 53 57 57 57 53 57 57 57 57 53 57 57 57 47 40 47 47 53 57 52 57 53 57 57 53 57 57 53 57 57 57 57 57 57 57 53 57 57 57 53 47 57 57 47 57 53 57 57 57 57 57 57 53 50 57 57 57 53 57 57 52 57 57 52 47 57 47 42 57 57 57 46 47 53 57 57 53 53 52 41 21 53 53 57 45 50 37 57 53 45 57 45 57 41 32 35 57 53 39 52 50 29 23 32 52 50 57 41 30 53 37 57 53 52 57 39 50 52 50 53 45 53 53 52 52 30 53 50 46 57 50 40 38 34 46 50 53 53 53 39 37 22 57 53 50 37 57 31 40 53 50 50 39 53 38 53 53 53 52 34 44 36 40 30 52 50 44 47 37 42 42 40 53 28 38 36 53 29 57 57 48 37 52 34 45 57 36 37 53 37 28 17 34 57 53 30 37 36 46 45 53 26 40 38 37 40 41 29 44 40 37 34 36 30 44 37 29 28 37 35 27 53 30 33 24 30 34 37 44 35 29 35 40 40 29 37 30 32 30 13 51 30 48 28 29 18 32 37 21 30 30 27 32 18 32 39 38 29 31 30 36 36 39 35 32 34 32 33 26 51 35 37 29 46 36 29 29 43 29 29 35 34 37 29 29 15 9 32 29 29 33 30 21 39 28 30 17 30 26 32 29 35 39 28 29 28 23 30 32 32 24 17 25 17 23 34 31 27 32 23 25 33 29 29 27 51 46 30 29 27 30 30 9 51 46 30 23 31 29 28 46 39 21 35 28 21 26 27 27 19 29 21 29 28 29 28 28 24 28 30 17 18 26 29 38 27 39 17 25 24 27 29 26 20 27 21 34 23 34 30 29 8 30 23 18 28 17 29 21 27 14 29 21 23 27 23 21 28 28 51 29 27 14 15 19 24 27 33 17 20 25 26 34 15 29 12 10 10 29 19 25 20 33 17 26 22 26 27 10 25 16 21 34 28 28 13 16 28 16 23 34 44 42 44 36 17 31 26 24 18 27 10 23 19 27 19 11 16 31 19 26 32 19 44 15 14 5 29 30 28 9 24 23 34 26 15 13 38 14 14 33 20 31 15 14 8 6 4 8 3 4 15 13 20 10 29 14 13 10 5 13 5 17 8 16 7 30 29 6 23 11 26 5 5 4 6 14 12 8 27 20 16 42 42 42 14 11 6 18 17 6 12 8 12 7 6 3 3 4 7 7 5 5 11 25 5 6 9 9 17 17 5 9 14 6 14 3 25 25 6 5 10 14 9 32 12 8 8 5 10 14 11 7 4 5 12 25 8 11 6 6 7 14 6 13 16 7 14 22 30 6 7 5 11 9 8 11 15 8 9 7 12 8 6 11 9 6 4 13 10 10 4 5 3 3 3 4 3 7 4 4 2 8 5 7 5 6 10 5 3 4 8 14 18 3 1 4 2 4 8 6 8 5 4 5 3 16 3 3 13 17 5 3 13 6 6 3 9 6 6 6 5 17 7 7 1 1 4 1 1 3 3 3 5 12 6 13 5 4 19 20 6 5 7 3 15 6 4	Open. Hide. 61 61 49 49 49 49 31 52 59 30 36 37 43 59 61 61 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 59 59 59 59 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 59 52 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 47 61 61 61 61 57 57 53 57 47 47 57 53 53 53 47 47 57 39 46 50 57 53 57 50 53 53 42 27 57 57 57 57 57 57 57 39 47 57 53 52 57 45 57 45 57 47 37 57 57 57 57 57 57 53 50 57 57 52 53 43 57 47 47 53 43 57 57 50 57 53 57 53 57 57 57 57 57 57 53 52 57 47 57 53 45 57 57 57 47 52 38 50 53 45 52 52 50 50 57 57 53 53 53 57 53 45 50 57 57 50 53 34 57 57 53 45 38 33 43 46 57 52 52 52 53 57 47 45 50 57 57 47 41 46 36 50 53 57 57 31 46 57 52 53 53 50 53 57 57 45 53 34 32 45 46 43 53 37 53 57 53 53 52 53 53 50 38 57 38 57 38 37 53 52 57 40 38 37 38 47 41 52 41 39 50 52 50 31 57 53 53 35 53 45 57 37 57 44 24 51 52 40 40 30 46 35 34 33 53 37 29 28 41 35 57 57 34 31 35 36 35 37 33 37 41 53 52 35 35 37 40 30 53 45 17 23 18 53 40 31 39 37 21 53 25 14 40 17 47 23 57 53 35 29 48 40 36 41 37 27 53 29 27 29 24 31 26 23 32 30 29 51 27 27 30 26 24 18 45 22 29 29 23 39 39 38 30 30 32 30 28 24 29 21 29 28 29 29 29 30 37 23 19 10 39 25 14 32 17 33 19 26 43 20 31 14 51 34 20 25 47 27 28 36 29 36 27 26 34 24 29 23 51 26 29 29 19 29 51 43 20 31 27 13 51 29 33 19 31 30 51 34 18 20 43 30 17 30 29 28 27 28 28 46 30 23 27 25 23 29 28 29 33 16 30 28 27 32 24 22 17 27 23 24 36 31 16 25 29 28 28 31 33 35 38 34 31 23 26 23 22 30 20 22 29 25 28 24 51 19 25 20 14 23 29 14 22 21 15 26 29 18 22 24 28 25 13 26 14 19 28 51 22 12 12 22 14 19 17 19 13 6 33 19 18 7 23 9 36 51 13 6 4 19 16 14 27 34 28 28 26 20 14 21 30 21 16 21 21 16 21 7 9 21 20 14 25 15 17 15 17 16 25 19 17 10 17 6 5 8 8 10 19 9 11 13 42 14 20 26 10 5 13 10 6 16 18 24 17 21 6 13 5 19 5 10 3 3 6 4 4 11 8 20 15 18 26 29 20 8 14 18 17 7 5 13 16 5 20 4 10 25 9 13 23 14 11 24 11 13 11 5 16 36 14 5 26 15 15 9 16 14 16 7 4 7 7 7 4 6 7 8 12 11 15 31 3 7 3 1 9 7 3 1 1 6 5 3 4 7 13 3 3 3 12 13 5 6 9 6 11 19 4 4 1 4 16 5 1 2 2 4 6 4 14 5 3 3 4 6 1 3 1 4 3 3 3 1 2 3 3 5 3 3 8 2 2 2 4 18 4 5 19 5 4 5 5 6 3 3 11 17 5 4 18 5 9 18 13 4 3 1 6 2 2 2 3 1 9 4 9 8 10 4 5 2 2 1 2 4 18 5 5 8 6 9 18 4 4 3 5 7 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_66485429_66486715
seq2: B6Ng01-144H05.b_44_1278 (reverse)

