MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-171M09
Chromosome	X (Build37)
Map Location	145,964,463 - 146,151,678
singlet/doublet	doublet
Overlap gene	LOC382243, EG666961
Upstream gene	LOC666861, EG666864, LOC434866, EG666868, EG624260, LOC434865, EG624310, Ott, LOC666888, LOC100039598, LOC100039890, LOC100039612, EG666923, EG624378, LOC100039934, LOC100039629
Downstream gene	EG666968, OTTMUSG00000018988, LOC100039651, EG624568, LOC382244, LOC100039669, EG666982, EG624631, EG546387, LOC333588, Tmem29, LOC100040101, Alas2, Apex2, Pfkfb1, Tro, LOC100039716
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC666861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666864 MGI:3648921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 8 Proteins

name	EG666868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666868 MGI:3644011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG624260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624260 MGI:3646683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 16 ESTs, 4 Proteins

name	EG624310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ott (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18422 MGI:107573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 15 ESTs, 9 Proteins

name	LOC100039612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666923 MGI:3645202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG624378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624378 MGI:3644585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039934 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 6 Proteins

name	LOC100039629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC382243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666961 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666961 MGI:3644995
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG666968 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666968 MGI:3648805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	OTTMUSG00000018988 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434869 MGI:3710639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 4 Proteins

name	LOC100039651 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039651
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG624568 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624568 MGI:3643049
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC382244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 8 Proteins

name	LOC100039669 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039669
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666982 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666982 MGI:3644367
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG624631 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624631 MGI:3647290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	EG546387 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546387 MGI:3644989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 130 ESTs, 5 Proteins

name	LOC333588 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:333588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	Tmem29 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 38 ESTs, 1 Protein

name	LOC100040101 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Alas2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11656 MGI:87990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Apex2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77622 MGI:1924872
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pfkfb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18639 MGI:107816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tro (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56191 MGI:1928994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100039716 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272441 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001487784.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272443 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_001487786.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272445 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_001487787.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272447 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001487785.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272451 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 5 transcript_id : XM_001487788.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272449 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 6 transcript_id : XM_001487789.1

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408362 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_486789.4

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408364 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_897890.2

name	EG624310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272430 GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624310 transcript_id : XM_888852.2

name	Ott (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859585 GeneID:18422 MGI:107573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed transcript_id : NM_011022.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272457 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 5 Proteins product : similar to ovary testis transcribed, transcript variant 1 transcript_id : XM_001473712.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272459 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to ovary testis transcribed, transcript variant 2 transcript_id : XM_001473728.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272461 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs, 1 Protein product : similar to ovary testis transcribed, transcript variant 3 transcript_id : XM_001473747.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272465 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : similar to Ott protein, transcript variant 1 transcript_id : XM_001473791.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272467 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 1 Protein product : similar to Ott protein, transcript variant 2 transcript_id : XM_001473809.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272469 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to Ott protein, transcript variant 3 transcript_id : XM_001473830.1

name	LOC382243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:130507580 GeneID:382243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed like transcript_id : NM_001037716.2

name	OTTMUSG00000018988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408373 GeneID:434869 MGI:3710639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : predicted gene, OTTMUSG00000018988, transcript variant 1 transcript_id : XM_486794.3

name	OTTMUSG00000018988 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408374 GeneID:434869 MGI:3710639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : predicted gene, OTTMUSG00000018988, transcript variant 3 transcript_id : XM_897991.2

name	LOC382244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408376 GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_356360.4

name	LOC382244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272473 GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001473979.1

name	LOC382244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272475 GeneID:382244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001473992.1

name	EG624631 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272436 GeneID:624631 MGI:3647290
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624631 transcript_id : XM_889176.3

name	LOC333588 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272484 GeneID:333588
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : hypothetical LOC333588 transcript_id : XM_001474045.1

name	Tmem29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408378 GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 34 ESTs, 1 Protein product : transmembrane protein 29, transcript variant 1 transcript_id : XM_356361.4

name	Tmem29 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408377 GeneID:382245 MGI:1923420
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 34 ESTs, 1 Protein product : transmembrane protein 29, transcript variant 2 transcript_id : XM_898013.2

name	LOC100040101 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272487 GeneID:100040101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical protein LOC100040101 transcript_id : XM_001474106.1

name	Alas2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130319 GeneID:11656 MGI:87990
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : aminolevulinic acid synthase 2, erythroid transcript_id : NM_009653.2

name	Apex2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21541817 GeneID:77622 MGI:1924872
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : apurinic/apyrimidinic endonuclease 2 transcript_id : NM_029943.1

name	Pfkfb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361607 GeneID:18639 MGI:107816
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 1 transcript_id : NM_008824.2

name	Tro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110618257 GeneID:56191 MGI:1928994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophinin transcript_id : NM_019548.3

name	Tro (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110618254 GeneID:56191 MGI:1928994
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : trophinin transcript_id : NM_001002272.2

