MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-149O01
Chromosome	X (Build37)
Map Location	135,429,651 - 135,430,639
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Il1rapl2, 1700025D03Rik
Downstream gene	Nrk, Serpina7, 4930513O06Rik, 4933428M09Rik, Mum1l1, LOC675062, Trap1a, C330013F16Rik, EG666359, D330045A20Rik, Rnf128, LOC622432, Tbc1d8b, Ripply1, Cldn2, Morc4
Link	Open Mouse BAC browser

Click to get alignment info.

name	Il1rapl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60367 MGI:1913106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700025D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67944 MGI:1915194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nrk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27206 MGI:1351326
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Serpina7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331535 MGI:3041197
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930513O06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75125 MGI:1922375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	4933428M09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71248 MGI:1918498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	Mum1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245631 MGI:2445062
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675062 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675062
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Trap1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22037 MGI:98818
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C330013F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78526 MGI:1925776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG666359 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666359 MGI:3646568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	D330045A20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102871 MGI:2147848
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rnf128 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66889 MGI:1914139
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins pseudo : _no_value

name	Tbc1d8b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245638 MGI:1918101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ripply1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622473 MGI:3614797
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cldn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12738 MGI:1276110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75746 MGI:1922996
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il1rapl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507615 GeneID:60367 MGI:1913106
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 receptor accessory protein-like 2 transcript_id : NM_030688.1

name	1700025D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347369 GeneID:67944 MGI:1915194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025D03 gene transcript_id : NM_026469.2

name	Nrk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7305326 GeneID:27206 MGI:1351326
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Nik related kinase transcript_id : NM_013724.1

name	Serpina7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46849769 GeneID:331535 MGI:3041197
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7 transcript_id : NM_177920.4

name	4930513O06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408277 GeneID:75125 MGI:1922375
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930513O06 gene transcript_id : XM_136059.4

name	4933428M09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272283 GeneID:71248 MGI:1918498
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933428M09 gene transcript_id : XM_001475652.1

name	Mum1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31342136 GeneID:245631 MGI:2445062
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma associated antigen (mutated) 1-like 1 transcript_id : NM_175541.2

name	Trap1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755870 GeneID:22037 MGI:98818
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tumor rejection antigen P1A transcript_id : NM_011635.1

name	C330013F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272285 GeneID:78526 MGI:1925776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA C330013F16 gene transcript_id : XM_001475717.1

name	D330045A20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351317 GeneID:102871 MGI:2147848
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA D330045A20 gene transcript_id : NM_175326.3

name	Rnf128 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378619 GeneID:66889 MGI:1914139
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ring finger protein 128 transcript_id : NM_023270.4

name	Tbc1d8b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125630635 GeneID:245638 MGI:1918101
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 8B transcript_id : NM_001081499.1

name	Ripply1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83776578 GeneID:622473 MGI:3614797
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ripply1 transcript_id : NM_001037915.1

name	Cldn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47270694 GeneID:12738 MGI:1276110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : claudin 2 transcript_id : NM_016675.3

name	Morc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383330 GeneID:75746 MGI:1922996
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : microrchidia 4 transcript_id : NM_029413.2

name	Il1rapl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507616 CCDS:CCDS30429.1 GeneID:60367 MGI:1913106
definition	GO_function : GO:0004910 - interleukin-1, Type II, blocking receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : interleukin 1 receptor accessory protein-like 2 protein_id : NP_109613.1

name	1700025D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347370 GeneID:67944 MGI:1915194
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : novel protein likely orthologue of human testis expressed sequence 13A (TEX13A) product : hypothetical protein LOC67944 protein_id : NP_080745.2

name	Nrk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305327 GeneID:27206 MGI:1351326
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence ISS] [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0007256 - activation of JNKK activity [Evidence IDA] codon_start : 1 exception : mismatches in translation product : Nik related kinase protein_id : NP_038752.1

name	Serpina7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46559749 GeneID:331535 MGI:3041197
definition	GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IEA] codon_start : 1 note : alpha-1 antiproteinase, antitrypsin, 7; serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7; serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antipeptidase, antitrypsin), member 7 product : thyroxine-binding globulin protein_id : NP_808588.2

name	4930513O06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985593 GeneID:75125 MGI:1922375
definition	codon_start : 1 product : hypothetical protein LOC75125 protein_id : XP_136059.1