seq1  AGCACTAGGACGGTTGAGAACCACTGCTCAATACTATCTCTCACTTTCCA  50
      ||||||||||| |||||||| ||    ||||| ||||||| ||||   ||
seq2  AGCACTAGGAC-GTTGAGAAACA----TCAAT-CTATCTC-CACT---CA  40

seq1  TGGGAAGTTTGGTTAGTTAAAATGCCTTTATGCATTAGTTTACATGTTTA  100
      |  ||||| | ||        ||||  ||| ||  |||  |||| ||| |
seq2  T--GAAGTGTAGT--------ATGC--TTAAGCCATAG-GTACA-GTTAA  76

seq1  TAAATAGAAATGTATATAATGCTTCTACATATTTTTACTTGAACATGGTT  150
      | ||        | ||||| ||||   || |||||||||   |||||  |
seq2  TGAA--------TGTATAAGGCTT---CACATTTTTACT--GACATG--T  111

seq1  TCATGAAG-ATGGGAAGAAAAGGCATAGCCTATGCTATGAACAATTAAGT  199
      |||||||| |||||||||||| ||||||||||||||||| |||  |||| 
seq2  TCATGAAGAATGGGAAGAAAA-GCATAGCCTATGCTATG-ACA--TAAG-  156

seq1  TACCAGAAAAATTTGGGTGTCCACATTTCTCTACCGCAGGGAACATCTGT  249
      |||||||||||||||||| | |||| ||||||| ||||||||||||||||
seq2  TACCAGAAAAATTTGGGT-TTCACA-TTCTCTA-CGCAGGGAACATCTGT  203

seq1  GTAAGTATCTGATGCTTTTTGGAAAGAAGGATGTCCTGACAGCTTTTTTC  299
      |||||||||||||||||||  ||||||| |||||||||||||| ||||||
seq2  GTAAGTATCTGATGCTTTT--GAAAGAA-GATGTCCTGACAGC-TTTTTC  249

seq1  TCACTAGAAGGTGAGTCGGTGCCACTTACATATTGATATGAAAGTTGATT  349
      ||||||||| ||||||||||||||| ||||||||||||||||||||||||
seq2  TCACTAGAA-GTGAGTCGGTGCCAC-TACATATTGATATGAAAGTTGATT  297

