MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-177G19
Chromosome	X (Build37)
Map Location	75,962,516 - 76,154,338
singlet/doublet	doublet
Overlap gene	4921509A18Rik, LOC667700, EG546337
Upstream gene	LOC667606, Prkx, Pbsn, OTTMUSG00000017866, LOC100042001, 5430402E10Rik, LOC628976, Obp1a, EG546335, EG628991, LOC236874, EG667658, 4930480E11Rik, EG667672, Prrg1, LOC667679, LOC667684
Downstream gene	EG629116, LOC636082, EG667736, LOC100041373, EG636104, 2410003J06Rik, LOC667749, LOC211702, LOC667755
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC667606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Prkx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19108 MGI:1309999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54192 MGI:1860484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000017866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628923 MGI:3709306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	LOC100042001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein pseudo : _no_value

name	5430402E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71351 MGI:1918601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC628976 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Obp1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18249 MGI:1277949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546335 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546335 MGI:3648846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins

name	EG628991 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628991 MGI:3647231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	LOC236874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins

name	EG667658 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667658 MGI:3644124
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930480E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74910 MGI:1922160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein

name	EG667672 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667672 MGI:3644783
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Prrg1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 3 Proteins

name	LOC667679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 21 Proteins pseudo : _no_value

name	LOC667684 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667684
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	4921509A18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70864 MGI:1918114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 2 Proteins

name	LOC667700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG546337 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546337 MGI:3648845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 6 Proteins

name	EG629116 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:629116 MGI:3644407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 619 ESTs, 7 Proteins

name	LOC636082 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:636082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	EG667736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041373 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	EG636104 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	2410003J06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 44 ESTs, 18 Proteins

name	LOC667749 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667749
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC211702 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:211702
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC667755 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667755
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Prkx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956079 GeneID:19108 MGI:1309999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, X-linked transcript_id : NM_016979.1

name	Pbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369561 GeneID:54192 MGI:1860484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : probasin transcript_id : NM_017471.2

name	OTTMUSG00000017866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407583 GeneID:628923 MGI:3709306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : predicted gene, OTTMUSG00000017866 transcript_id : XM_486715.3

name	5430402E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352770 GeneID:71351 MGI:1918601
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430402E10 gene transcript_id : NM_027768.2

name	LOC628976 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271713 GeneID:628976
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to odorant binding protein Ia transcript_id : XM_001476077.1

name	Obp1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142347493 GeneID:18249 MGI:1277949
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : odorant binding protein Ia transcript_id : NM_008754.2

name	EG546335 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407588 GeneID:546335 MGI:3648846
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 26 ESTs, 2 Proteins product : predicted gene, EG546335 transcript_id : XM_621044.3

name	EG628991 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407589 GeneID:628991 MGI:3647231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : predicted gene, EG628991 transcript_id : XM_893814.2

name	LOC236874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271715 GeneID:236874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 2 Proteins product : similar to odorant binding protein Ia transcript_id : XM_135951.6

name	4930480E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407594 GeneID:74910 MGI:1922160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 Protein product : RIKEN cDNA 4930480E11 gene transcript_id : XM_135942.5

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271775 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 23 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 6 transcript_id : XM_900528.3

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271774 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 18 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 1 transcript_id : XM_621045.4

name	Prrg1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271773 GeneID:546336 MGI:1917364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 2 Proteins product : proline rich Gla (G-carboxyglutamic acid) 1, transcript variant 5 transcript_id : XM_900525.3

name	4921509A18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407597 GeneID:70864 MGI:1918114
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 2 Proteins product : RIKEN cDNA 4921509A18 gene transcript_id : XM_135940.5

name	EG546337 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271779 GeneID:546337 MGI:3648845
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 44 ESTs, 3 Proteins product : predicted gene, EG546337, transcript variant 1 transcript_id : XM_621046.4

name	EG629116 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271780 GeneID:629116 MGI:3644407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 619 ESTs, 7 Proteins product : predicted gene, EG629116 transcript_id : XM_893941.3

name	LOC636082 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271717 GeneID:636082
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : hypothetical LOC636082 transcript_id : XM_001476250.1

name	EG667736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271782 GeneID:667736 MGI:3643055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG667736 transcript_id : XM_992119.2

name	LOC100041373 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271719 GeneID:100041373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100041373 transcript_id : XM_001476267.1

name	EG636104 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271721 GeneID:636104 MGI:3645063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG636104 transcript_id : XM_001476286.1