name	4933428M09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272284 GeneID:71248 MGI:1918498
definition	codon_start : 1 product : hypothetical protein LOC71248 protein_id : XP_001475702.1

name	Mum1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789431 CCDS:CCDS30432.1 GeneID:245631 MGI:2445062
definition	codon_start : 1 product : melanoma associated antigen (mutated) 1-like 1 protein_id : NP_780750.1

name	Trap1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755871 CCDS:CCDS30433.1 GeneID:22037 MGI:98818
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : tumor rejection antigen P1A protein_id : NP_035765.1

name	C330013F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272286 GeneID:78526 MGI:1925776
definition	codon_start : 1 product : hypothetical protein LOC78526 protein_id : XP_001475767.1

name	D330045A20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425010 CCDS:CCDS30434.1 GeneID:102871 MGI:2147848
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] codon_start : 1 note : likely orthologue of H. sapiens Chromosome X open reading frame 57 (CXorf57) product : hypothetical protein LOC102871 protein_id : NP_780535.1

name	Rnf128 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560218 CCDS:CCDS30435.1 GeneID:66889 MGI:1914139
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005770 - late endosome [Evidence IDA] GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence IDA] [Evidence ISS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0042036 - negative regulation of cytokine biosynthesis [Evidence IDA] codon_start : 1 exception : mismatches in translation product : ring finger protein 128 protein_id : NP_075759.2

name	Tbc1d8b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125630636 GeneID:245638 MGI:1918101
definition	codon_start : 1 product : TBC1 domain family, member 8B protein_id : NP_001074968.1

name	Ripply1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83776579 CCDS:CCDS30436.1 GeneID:622473 MGI:3614797
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : Down syndrome critical region homolog 6-like product : Ripply1 protein protein_id : NP_001033004.1

name	Cldn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7710004 CCDS:CCDS30437.1 GeneID:12738 MGI:1276110
definition	GO_component : GO:0016021 - integral to membrane [Evidence NAS]; GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0016338 - calcium-independent cell-cell adhesion [Evidence IDA] codon_start : 1 product : claudin 2 protein_id : NP_057884.1

name	Morc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794186 GeneID:75746 MGI:1922996
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation note : zinc finger, CW-type with coiled-coil domain 2 product : microrchidia 4 protein_id : NP_083689.1

name	LOC675062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675062
definition	number : 2 pseudo : _no_value

name	LOC675062 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675062
definition	number : 1 pseudo : _no_value

name	EG666359 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408280 GeneID:666359 MGI:3646568
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG666359 pseudo : _no_value transcript_id : XR_001862.1

name	LOC622432 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272287 GeneID:622432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 17 Proteins product : similar to Glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_032430.1