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272442 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487834.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272446 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001487837.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272444 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001487836.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272448 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487835.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272452 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_001487838.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272450 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 6 protein_id : XP_001487839.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772471 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 1 protein_id : XP_486789.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408365 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 4 protein_id : XP_902983.2

name	EG624310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272431 GeneID:624310 MGI:3644796
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893945.2

name	Ott (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859586 GeneID:18422 MGI:107573
definition	codon_start : 1 product : ovary testis transcribed protein_id : NP_035152.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272458 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473762.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272462 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001473797.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272460 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473778.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272466 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 1 protein_id : XP_001473841.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272468 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 2 protein_id : XP_001473859.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272470 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 3 protein_id : XP_001473880.1

name	LOC382243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:130507581 GeneID:382243
definition	codon_start : 1 product : ovary testis transcribed like protein_id : NP_001032805.2

name	OTTMUSG00000018988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772479 GeneID:434869 MGI:3710639
definition	codon_start : 1 product : hypothetical protein LOC434869 isoform 1 protein_id : XP_486794.1

name	OTTMUSG00000018988 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408375 GeneID:434869 MGI:3710639
definition	codon_start : 1 product : hypothetical protein LOC434869 isoform 3 protein_id : XP_903084.2

name	LOC382244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:38086787 GeneID:382244
definition	codon_start : 1 product : hypothetical protein LOC382244 isoform 3 protein_id : XP_356360.1

name	LOC382244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272476 GeneID:382244
definition	codon_start : 1 product : hypothetical protein LOC382244 isoform 2 protein_id : XP_001474042.1

name	LOC382244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272474 GeneID:382244
definition	codon_start : 1 product : hypothetical protein LOC382244 isoform 1 protein_id : XP_001474029.1

name	EG624631 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272437 GeneID:624631 MGI:3647290
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_894269.3

name	LOC333588 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272485 GeneID:333588
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474095.1

name	Tmem29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004391 GeneID:382245 MGI:1923420
definition	codon_start : 1 product : similar to chromosome X open reading frame 44, isoform 1 protein_id : XP_356361.3

name	Tmem29 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004389 GeneID:382245 MGI:1923420
definition	codon_start : 1 product : similar to chromosome X open reading frame 44, isoform 2 protein_id : XP_903106.1

name	LOC100040101 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272488 GeneID:100040101
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474156.1

name	Alas2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859502 GeneID:11656 MGI:87990
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] [Evidence IEA] GO_function : GO:0003870 - 5-aminolevulinate synthase activity [Evidence IMP] [Evidence ISS] [Evidence IEA]; GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016769 - transferase activity, transferring nitrogenous groups [Evidence IEA] GO_process : GO:0009058 - biosynthesis [Evidence IEA]; GO:0030218 - erythrocyte differentiation [Evidence IMP]; GO:0006783 - heme biosynthesis [Evidence IEA] [Evidence IMP]; GO:0006879 - iron ion homeostasis [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : erythroid-specific ALAS; 5-aminolevulinate synthase product : aminolevulinic acid synthase 2, erythroid protein_id : NP_033783.1

name	Apex2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21541818 CCDS:CCDS30463.1 GeneID:77622 MGI:1924872
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003906 - DNA-(apurinic or apyrimidinic site) lyase activity [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : AP endonuclease 2 protein_id : NP_084219.1

name	Pfkfb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74315988 CCDS:CCDS30464.1 GeneID:18639 MGI:107816
definition	GO_component : GO:0043540 - 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 complex [Evidence ISS] GO_function : GO:0003873 - 6-phosphofructo-2-kinase activity [Evidence ISS] [Evidence IEA]; GO:0005524 - ATP binding [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0004331 - fructose-2,6-bisphosphate 2-phosphatase activity [Evidence ISS] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006003 - fructose 2,6-bisphosphate metabolism [Evidence ISS] [Evidence IEA]; GO:0006094 - gluconeogenesis [Evidence ISS]; GO:0006096 - glycolysis [Evidence ISS]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : PFK-2/FBPase-2 gene A; 6-phosphofructo-2-kinase/fructose-2,6-biphosphata se 1 product : 6-phosphofructo-2-kinase/fructose-2, 6-biphosphatase 1 protein_id : NP_032850.1