seq1  CCTATGGCAACAGACAGAATCAGAAGCAGTGCCATGCTGTGTGAACTGGA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTATGGCAACAGACAGAATCAGAAGCAGTGCCATGCTGTGTGAACTGGA  347

seq1  AAGTGAAAATCAGAAAAGGCTTGGAATTGGAAGAAGAGTCAGCTTGTGTG  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGAAAATCAGAAAAGGCTTGGAATTGGAAGAAGAGTCAGCTTGTGTG  397

seq1  GCTAATGCTGATACACAAATAAACAGCTGCTGTTGATTATGTACCATCTC  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAATGCTGATACACAAATAAACAGCTGCTGTTGATTATGTACCATCTC  447

seq1  CCTCAGTGATAAGAAATGTTTGCATCAAGTGAGGCAGAGCTCTTGCTTTG  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAGTGATAAGAAATGTTTGCATCAAGTGAGGCAGAGCTCTTGCTTTG  497

seq1  TCCAACATGTGTTTGTGACACTATTAAGCATTCAGATGTATATGCCTTCC  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAACATGTGTTTGTGACACTATTAAGCATTCAGATGTATATGCCTTCC  547

seq1  TGATAAGGTGTTTCTTGGCATGCGTACATTTGGTCACTGGTAAGAATTTC  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATAAGGTGTTTCTTGGCATGCGTACATTTGGTCACTGGTAAGAATTTC  597

seq1  TTCAATAATTTGGAGAAAGTTTTCTCACAGAAAAGTTTGCAAGAGTGGCA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAATAATTTGGAGAAAGTTTTCTCACAGAAAAGTTTGCAAGAGTGGCA  647

seq1  AGCAAACTCAAGATGAACATGATCTAATCCAATTGTACCCATTTCCAGTA  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAAACTCAAGATGAACATGATCTAATCCAATTGTACCCATTTCCAGTA  697

seq1  GAAAAATTTAACAATAGCTTAGATGTAAATAGCAGGAATGTTCCAATTTG  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAAATTTAACAATAGCTTAGATGTAAATAGCAGGAATGTTCCAATTTG  747

seq1  TTAATCTTCCACTTTTCTGTATATTAAGTTGCTTCAACCCATAGGTGTGT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATCTTCCACTTTTCTGTATATTAAGTTGCTTCAACCCATAGGTGTGT  797

seq1  GTTGTAGCTGCTTCTATTGAAACACCCTAAATTAGCATGTGAGTCTGAGG  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTAGCTGCTTCTATTGAAACACCCTAAATTAGCATGTGAGTCTGAGG  847

seq1  CAAGCATTTTCCTATTTTTTTCTAATCTTTGCTCATTGACAATTATTTGG  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGCATTTTCCTATTTTTTTCTAATCTTTGCTCATTGACAATTATTTGG  897

seq1  CTTCCTTCTTCCAAATTAGTAAAGAAAATGGCTTTCTATCCTACTCTGTT  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCTTCTTCCAAATTAGTAAAGAAAATGGCTTTCTATCCTACTCTGTT  947

seq1  CCCCACTCAAATACTTTAAAGAATCAGATTGTAAAAACGATCTTGCTCTA  1049
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCACTCAAATACTTTAAAGAATCAGATTGTAAAAACGATCTTGCTCTA  997

seq1  TTCTTCTTTCGTCCCAGACATTATTGCTTAGGGGTCAGATGGAAAATAGT  1099
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCTTTCGTCCCAGACATTATTGCTTAGGGGTCAGATGGAAAATAGT  1047

seq1  TTGAATTGTTCCTGTGTAAATTTTTAAGAGAACAGGTGTTATGTACTATA  1149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAATTGTTCCTGTGTAAATTTTTAAGAGAACAGGTGTTATGTACTATA  1097

seq1  AGACAATTTTTAAAAATATTCCCTTAATGATAATTTCAAAAACAATGTGA  1199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAATTTTTAAAAATATTCCCTTAATGATAATTTCAAAAACAATGTGA  1147

seq1  TACTTTCTAACAAATATTATAAATTTGGTAGTTGAAGCTACCAAACAATA  1249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTTCTAACAAATATTATAAATTTGGTAGTTGAAGCTACCAAACAATA  1197

seq1  AAGGGTTTCTCTGAGCTTTTCTCATCTCAAAAGAATTC  1287
      ||||||||||||||||||||||||||||||||||||||
seq2  AAGGGTTTCTCTGAGCTTTTCTCATCTCAAAAGAATTC  1235

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information