clone name	MSMg01-433F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-396D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300E04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508H15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-464K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-050I07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308P08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545A01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-524C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-115K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-102G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-381J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347N06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-201I02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179F01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124J07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-361H12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-452O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294O19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-308J18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365H05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-114H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-024H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-315H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-035E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-257D24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201H01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290M11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207L02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108H12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185K12
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-149O01.b	B6Ng01-149O01.g
ACC	DH946096	DH946097
length	1,180	989
definition	DH946096\|Mus musculus domesticus DNA, BAC clone: B6Ng01-149O01, 5' end.	DH946097\|Mus musculus domesticus DNA, BAC clone: B6Ng01-149O01, 3' end.
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcttccttttttcctcttttttactttctggctcacaaagagttga tgaactctgagccacttgactgatcagtgaggagcctgtgagttgtagaa caaagggccagagtagttagcttttgtccttaattcactgatgctaacag caggagtcaactgccagaaaccagcagcttttagtcacaaaacagcaaga gtaaaatttctagaagccatcagcttttgatgtccagaacaataagagag acttacaaggccagagatcaccagtctttggccttcatccaattcagtgt tgtgtctcatctcagtacctgtcatgctgggaaggtctctggaagatatt atgtacctatcaaattgcattttaaagatttctgttcatagtcattaatt attgctgctgtagcttgttccgtggaactttttgcggtgggcagtagtta ttgtggaaactcataactagtcatatttctgaatagaataatttactatt gctgtatcatactagcccaatgatcaaccctaaatgggagaaaatgatca aacatctctatcatccctatcaaggctctggggccattagggaagtgaga tgagaaaaagtgtaaaagctaaaggaagggtggaatgtggaagactttcc agatgacacatgactgttttacaactgtgaattgagatcatctgtgaata cccacaggaaaccttcacaagacagggccattggtgcttccatttaaaac tgtggttctcaaccttcctaatgctggacccttcaacacagtttttcatg ttgtggtgacctcaaccataaaatcatttcattgctactttataactgta atttcacttctgctatgattttaatgtaaatatttgatatgtgttgaatc ctgtgcgggttgcagccttcaggttgaaaattgctagtttagaaggaagg gccagggcagtattagaaccacattgagattctagccatccatcctgcac ccatcttttaggtgtatgtaattctcttttatcttttatgaggtcccatg agtgcagaacaccatggaaacacataaattaactaagtgtttactccata tcatggtgacttcagggagtaccaacctggatggttaaggtccaatccag tttgttttccttttaagccaaatatattca	gaattctaaacatcacacaattgcagatacaatgggcagctggcaaaacc gtgtctctgcaaaaatgaggtaaatcatattctactgccacctatcccca cacctagggttcaaacaaagccatagtctcacaatatttgtgtctttttt ttagaattgtcactataaatcccataattaaatagtttcatttataagag ttgctttgatcaggatttcaatttgcaacaatagaacagtgaccaagaag gacatgctactgcagaaggaaaaaaaaaatctcctggcatcctgtcccta gacaaagaactgcaagtaactaataagtttctagagagggggaattatcc tgtcctgtggtaaaacccctggttgcttatttaatacaaagttgtcattc ctgacagcatgaacatataaacaacacatttgcattcagtaggttatgtt catatatttatgcacatatgtaatatgcatgtgtatgtaaatataataaa aagtaaagctatggaaatgaaacccaaagcctttaatgtttatctcagtg agaaaagatgagaaatagaggaaactacctttttctttatacttccttgt atgatttaaagtgtttgaaaatcaataaaagttgatatggccatgaaaag tttagctggaaaagtctgaaagaatagtgccactatgaagggaaacgact aacagatggggcaagcattactcttataagaataagaagtccaagataaa gaatcaataagatatgtcctataacttaagtgtggacttgtagcacaatc atttagacacatttccaaaggtgaataacaacccaccttgctcccatatg cactcactgatcttgaagatcctctttactgttacaatactccaaagagc taaacagaaaatactgaagtggacatttgcagactgtgatgagaggatag tgatgccttgaagtgggaggaggttaaggggagaagaaa