name	Tro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50593514 GeneID:56191 MGI:1928994
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence IDA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3; necdin and trophinin like; trophinin-2; magphinin-alpha; magphinin-gamma; magphinin-beta 2; melanoma antigen, family D, 3-like product : trophinin isoform 3 protein_id : NP_062421.2

name	Tro (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50593518 CCDS:CCDS30465.1 GeneID:56191 MGI:1928994
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA] GO_process : GO:0007155 - cell adhesion [Evidence ISS]; GO:0030308 - negative regulation of cell growth [Evidence IDA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; necdin and trophinin like; trophinin-2; magphinin-alpha; magphinin-gamma; magphinin-beta 2; melanoma antigen, family D, 3-like product : trophinin isoform 1 protein_id : NP_001002272.1

name	LOC666861 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666861
definition	number : 1 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 2 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 1 pseudo : _no_value

name	EG666868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666868
definition	number : 1 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 2 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 1 pseudo : _no_value

name	LOC666888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666888
definition	number : 1 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 2 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 2 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 3 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 4 pseudo : _no_value

name	EG666923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666923
definition	number : 1 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 2 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 1 pseudo : _no_value

name	LOC100039629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039629
definition	number : 2 pseudo : _no_value

name	LOC100039629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039629
definition	number : 1 pseudo : _no_value

name	EG666961 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666961
definition	number : 1 pseudo : _no_value

name	EG666968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666968
definition	number : 3 pseudo : _no_value

name	EG666968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666968
definition	number : 2 pseudo : _no_value

name	EG666968 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666968
definition	number : 1 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 1 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 2 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 3 pseudo : _no_value

name	LOC100039651 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039651
definition	number : 4 pseudo : _no_value

name	EG624568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624568
definition	number : 2 pseudo : _no_value

name	EG624568 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624568
definition	number : 1 pseudo : _no_value

name	LOC100039669 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039669
definition	number : 1 pseudo : _no_value

name	LOC100039669 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039669
definition	number : 2 pseudo : _no_value

name	LOC100039669 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039669
definition	number : 3 pseudo : _no_value

name	EG666982 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666982
definition	number : 1 pseudo : _no_value

name	EG546387 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272483 GeneID:546387 MGI:3644989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 130 ESTs, 5 Proteins product : predicted gene, EG546387 transcript_id : XR_001595.2

name	LOC100039716 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272438 GeneID:100039716
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to ribosomal protein L13 pseudo : _no_value transcript_id : XR_031183.1