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271784 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 31 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 1 transcript_id : XM_135953.7

name	2410003J06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407568 GeneID:71967 MGI:1919217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 42 ESTs, 18 Proteins product : RIKEN cDNA 2410003J06 gene, transcript variant 2 transcript_id : XM_893039.2

name	Prkx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956080 CCDS:CCDS30248.1 GeneID:19108 MGI:1309999
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : putative serine/threonine kinase product : protein kinase, X-linked protein_id : NP_058675.1

name	Pbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567372 CCDS:CCDS30249.1 GeneID:54192 MGI:1860484
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : probasin protein_id : NP_059499.1

name	OTTMUSG00000017866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772133 GeneID:628923 MGI:3709306
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486715.1

name	5430402E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001098 GeneID:71351 MGI:1918601
definition	GO_function : GO:0005549 - odorant binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to odorant binding protein I f Obp1f product : hypothetical protein LOC71351 protein_id : NP_082044.1

name	LOC628976 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271714 GeneID:628976
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476127.1

name	Obp1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27151739 CCDS:CCDS30251.1 GeneID:18249 MGI:1277949
definition	GO_function : GO:0005549 - odorant binding [Evidence IDA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : odorant-binding protein Ia product : odorant binding protein Ia protein_id : NP_032780.2

name	EG546335 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746579 GeneID:546335 MGI:3648846
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621044.1

name	EG628991 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407590 GeneID:628991 MGI:3647231
definition	codon_start : 1 product : similar to odorant binding protein Ib protein_id : XP_898907.2

name	LOC236874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407592 GeneID:236874
definition	codon_start : 1 product : hypothetical protein protein_id : XP_135951.5

name	4930480E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984424 GeneID:74910 MGI:1922160
definition	codon_start : 1 product : hypothetical protein LOC74910 protein_id : XP_135942.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746591 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 1 protein_id : XP_621045.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001561 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 5 protein_id : XP_905618.1

name	Prrg1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001563 GeneID:546336 MGI:1917364
definition	codon_start : 1 product : proline rich Gla (G-carboxyglutamic acid) 1 isoform 6 protein_id : XP_905621.1

name	4921509A18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984438 GeneID:70864 MGI:1918114
definition	codon_start : 1 product : hypothetical protein LOC70864 protein_id : XP_135940.1

name	EG546337 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001566 GeneID:546337 MGI:3648845
definition	codon_start : 1 product : similar to conserved nuclear protein Nhn1 isoform 1 protein_id : XP_621046.2

name	EG629116 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271781 GeneID:629116 MGI:3644407
definition	codon_start : 1 product : hypothetical protein protein_id : XP_899034.2

name	LOC636082 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271718 GeneID:636082
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476300.1

name	EG667736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271783 GeneID:667736 MGI:3643055
definition	codon_start : 1 product : hypothetical protein protein_id : XP_997213.2

name	LOC100041373 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271720 GeneID:100041373
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476317.1

name	EG636104 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271722 GeneID:636104 MGI:3645063
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476336.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984446 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 1 protein_id : XP_135953.1

name	2410003J06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001575 GeneID:71967 MGI:1919217
definition	codon_start : 1 product : hypothetical protein LOC71967 isoform 2 protein_id : XP_898132.1

name	EG667658 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667658
definition	number : 1 pseudo : _no_value

name	EG667672 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667672
definition	number : 1 pseudo : _no_value

name	LOC667684 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667684
definition	number : 2 pseudo : _no_value

name	LOC667684 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667684
definition	number : 1 pseudo : _no_value

name	LOC667700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667700
definition	number : 1 pseudo : _no_value

name	LOC667749 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667749
definition	number : 1 pseudo : _no_value

name	LOC211702 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:211702
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 1 pseudo : _no_value

name	LOC667755 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667755
definition	number : 2 pseudo : _no_value

name	LOC667606 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271711 GeneID:667606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to ATP synthase gamma-subunit pseudo : _no_value transcript_id : XR_032530.1

name	LOC100042001 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271770 GeneID:100042001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : hypothetical protein LOC100042001 pseudo : _no_value transcript_id : XR_033262.1

name	LOC667679 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271776 GeneID:667679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 21 Proteins product : similar to H3 histone, family 3A pseudo : _no_value transcript_id : XR_033334.1