quality values	Open. Hide. 57 42 32 38 61 61 61 61 61 37 47 61 61 61 61 61 61 61 61 61 61 61 61 61 61 35 32 43 37 28 34 29 27 52 61 55 55 47 52 55 55 61 61 61 59 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 59 59 61 59 59 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 43 61 61 61 61 53 61 53 57 53 57 57 57 57 57 53 57 47 52 57 57 57 57 57 50 57 57 57 57 57 57 53 57 57 53 57 57 57 42 40 46 38 57 47 53 52 57 57 57 57 42 53 53 53 43 47 35 57 57 52 53 57 57 57 57 45 42 42 29 42 57 57 57 45 52 52 53 57 57 53 52 53 53 39 57 52 50 52 38 53 48 39 52 33 57 47 57 47 38 52 42 53 57 53 53 53 42 42 53 32 53 52 39 42 53 41 52 53 38 37 50 57 33 57 57 52 42 50 25 53 53 50 57 52 53 53 43 35 47 52 50 40 45 45 45 42 53 52 53 52 33 53 52 30 42 36 42 57 52 38 41 25 33 52 52 57 53 41 51 50 42 50 38 34 14 57 37 46 27 42 38 57 57 33 53 35 37 33 57 31 35 52 32 48 30 32 37 20 53 33 29 36 57 57 41 32 37 53 40 57 40 31 33 37 36 35 27 33 39 53 44 41 44 44 21 22 32 30 34 21 40 40 47 29 25 53 45 28 53 32 21 48 41 34 37 27 32 40 57 57 57 37 37 25 31 48 16 46 40 20 32 32 28 31 29 22 39 30 44 27 24 27 44 26 39 29 51 51 46 36 32 22 44 51 38 30 29 33 19 48 33 35 32 26 30 51 16 29 29 13 36 47 21 30 26 29 33 21 51 27 35 31 48 38 28 39 22 37 23 12 15 21 35 48 31 51 51 31 39 33 28 48 13 46 46 18 21 15 6 51 46 18 28 18 27 19 39 16 43 29 27 29 29 30 29 28 39 19 31 13 29 29 23 46 34 20 33 14 22 25 19 35 33 17 33 33 16 19 16 7 31 28 36 41 41 10 7 11 27 31 12 14 28 30 51 30 25 17 46 23 23 29 26 18 26 39 26 23 29 14 22 39 41 23 24 11 10 24 12 18 7 9 15 25 23 25 17 38 20 23 27 30 16 6 26 21 27 41 30 33 28 34 27 23 51 14 18 10 11 20 20 26 38 27 22 26 51 30 9 13 14 8 38 26 19 11 7 5 8 15 7 10 8 28 17 34 18 24 17 10 5 13 18 51 51 22 7 6 12 7 32 29 15 9 8 12 18 10 35 11 34 34 29 12 6 6 21 34 15 19 25 6 14 29 16 16 8 12 6 5 9 31 17 17 32 12 6 5 4 5 4 15 20 16 6 10 14 9 17 28 20 9 4 8 14 8 33 23 6 12 12 8 21 12 6 5 5 6 22 5 15 10 9 17 23 19 22 12 6 3 5 23 6 30 17 6 5 7 8 9 18 11 28 4 7 4 2 3 5 7 11 7 8 17 7 9 15 26 13 5 5 12 4 1 4 18 7 6 7 18 5 24 7 14 4 6 3 3 18 18 5 7 8 21 5 7 5 5 12 5 9 15 6 5 3 3	Open. Hide. 61 47 61 47 55 34 32 19 20 20 22 21 34 24 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 37 55 59 59 59 59 61 61 61 61 61 61 61 59 61 61 59 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 59 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 55 61 61 61 61 61 61 61 55 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 55 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 61 53 61 61 61 61 61 61 61 61 61 57 53 57 57 53 53 57 53 53 53 57 47 53 47 47 57 57 57 52 57 53 53 57 53 57 57 53 53 53 57 57 53 57 57 57 57 47 53 43 57 57 42 57 57 47 47 53 47 57 52 57 57 57 57 53 57 53 57 57 53 57 57 57 57 53 57 57 53 50 45 53 53 53 57 57 57 45 57 57 53 45 52 57 52 33 57 45 53 57 57 57 50 52 35 57 57 52 53 57 57 53 50 45 40 53 53 57 57 57 53 30 38 57 53 41 38 52 52 57 31 26 47 33 53 53 53 57 57 57 33 50 57 38 52 38 53 50 53 53 37 57 57 53 42 40 44 50 52 57 57 53 27 53 38 37 29 23 40 38 29 25 20 45 40 37 53 41 41 34 23 57 53 36 57 36 36 24 47 40 40 23 53 38 37 33 40 37 48 57 57 57 31 33 36 41 40 23 41 53 33 37 41 37 37 40 36 48 28 44 34 47 40 33 23 47 27 48 34 30 31 27 23 17 45 30 32 24 46 46 45 29 46 30 35 36 29 30 32 36 33 27 32 22 32 29 47 29 29 48 29 29 37 35 31 29 21 38 34 38 29 30 36 22 47 29 29 28 29 29 48 32 30 29 29 28 29 27 25 29 33 28 29 51 29 29 27 29 29 22 29 23 33 51 46 28 36 24 43 16 16 23 14 34 28 30 26 22 40 29 24 29 38 51 29 14 29 26 26 26 30 26 28 29 41 29 18 29 23 25 28 25 23 38 29 28 14 29 28 43 29 34 28 23 26 29 25 32 22 25 16 20 32 14 16 26 31 25 23 23 23 43 15 27 20 23 20 24 29 34 34 28 22 28 28 51 21 17 23 12 25 25 13 51 26 6 9 18 39 38 51 30 24 23 33 31 33 19 28 19 13 16 28 17 14 12 35 51 30 14 26 12 9 33 23 22 30 16 25 33 34 31 28 21 30 27 20 22 14 6 4 12 26 24 13 29 17 17 27 24 30 19 19 18 31 30 44 23 29 19 23 25 9 30 14 20 19 13 10 42 35 9 25 5 4 4 4 4 29 29