clone name	MSMg01-541N09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-535B02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-078P12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-083G04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-496H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-059C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444B11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-387I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-487M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-130F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069F05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306H21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-140M21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-124L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089K09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-171M09.b	B6Ng01-171M09.g
ACC	GA000565	GA000566
length	1,111	1,185
definition	B6Ng01-171M09.b	B6Ng01-171M09.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(146,150,552 - 146,151,678)	(145,964,463 - 145,965,621)
sequence	gaattcagaatgtgagtcaaatcaatcccttcactccagaactggtgccc aatttcataaaccctgtcaatggcaccaacagccagcatcttatggtaga gttctggagcaattctcatacataagttcattttcctgctcattgtgata ggtgatgaaaggctcggctgaagctctcccagggatgatgttcatcatgg gagttccaaatttcagggatcccagctcatctaagaaacttcttatatct gtgatgatctttagaaaagatgacaaatttctatctcacaaactccttca gtatcaagcccaaatatctctgaagagaccttatttccttgtctttgaag gccaaaatgaagctgaggcacatgtgcaagcagagggacagaagtgtgat ctcctgggggatggtgctcaacttgcccttcttggttttccctggattac cctcaactctaattatatctccctgatgcagtttttattgaggtgcacac attcttcctctgatttataattcctggagttggccatgacttgtaacttg acctcctctccttgaaggtcatagaagatcaattttcccctagacactct cttggatgtgacctgccacttatgatgttagtcaggtgatccccaggctg caggtggctgtattcttgagtgaactgagtgaatgagatgtccacatggt acttgagtgggtatgagtcctccacactgaccttcagctgctggactttg gatcctgtaatattgatttgggtccagagtctcctcctcggcatccaaac caaatgtcagcagtggggttggtggtggcagcagcagtagtcttgtttta gctgttctcatgagctctttctacttgggcctttctcttccagtttcttc tcagctttcagatggctcttcagctcatttttgcttatttcaactcaaca atcactttgacttcactctctgcagagtggcatcccccccccccgtattc tcacttttgaaagtctttttatgcctctagtctttgcatatagcatgtaa aaccttatgtttgtgaaatgttattcctattactgttatgcttgagcatc actgactgttt	gaattcttggtacgtgtaaccacattgttttccattgtcttttattgggt aagagacctctaggtctcgatataataagatgcctcaatctctaggctta gggaattatagatatatgctccctctttgacgttttggtcccatgttaat tggaatatttatggtgttaagaatgggactcaaaaaaaaaaaaaaataaa aagaatgggactccggtttcaatctagctagtgttcgaacatttctttgc actctcaaacctacggctaacatttttgtaattttcttcctttttgctta actttgagaatcattttatgagttagaaaaatgacatagagacagggcag atgagttgcaaaaatcagcagctgcagggaggagggagatggagaagcaa aagagaggaagtcctcctgtcttttaacatagggtccaagaaagcaaaca tacttatcagctgtgtgggaattatgcagagaaagaataagaatggccag actgtcagaacaggcttaggagtttaaccactatttacaaagtaatataa tgaggaaaggaaatgttaactcttttgacattaggacacagaaaagtagg taggtatagtcatacatatcagcaagcaactgctttgtttctttggtttt gtttggtatgattgtttctttgtttgttttttgttttgttttgtttttag agggtctcatacccaagaatagcctcaacactgtttctaaggatattcat gagctcctgatcaatctgcctctatctactaagaactaagattataggca cagctttgaggaattttactaagtgacaatttttatattaatatagttag actactcagttgtgtgggcttttagtagattatgaagatgtggcagtctt tcatcctgaatgtaatttttggaacatttttcactgttgggcctccaaat tgcccatgctcctttttgaggaacacttcctcacgcaggacctttcttgg ccccatggtttcttctggcatccctagtccaagagacacctcacaaatcc aattttctcctatggaacggttttggataacttttggttccaaatatacc taacacttaaaaaggagattgaacctggaatttctatctaacaggtaact tccctaagacgtaggtacctggataataataccta