clone name	MSMg01-372H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-367F24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418C23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-331I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-060F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396I23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415L08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-475K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-420P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360I05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-059M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-304P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-292K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-293A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-480H11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141F14
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-327O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237O06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-107N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-061E24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180N21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145H01
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-177G19.b	B6Ng01-177G19.g
ACC	GA004697	GA004698
length	1,032	1,124
definition	B6Ng01-177G19.b	B6Ng01-177G19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(75,962,516 - 75,963,554)	(76,153,199 - 76,154,338)
sequence	gaattcccttacttcctcctctggtgtgggggcctcttgtctgtctccat gaatgcttcctcttcttcctctccctatgtcctagttcttattctgcagt tcttcctatatgagcctgaagacatggcattttttgctctaaaatcacac caagagagatctttgttcctttgctggtggggatcaaacttatcttctcc atggggtctgcaggggcctctgaattggccctcatacagacccattacct ggctgcagacttcagggacaaactcaaccaagacatggtactaagaatgg aaagcctagagacactccagcaccagacaaacttactagctggaatggtg ttgaaaaataggaaaaccctaggtctgataattggttaatgtgacggact tgtattgtggtaggggaatgttgcttttatgttaatgaataaaatattgt tgaatcaaatgaaactttcaatacacaaaattgcttacttggtagcaaca atctgagccaatgtcctggttccaaaaccattacctggttccaaaaccat tatcaaaaccttacctagatataacatgtgttgattcctatgcttgctct atgcagcatcatgatatttacccccaactattccagttagtacagtgaca agtttctaccatagtggtctgtactggctagttttgtgtcaacttgacat agctggagtaatcatagagaaaggagcttcagttgaggaaatgcctccat gagatccaactgtaaggcattttcttaattagtgatcaagggggaaaggc cccttgtgggtgggaccatctctgggctggtagtcttggttcaataagag agcagctgagcaagccaggggaagcaagccagtaaagaacatccctccat ggtctctgcatcagctcctgcttcctgacctgttgagttccagtcctcac ttccttggtgataaacagcagtagggaattgtaagctgataacctttctc cccacttgcttcttggtcatgatgtttgtgca	gaattcttatatctgcaaatatgtatctcatggaaataaaaaggtatctt ttcagattagataaattaaccaagtaaatggctacagtcacagttgtcat cgaacctgaaagacaaagcatttatgtcagaagtgaaatctaatatgtcc tatatacctgtgacttacgacgctagcacttctttgccatggtttttatt aaactcaagaaaatgttattttactactaagatactctgcaacattcatg ttttatagcacatgtatccaattttttattaaaaagaaagtaatattaaa aataattttatagaccaatgatctattccaatgatcctgacatttagtgt actgacagaaccaccttgggaatcttgttaaacagaatctaatttcaaat gtctggggtcttagattctacattcctaacaagttcccaggagataccaa tgaggttgatactcagacgacacataattggcatagaaagagtccaacca gcctctgtgactcaggagttggataaaaattgtgaattctctgagctgga aaattgaaaactgaaaagcaaccaaaatgtaatcagccatgcctgcttaa ctagacaaggtgttgaagagcagacatctagatcagtgtcaggcaaaatt atagtgagagttaaaactgaaatgtggtacaggagaaaggacagaattac ttcaaagaagcctgcatgaagtcttgagatacagaaagcagaaaataaaa atgcataagaaaaccatgggacaaaagaggaaaaagtaaagaccaacaaa aatataaaatttctggtccccaattcattgggtaaatatatagtacacac atactttgttttgttatcaggacatatgtggctcttaatttttttttttt catggagagtgaacaactaaaaataagagatggttggatttttagaatta tgcacaaatgcctacagtattggtttgtatatcttatacatctactgcta ttattttgaaaattttctgtggggcatacgaatatagaagaaaacatatg gtgagttgaaatactgatatagattcactataaaacattaatattgtaag tgttctagagcctaaaaatgtcta