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_135429651_135430639
seq2: B6Ng01-149O01.g_69_1057

seq1  GAATTCTAAACATCACACAATTGCAGATACAATGGGCAGCTGGCAAAACC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAAACATCACACAATTGCAGATACAATGGGCAGCTGGCAAAACC  50

seq1  GTGTCTCTGCAAAAATGAGGTAAATCATATTCTACTGCCACCTATCCCCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCTCTGCAAAAATGAGGTAAATCATATTCTACTGCCACCTATCCCCA  100

seq1  CACCTAGGGTTCAAACAAAGCCATAGTCTCACAATATTTGTGTCTTTTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCTAGGGTTCAAACAAAGCCATAGTCTCACAATATTTGTGTCTTTTTT  150

seq1  TTAGAATTGTCACTATAAATCCCATAATTAAATAGTTTCATTTATAAGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGAATTGTCACTATAAATCCCATAATTAAATAGTTTCATTTATAAGAG  200

seq1  TTGCTTTGATCAGGATTTCAATTTGCAACAATAGAACAGTGACCAAGAAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGCTTTGATCAGGATTTCAATTTGCAACAATAGAACAGTGACCAAGAAG  250

seq1  GACATGCTACTGCAGAAGGAAAAAAAAAATCTCCTGGCATCCTGTCCCTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATGCTACTGCAGAAGGAAAAAAAAAATCTCCTGGCATCCTGTCCCTA  300

seq1  GACAAAGAACTGCAAGTAACTAATAAGTTTCTAGAGAGGGGGAATTATCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAAAGAACTGCAAGTAACTAATAAGTTTCTAGAGAGGGGGAATTATCC  350

seq1  TGTCCTGTGGTAAAACCCCTGGTTGCTTATTTAATACAAAGTTGTCATTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTGTGGTAAAACCCCTGGTTGCTTATTTAATACAAAGTTGTCATTC  400

seq1  CTGACAGCATGAACATATAAACAACACATTTGCATTCAGTAGGTTATGTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGACAGCATGAACATATAAACAACACATTTGCATTCAGTAGGTTATGTT  450

seq1  CATATATTTATGCACATATGTAATATGCATGTGTATGTAAATATAATAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATATATTTATGCACATATGTAATATGCATGTGTATGTAAATATAATAAA  500

seq1  AAGTAAAGCTATGGAAATGAAACCCAAAGCCTTTAATGTTTATCTCAGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTAAAGCTATGGAAATGAAACCCAAAGCCTTTAATGTTTATCTCAGTG  550

seq1  AGAAAAGATGAGAAATAGAGGAAACTACCTTTTTCTTTATACTTCCTTGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAGATGAGAAATAGAGGAAACTACCTTTTTCTTTATACTTCCTTGT  600

seq1  ATGATTTAAAGTGTTTGAAAATCAATAAAAGTTGATATGGCCATGAAAAG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATTTAAAGTGTTTGAAAATCAATAAAAGTTGATATGGCCATGAAAAG  650

seq1  TTTAGCTGGAAAAGTCTGAAAGAATAGTGCCACTATGAAGGGAAACGACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAGCTGGAAAAGTCTGAAAGAATAGTGCCACTATGAAGGGAAACGACT  700

seq1  AACAGATGGGGCAAGCATTACTCTTATAAGAATAAGAAGTCCAAGATAAA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACAGATGGGGCAAGCATTACTCTTATAAGAATAAGAAGTCCAAGATAAA  750

seq1  GAATCAATAAGATATGTCCTATAACTTAAGTGTGGACTTGTAGCACAATC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCAATAAGATATGTCCTATAACTTAAGTGTGGACTTGTAGCACAATC  800

seq1  ATTTAGACACATTTCCAAAGGTGAATAACAACCCACCTTGCTCCCATATG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTAGACACATTTCCAAAGGTGAATAACAACCCACCTTGCTCCCATATG  850

seq1  CACTCACTGATCTTGAAGATCCTCTTTACTGTTACAATACTCCAAAGAGC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCACTGATCTTGAAGATCCTCTTTACTGTTACAATACTCCAAAGAGC  900

seq1  TAAACAGAAAATACTGAAGTGGACATTTGCAGACTGTGATGAGAGGATAG  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACAGAAAATACTGAAGTGGACATTTGCAGACTGTGATGAGAGGATAG  950

seq1  TGATGCCTTGAAGTGGGAGGAGGTTAAGGGGAGAGGAAA  989
      |||||||||||||||||||||||||||||||||| ||||
seq2  TGATGCCTTGAAGTGGGAGGAGGTTAAGGGGAGAAGAAA  989

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information