quality values	Open. Hide. 58 36 22 28 58 41 31 54 62 43 38 49 47 62 62 62 62 47 51 62 62 62 47 56 62 62 62 56 62 56 56 25 35 44 56 49 59 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 46 62 54 62 52 54 62 62 62 62 62 58 58 58 58 54 58 58 54 45 54 58 54 58 58 54 54 58 58 58 45 47 58 58 58 58 58 54 47 58 58 58 58 54 58 58 58 58 47 58 58 58 58 33 49 25 42 54 54 54 52 58 58 54 54 41 54 47 41 48 58 58 58 54 46 41 58 49 50 50 54 40 52 58 58 58 53 54 53 58 58 47 41 30 45 38 48 44 37 58 53 58 58 49 34 58 58 53 53 52 58 58 46 58 52 50 52 51 51 49 52 35 49 40 58 39 37 53 49 41 41 50 33 47 58 52 51 46 39 32 54 46 58 49 46 58 52 50 41 32 41 54 42 58 51 53 34 58 53 51 46 32 39 51 58 32 52 53 41 44 28 52 58 40 53 33 39 41 58 50 39 53 37 52 49 54 29 40 39 28 29 39 39 28 45 51 54 54 37 38 31 40 49 21 38 35 54 40 37 49 37 53 42 47 47 54 39 49 35 46 53 40 42 29 41 42 53 39 37 51 23 40 29 37 54 40 40 54 37 31 28 53 31 51 28 32 53 37 42 31 33 26 32 15 53 53 53 52 40 22 52 33 31 32 39 18 32 32 32 34 25 28 31 33 34 39 26 32 29 14 29 33 31 31 51 29 20 21 8 51 16 18 51 31 32 35 28 31 36 29 27 38 51 46 38 15 14 21 43 26 28 13 10 21 22 21 30 29 31 31 19 41 33 34 22 42 26 21 33 14 30 18 9 46 48 10 30 32 43 34 22 16 12 29 21 32 10 22 31 26 24 38 31 27 39 46 16 25 26 28 25 16 28 13 41 25 21 11 18 31 27 15 12 16 8 35 13 30 31 19 25 44 22 28 9 35 31 30 32 27 19 38 35 48 11 30 27 14 42 11 7 11 44 25 31 31 10 28 32 19 27 22 13 10 33 39 43 37 15 32 25 12 7 22 8 31 26 19 14 17 32 32 32 17 6 7 7 13 7 17 6 6 24 40 15 32 10 10 22 19 32 22 22 12 13 26 30 7 21 11 16 12 21 10 17 23 15 3 3 14 16 8 6 7 4 9 5 18 5 9 8 10 13 26 23 9 27 21 16 6 6 9 29 21 25 7 13 47 27 20 20 7 17 30 47 38 18 13 14 10 15 5 9 25 9 12 5 5 12 18 30 25 11 13 4 6 22 5 6 5 14 12 5 7 7 18 28 21 22 5 7 23 19 16 8 20 5 8 8 13 7 4 3 16 22 6 6 2 3 3 4 9 5 17 5 4 7 11 9 7 7 9 5 1 4 4 3 5 3 7 9 10 16 5 3 3 2 4 10 1 3 7 12 5 5 11 28 6	Open. Hide. 62 47 30 47 42 42 32 27 38 27 27 29 38 46 56 62 62 59 62 62 59 59 59 59 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 59 59 54 62 62 56 59 50 43 38 48 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 56 62 59 59 59 56 62 59 59 59 50 62 59 59 56 62 59 59 59 59 56 59 62 59 51 62 62 62 54 56 59 59 62 62 62 62 62 62 62 62 62 62 59 62 56 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 59 62 62 62 59 59 59 59 62 59 62 59 62 51 62 59 59 49 56 59 62 62 62 62 62 62 51 62 62 59 62 62 62 62 62 56 59 59 49 62 62 62 62 62 62 62 62 59 59 59 59 59 59 59 59 59 62 62 56 62 62 62 62 56 62 62 62 47 62 62 49 62 62 62 62 47 47 47 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 56 62 62 46 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 40 38 62 62 62 62 46 28 41 54 62 54 62 62 54 49 54 62 62 62 62 54 62 41 41 62 62 52 62 42 62 62 62 62 62 54 54 58 54 58 58 52 52 52 46 58 58 54 54 58 58 54 58 52 54 49 54 54 50 54 54 58 58 54 58 52 50 45 45 54 58 58 54 50 54 35 58 47 54 54 54 52 54 53 58 54 54 54 58 58 58 41 41 47 48 54 58 58 54 47 48 58 42 36 34 40 41 51 53 58 58 58 58 58 51 50 40 58 53 46 34 58 42 40 41 42 49 33 49 58 58 53 39 42 49 46 46 46 50 58 51 50 33 47 46 53 49 48 25 39 40 58 50 52 52 51 52 51 34 51 53 50 50 49 53 53 51 48 58 50 58 58 41 47 49 43 58 58 52 58 48 58 50 37 51 29 24 51 27 58 50 54 51 21 35 28 34 58 39 29 58 26 54 50 58 41 51 40 58 32 51 33 36 15 54 58 58 58 42 54 50 54 33 25 54 29 54 54 32 36 24 50 51 52 41 47 31 42 34 54 29 31 53 45 40 32 38 37 38 50 49 16 23 17 51 44 44 41 24 31 37 36 37 54 42 29 23 40 42 53 40 54 33 39 28 31 52 32 31 34 24 31 52 26 37 30 40 41 33 13 53 31 25 33 26 45 45 26 32 40 41 39 42 25 45 31 41 33 35 34 36 31 34 33 36 35 32 21 25 29 34 32 30 31 34 36 17 38 26 25 29 21 30 14 15 19 13 31 29 32 35 31 46 29 16 21 12 31 31 21 29 51 51 32 13 27 31 9 7 9 11 27 21 31 25 17 18 46 46 40 24 8 8 16 30 27 7 14 8 6 5 13 31 31 31 31 24 29 25 29 29 27 23 28 20 28 25 6 36 21 31 9 13 46 26 18 10 46 41 36 25 9 18 31 22 41 11 31 10 20 26 22 10 6 37 18 16 13 10 11 31 14 31 8 23 18 48 11 32 11 32 32 38 8 31 11 22 24 11 14 24 12 9 44 44 44 38 16 10 37 17 10 9 16 42 35 31 11 7 5 6 11 17 14 6 15 31 17 32 14 6 5 30 16 33 26 9 14 20 12 34 23 20 24 34 24 20 11 38 8 39 33 34 20 29 10 6 5 8 5 7 6 5 7 6 15 24 4 6 6 5 9 14 12 8 7 14 9 11 8 34 18 9 10 28 13 24 19 40 40 18 6 10 11 16 10 29 10 11 12 8 13 9 16 11 9 11 28 13 28 10 20 11 6 21 13 15 7 28 8 10 8 28 13 20 27 11 25 6 5 13 27 28 8 6 8 13 6 8 13 40 47 10 12 11 3 11 4 7 16 16 11 4 12 8 13 7 24 28 23 23 8 9 6 4 6 7 9 12 24 28 18 8 12 8 9 15 4 3 13 1 5 4 9 11 4 6 6 4 3 9 9 6 10 5 7 21 17 17 8 14 23 8 5 5 3 8 7 18 23 5 5 12 11 17 4 7 8 24 4 3 2 3 4 11 19 14 8 8 4 13 3 1 4 3 2 2 4 4 3 9 3 3 4 9 9 5 13 4 2 4 11 9 3 1 3 18 9 16 7 5 18 8 5 6 14 10 5 9 16 4 1