quality values	Open. Hide. 62 41 24 29 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 56 56 54 34 43 59 48 34 33 54 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 54 62 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 47 43 62 62 62 62 43 54 62 62 62 62 62 62 62 62 62 54 48 41 43 58 52 52 47 43 54 54 54 58 58 54 54 58 58 58 58 58 58 54 54 52 52 54 54 54 58 54 54 54 58 58 58 58 58 58 58 58 58 58 58 53 54 58 54 58 40 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 52 52 58 54 58 58 54 58 58 51 51 54 58 58 45 48 58 58 58 58 51 35 58 49 45 52 51 49 49 47 48 53 58 48 40 58 49 51 50 50 58 49 58 51 50 38 58 53 58 58 54 58 42 50 42 43 50 53 53 53 42 58 58 53 53 51 58 49 50 47 51 58 54 49 47 53 39 58 58 58 50 58 53 58 50 50 32 49 53 58 52 51 51 52 37 52 53 35 54 53 51 58 58 29 52 41 41 52 42 53 49 49 41 51 50 49 58 40 49 54 51 19 42 32 18 33 41 35 51 51 35 35 20 51 47 54 30 35 52 49 39 46 40 49 26 53 39 44 31 38 33 33 39 33 34 42 45 52 37 34 39 37 54 31 30 30 54 54 52 53 41 53 21 36 32 33 25 37 52 53 38 42 42 25 27 41 54 54 54 40 35 52 47 18 29 11 47 52 52 33 35 45 29 33 52 32 31 40 46 31 22 10 27 30 45 27 47 32 45 53 51 40 30 33 24 33 26 30 35 35 31 33 31 30 46 31 11 20 31 30 34 33 33 24 46 15 31 17 31 6 7 11 35 36 42 9 30 21 19 13 14 28 26 26 46 46 24 9 23 23 31 28 35 30 20 22 31 31 31 29 46 31 17 32 21 30 32 30 20 48 31 29 25 26 25 32 25 27 23 32 31 31 27 36 34 31 31 31 32 21 29 42 25 33 26 31 31 33 30 18 22 19 22 32 18 21 13 21 26 20 14 31 21 35 33 14 28 33 25 32 29 25 31 31 24 25 29 19 26 18 19 24 18 29 11 23 32 19 11 39 31 18 24 24 27 34 22 32 22 25 43 17 22 22 12 17 32 22 29 17 22 32 29 14 43 9 30 30 23 23 7 47 20 30 16 7 21 24 11 3 8 10 16 9 19 16 16 17 12 14 16 21 18 11 7 9 10 11 6 14 10 38 21 18 5 7 8 6	Open. Hide. 62 47 56 44 62 62 49 62 62 62 62 28 49 34 46 51 34 28 28 45 56 59 54 62 59 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 54 49 62 62 62 59 59 59 62 62 62 54 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 54 42 62 59 62 62 54 62 59 62 48 62 51 56 48 59 62 62 62 59 62 62 59 62 62 62 62 62 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 54 58 58 58 52 58 58 58 41 52 58 58 58 58 58 58 58 58 54 46 58 58 52 38 58 58 49 54 58 58 58 58 42 58 58 58 58 43 49 58 58 41 58 58 54 51 58 58 58 58 58 58 58 52 58 51 58 58 54 58 58 58 33 58 58 58 58 58 58 58 58 58 54 58 58 58 48 49 50 51 53 58 37 51 50 58 50 58 46 52 50 51 58 50 48 47 46 46 51 58 50 54 53 58 58 58 46 39 44 49 49 49 51 41 50 42 58 51 58 50 51 32 51 50 58 58 52 58 34 41 51 32 51 31 39 53 58 39 41 40 41 39 49 35 44 27 58 32 52 40 38 54 39 52 54 54 45 39 54 53 39 51 49 52 54 52 52 49 37 39 52 34 54 54 44 40 45 53 49 54 47 35 51 29 54 51 31 40 43 37 40 51 51 28 54 54 40 37 51 33 26 39 37 49 37 32 54 42 33 21 53 45 35 54 49 37 53 54 30 31 39 32 53 28 27 34 40 53 45 32 28 53 29 36 42 53 33 39 26 31 32 31 32 51 51 51 32 35 35 19 51 53 53 32 31 46 51 51 46 30 31 37 25 29 43 31 31 15 46 51 51 41 31 42 29 35 37 51 46 24 34 23 46 46 30 31 41 13 45 31 51 47 46 29 22 32 36 46 32 32 31 24 31 12 29 32 18 46 48 48 42 32 32 42 24 48 46 26 22 48 31 42 33 37 43 31 31 47 46 35 17 27 30 35 25 22 22 21 31 41 20 17 37 48 30 32 32 31 32 32 26 31 24 32 33 20 22 25 38 31 35 33 37 38 48 30 32 32 48 48 33 30 21 14 29 27 34 13 25 18 32 23 16 31 27 30 29 17 26 31 27 34 34 26 30 21 15 25 47 47 47 48 48 48 48 48 47 44 30 24 13 21 26 16 22 18 27 27 17 29 21 22 18 9 26 31 21 32 39 48 48 33 31 23 11 6 31 12 27 14 20 30 12 17 16 18 19 21 39 48 39 9 9 4 15 30 5 6 9 11 12 12 10 21 10 24 25 8 29 13 25 23 6 5 4 8 5 3 5 20 14 9 4 6 9 16 9 10 11 12 16 19 10 9 14 11 6 9 16 20 26 11 14 28 12 28 20 13 6 4 5 16 13 33 38 25 17 21 47 27 9 11 40 40 10 28 13 14 6 21 38 32 26 14 12 8 3 5 5 4 3 7 10 24 9 9 9 16 11 16 29 30 10 15 4 5 1 2 2 7 23 9 24 7 11 10 11 9 25 11 12 17 21 10 15 6 11 6 12 6 18 12 14 24 24 7 3 2 7 4 9 26 24 7 9 4 9 3 5 4 5 2 6 22 5 4 5 24 5 5 13 15 10 16 13 13 5 13 5 5 7 13 17 17 29 13 17 6 21 5 6 6 18