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_146150552_146151678
seq2: B6Ng01-171M09.b_48_1158 (reverse)

seq1  AAACAGTCAGGTGATAGCCTCAGGGCATAACAGTAATAGGAAATAAACAT  50
      ||||||||| |||||   ||||  ||||||||||||||||||   |||| 
seq2  AAACAGTCA-GTGAT--GCTCA-AGCATAACAGTAATAGGAA--TAACA-  43

seq1  TTTCAC-AACATAAGTTTTTACATGCTATTATGGCAAAGACTAGGAGGCA  99
      |||||| |||||||| |||||||||||| ||| |||||||||| ||||| 
seq2  TTTCACAAACATAAGGTTTTACATGCTA-TAT-GCAAAGACTA-GAGGC-  89

seq1  ATAAAAAGACTTTCAAAAGTGAGAATACGGGGGGGGGGGGGGAATGGCCA  149
      |||||||||||||||||||||||||||||||||||||||    || ||||
seq2  ATAAAAAGACTTTCAAAAGTGAGAATACGGGGGGGGGGG----AT-GCCA  134

seq1  CTCTGCAGGAGAGTGAAGTCAAAGTGGATGTTGAGTTGAAATTAAGCAAA  199
      ||||||| ||||||||||||||||||  ||||||||||||| ||||||||
seq2  CTCTGCA-GAGAGTGAAGTCAAAGTGATTGTTGAGTTGAAA-TAAGCAAA  182

seq1  AATGAGCTGAAGAGGCATCTGAAAGCTGAGAAGAAACTGGAAGAGAAAGG  249
      |||||||||||||| |||||||||||||||||||||||||||||||||||
seq2  AATGAGCTGAAGAGCCATCTGAAAGCTGAGAAGAAACTGGAAGAGAAAGG  232

seq1  -CCAAGTAGAAAGAGCTCAATGAGAAACAGCT-AAACAAGACTACTGCTG  297
       ||||||||||||||||| ||||| ||||||| |||||||||||||||||
seq2  CCCAAGTAGAAAGAGCTC-ATGAG-AACAGCTAAAACAAGACTACTGCTG  280

seq1  CTGCCACCACCAACCCCACTGCTGACA-TTGGTTTGGATGCCGAGGAGGA  346
      ||||||||||||||||||||||||||| ||||||||||||||||||||||
seq2  CTGCCACCACCAACCCCACTGCTGACATTTGGTTTGGATGCCGAGGAGGA  330

seq1  GACTCTGGACCCAAATCAATATTACAGGATCCAAAGTCCAGCAGCTGAAG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCTGGACCCAAATCAATATTACAGGATCCAAAGTCCAGCAGCTGAAG  380

seq1  GTCAGTGTGGAGGACTCATACCCACTCAAGTACCATGTGGACATCTCATT  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAGTGTGGAGGACTCATACCCACTCAAGTACCATGTGGACATCTCATT  430

seq1  CACTCAGTTCACTCAAGAATACAGCCACCTGCAGCCTGGGGATCACCTGA  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCAGTTCACTCAAGAATACAGCCACCTGCAGCCTGGGGATCACCTGA  480

seq1  CTAACATCATAAGTGGCAGGTCACATCCAAGAGAGTGTCTAGGGGAAAAT  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACATCATAAGTGGCAGGTCACATCCAAGAGAGTGTCTAGGGGAAAAT  530

seq1  TGATCTTCTATGACCTTCAAGGAGAGGAGGTCAAGTTACAAGTCATGGCC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATCTTCTATGACCTTCAAGGAGAGGAGGTCAAGTTACAAGTCATGGCC  580

seq1  AACTCCAGGAATTATAAATCAGAGGAAGAATGTGTGCACCTCAATAAAAA  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCCAGGAATTATAAATCAGAGGAAGAATGTGTGCACCTCAATAAAAA  630

seq1  CTGCATCAGGGAGATATAATTAGAGTTGAGGGTAATCCAGGGAAAACCAA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCATCAGGGAGATATAATTAGAGTTGAGGGTAATCCAGGGAAAACCAA  680

seq1  GAAGGGCAAGTTGAGCACCATCCCCCAGGAGATCACACTTCTGTCCCTCT  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGCAAGTTGAGCACCATCCCCCAGGAGATCACACTTCTGTCCCTCT  730

seq1  GCTTGCACATGTGCCTCAGCTTCATTTTGGCCTTCAAAGACAAGGAAATA  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGCACATGTGCCTCAGCTTCATTTTGGCCTTCAAAGACAAGGAAATA  780

seq1  AGGTCTCTTCAGAGATATTTGGGCTTGATACTGAAGGAGTTTGTGAGATA  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCTCTTCAGAGATATTTGGGCTTGATACTGAAGGAGTTTGTGAGATA  830

seq1  GAAATTTGTCATCTTTTCTAAAGATCATCACAGATATAAGAAGTTTCTTA  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATTTGTCATCTTTTCTAAAGATCATCACAGATATAAGAAGTTTCTTA  880

seq1  GATGAGCTGGGATCCCTGAAATTTGGAACTCCCATGATGAACATCATCCC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAGCTGGGATCCCTGAAATTTGGAACTCCCATGATGAACATCATCCC  930

seq1  TGGGAGAGCTTCAGCCGAGCCTTTCATCACCTATCACAATGAGCAGGAAA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGAGAGCTTCAGCCGAGCCTTTCATCACCTATCACAATGAGCAGGAAA  980

seq1  ATGAACTTATGTATGAGAATTGCTCCAGAACTCTACCATAAGATGCTGGC  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAACTTATGTATGAGAATTGCTCCAGAACTCTACCATAAGATGCTGGC  1030

seq1  TGTTGGTGCCATTGACAGGGTTTATGAAATTGGGCACCAGTTCTGGAGTG  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGGTGCCATTGACAGGGTTTATGAAATTGGGCACCAGTTCTGGAGTG  1080

seq1  AAGGGATTGATTTGACTCACATTCTGAATTC  1127
      |||||||||||||||||||||||||||||||
seq2  AAGGGATTGATTTGACTCACATTCTGAATTC  1111

seq1: chrX_145964463_145965621
seq2: B6Ng01-171M09.g_68_1252

seq1  GAATTCTTGGTACGTGTAACCACATTGTTTTCCATTGTCTTTTATTGGGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGGTACGTGTAACCACATTGTTTTCCATTGTCTTTTATTGGGT  50

seq1  AAGAGACCTCTAGGTCTCGATATAATAAGATGCCTCAATCTCTAGGCTTA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGACCTCTAGGTCTCGATATAATAAGATGCCTCAATCTCTAGGCTTA  100

seq1  GGGAATTATAGATATATGCTCCCTCTTTGACGTTTTGGTCCCATGTTAAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAATTATAGATATATGCTCCCTCTTTGACGTTTTGGTCCCATGTTAAT  150

seq1  TGGAATATTTATGGTGTTAAGAATGGGACTCAAAAAAAAAAAAAAATAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATATTTATGGTGTTAAGAATGGGACTCAAAAAAAAAAAAAAATAAA  200

seq1  AAGAATGGGACTCCGGTTTCAATCTAGCTAGTGTTCGAACATTTCTTTGC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAATGGGACTCCGGTTTCAATCTAGCTAGTGTTCGAACATTTCTTTGC  250

seq1  ACTCTCAAACCTACGGCTAACATTTTTGTAATTTTCTTCCTTTTTGCTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTCAAACCTACGGCTAACATTTTTGTAATTTTCTTCCTTTTTGCTTA  300

seq1  ACTTTGAGAATCATTTTATGAGTTAGAAAAATGACATAGAGACAGGGCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTTGAGAATCATTTTATGAGTTAGAAAAATGACATAGAGACAGGGCAG  350

seq1  ATGAGTTGCAAAAATCAGCAGCTGCAGGGAGGAGGGAGATGGAGAAGCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGTTGCAAAAATCAGCAGCTGCAGGGAGGAGGGAGATGGAGAAGCAA  400