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_75962516_75963554
seq2: B6Ng01-177G19.b_46_1077

seq1  GAATTCCCTTACTTCCTCCTCTGGTGTGGGGGCCTCTTGTCTGTCTCCAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCCTTACTTCCTCCTCTGGTGTGGGGGCCTCTTGTCTGTCTCCAT  50

seq1  GAATGCTTCCTCTTCTTCCTCTCCCTATGTCCTAGTTCTTATTCTGCAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATGCTTCCTCTTCTTCCTCTCCCTATGTCCTAGTTCTTATTCTGCAGT  100

seq1  TCTTCCTATATGAGCCTGAAGACATGGCATTTTTTGCTCTAAAATCACAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCCTATATGAGCCTGAAGACATGGCATTTTTTGCTCTAAAATCACAC  150

seq1  CAAGAGAGATCTTTGTTCCTTTGCTGGTGGGGATCAAACTTATCTTCTCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGAGAGATCTTTGTTCCTTTGCTGGTGGGGATCAAACTTATCTTCTCC  200

seq1  ATGGGGTCTGCAGGGGCCTCTGAATTGGCCCTCATACAGACCCATTACCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGGTCTGCAGGGGCCTCTGAATTGGCCCTCATACAGACCCATTACCT  250

seq1  GGCTGCAGACTTCAGGGACAAACTCAACCAAGACATGGTACTAAGAATGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCAGACTTCAGGGACAAACTCAACCAAGACATGGTACTAAGAATGG  300

seq1  AAAGCCTAGAGACACTCCAGCACCAGACAAACTTACTAGCTGGAATGGTG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCTAGAGACACTCCAGCACCAGACAAACTTACTAGCTGGAATGGTG  350

seq1  TTGAAAAATAGGAAAACCCTAGGTCTGATAATTGGTTAATGTGACGGACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAAAAATAGGAAAACCCTAGGTCTGATAATTGGTTAATGTGACGGACT  400

seq1  TGTATTGTGGTAGGGGAATGTTGCTTTTATGTTAATGAATAAAATATTGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTGTGGTAGGGGAATGTTGCTTTTATGTTAATGAATAAAATATTGT  450

seq1  TGAATCAAATGAAACTTTCAATACACAAAATTGCTTACTTGGTAGCAACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAATCAAATGAAACTTTCAATACACAAAATTGCTTACTTGGTAGCAACA  500

seq1  ATCTGAGCCAATGTCCTGGTTCCAAAACCATTACCTGGTTCCAAAACCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGAGCCAATGTCCTGGTTCCAAAACCATTACCTGGTTCCAAAACCAT  550

seq1  TATCAAAACCTTACCTAGATATAACATGTGTTGATTCCTATGCTTGCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCAAAACCTTACCTAGATATAACATGTGTTGATTCCTATGCTTGCTCT  600

seq1  ATGCAGCATCATGATATTTACCCCCAACTATTCCAGTTAGTACAGTGACA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCAGCATCATGATATTTACCCCCAACTATTCCAGTTAGTACAGTGACA  650