seq1  AAGAGAGGAAGTCCTCCTGTCTTTTAACATAGGGTCCAAGAAAGCAAACA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGAGGAAGTCCTCCTGTCTTTTAACATAGGGTCCAAGAAAGCAAACA  450

seq1  TACTTATCAGCTGTGTGGGAATTATGCAGAGAAAGAATAAGAATGGCCAG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTATCAGCTGTGTGGGAATTATGCAGAGAAAGAATAAGAATGGCCAG  500

seq1  ACTGTCAGAACAGGCTTAGGAGTTTAACCACTATTTACAAAGTAATATAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTCAGAACAGGCTTAGGAGTTTAACCACTATTTACAAAGTAATATAA  550

seq1  TGAGGAAAGGAAATGTTAACTCTTTTGACATTAGGACACAGAAAAGTAGG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGAAAGGAAATGTTAACTCTTTTGACATTAGGACACAGAAAAGTAGG  600

seq1  TAGGTATAGTCATACATATCAGCAAGCAACTGCTTTGTTTCTTTGGTTTT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGTATAGTCATACATATCAGCAAGCAACTGCTTTGTTTCTTTGGTTTT  650

seq1  GTTTGGTATGATTGTTTCTTTGTTTGTTTTTTGTTTTGTTTTGTTTTTAG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTGGTATGATTGTTTCTTTGTTTGTTTTTTGTTTTGTTTTGTTTTTAG  700

seq1  AGGGTCTCATACCCAAGAATAGCCTCAAACACTGTTTCTAAGGATATTCA  750
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  AGGGTCTCATACCCAAGAATAGCCTC-AACACTGTTTCTAAGGATATTCA  749

seq1  TGAGCTCCTGATCAATCTGCCTCTATCTACTAAGAACTAAGATTATAGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCTCCTGATCAATCTGCCTCTATCTACTAAGAACTAAGATTATAGGC  799

seq1  ACAGCTTTGAGGAATTTTACTAAGTGACAATTTTTATATT-ATATAGTTA  849
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  ACAGCTTTGAGGAATTTTACTAAGTGACAATTTTTATATTAATATAGTTA  849

seq1  GACTACTCAGTTGTGT-GGCTTTTAGTAGATTATG-AGATGT-GCAGTC-  895
      |||||||||||||||| |||||||||||||||||| |||||| |||||| 
seq2  GACTACTCAGTTGTGTGGGCTTTTAGTAGATTATGAAGATGTGGCAGTCT  899

seq1  TTCATCCTG-ATGTAATTTTT-GAACA-TTTTCACTGTT-GGCCTCCAAA  941
      ||||||||| ||||||||||| ||||| ||||||||||| ||||||||||
seq2  TTCATCCTGAATGTAATTTTTGGAACATTTTTCACTGTTGGGCCTCCAAA  949

seq1  TTG-CCATGCTCC-TTTTGAG--ACAC-TCCTCACGCA-GACCTTTCTT-  984
      ||| ||||||||| |||||||  |||| |||||||||| |||||||||| 
seq2  TTGCCCATGCTCCTTTTTGAGGAACACTTCCTCACGCAGGACCTTTCTTG  999

seq1  GCCCCATGTTCTCT----GCAT-CCTAGTCCAAGACA---CTCACAAATC  1026
      |||||||| | |||    |||| |||||||||||| |   ||||||||||
seq2  GCCCCATGGTTTCTTCTGGCATCCCTAGTCCAAGAGACACCTCACAAATC  1049

seq1  CATTTTCTTCCTATGG-ACG--TTTTGATTACTTTTGTTCCAAAATATAC  1073
      || |||  |||||||| |||  ||| ||| ||||||| | | ||||||||
seq2  CAATTTTCTCCTATGGAACGGTTTTGGATAACTTTTGGTTCCAAATATAC  1099

seq1  --TACACTTAAAAAGGAG-TAGAA-CTGG-ATTCCTATCTAACAGGTGAA  1118
         ||||||||||||||| | ||| |||| ||| |||||||||||||   
seq2  CTAACACTTAAAAAGGAGATTGAACCTGGAATTTCTATCTAACAGGT---  1146

seq1  AACTCACCTAAAGATGTAAAGTAAATTGATAATAATACCTA  1159
      ||||  ||| |||| || | |||  | ||||||||||||||
seq2  AACTTCCCT-AAGACGT-AGGTACCTGGATAATAATACCTA  1185

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information