seq1  AGTTTCTACCATAGTGGTCTGTACTGGCTAGTTTTGTGTCAACTTGACAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTCTACCATAGTGGTCTGTACTGGCTAGTTTTGTGTCAACTTGACAT  700

seq1  AGCTGGAGTAATCATAGAGAAAGGAGCTTCAGTTGAGGAAATGCCTCCAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTGGAGTAATCATAGAGAAAGGAGCTTCAGTTGAGGAAATGCCTCCAT  750

seq1  GAGATCCAACTGTAAGGCATTTTCTTAATTAGTGATCAAGGGGGAAAGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATCCAACTGTAAGGCATTTTCTTAATTAGTGATCAAGGGGGAAAGGC  800

seq1  CCCTTGTGGGTGGGACCATCTCTGGGCTGGTAGTCTTGGTTCAATAAGAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTGTGGGTGGGACCATCTCTGGGCTGGTAGTCTTGGTTCAATAAGAG  850

seq1  AGCAGGCTGAGCAAGCCAGGGGAAGCAAGCCAGTAAAGAACATCCCTCCA  900
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCA-GCTGAGCAAGCCAGGGGAAGCAAGCCAGTAAAGAACATCCCTCCA  899

seq1  TGGTCTCTGCATCAGCTCCTGCTTCCTGACCTGTTTGAGTTCCAGTCCTC  950
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  TGGTCTCTGCATCAGCTCCTGCTTCCTGACCTG-TTGAGTTCCAGTCCTC  948

seq1  ACTTCCTTGGTGATAAACAGCAGTAGGGAATTGTAAGCTGAATAAACCCT  1000
      |||||||||||||||||||||||||||||||||||||||| ||||  |||
seq2  ACTTCCTTGGTGATAAACAGCAGTAGGGAATTGTAAGCTG-ATAA--CCT  995

seq1  TTCCTCCCCAACTTGCTTCTTGGTCATGATGTTTGTGCA  1039
      || |||||| |||||||||||||||||||||||||||||
seq2  TT-CTCCCC-ACTTGCTTCTTGGTCATGATGTTTGTGCA  1032

seq1: chrX_76153199_76154338
seq2: B6Ng01-177G19.g_64_1187 (reverse)

seq1  TAGACATTTTTTTAGCTCTAGAACACTTAACAAATAAATAAATGTTTTAT  50
      |||||| |||||  |||||||||||||| |||   | || ||||||||||
seq2  TAGACA-TTTTTAGGCTCTAGAACACTT-ACA---ATATTAATGTTTTAT  45

seq1  AGGTTGGAAATCCTATAATCCAGTATTTCAACTTCAACAATATGTTTTC-  99
      ||  ||  ||| |||||   |||||||||||||   || |||||||||| 
seq2  AG--TG--AAT-CTATA--TCAGTATTTCAACT--CACCATATGTTTTCT  86

seq1  TCTATATTTCTGTATGCCCCACAGAAAATTTTCAAAAT-ATAGCAGTAGA  148
      ||||||||   ||||||||||||||||||||||||||| |||||||||||
seq2  TCTATATT--CGTATGCCCCACAGAAAATTTTCAAAATAATAGCAGTAGA  134

seq1  TGTAT-AGATATACAAACCAATAACTTGTAGGCATTTGTGCATATTTCTT  197
      ||||| |||||||||||||||||   |||||||||||||||||| ||| |
seq2  TGTATAAGATATACAAACCAATA--CTGTAGGCATTTGTGCATAATTC-T  181

seq1  AAAAATCCAACCATCTCTTATTTTTAGTTGTTCACTCTCCATGAAAAAAA  247
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATCCAACCATCTCTTATTTTTAGTTGTTCACTCTCCATGAAAAAAA  231

seq1  AAAAATTAAGAGCCACATATGTCCTGATAACAAAACAAAGTATGTGTGTA  297
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATTAAGAGCCACATATGTCCTGATAACAAAACAAAGTATGTGTGTA  281

seq1  CTATATATTTACCCAATGAATTGGGGACCAGAAATTTTATATTTTTGTTG  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATATATTTACCCAATGAATTGGGGACCAGAAATTTTATATTTTTGTTG  331

seq1  GTCTTTACTTTTTCCTCTTTTGTCCCATGGTTTTCTTATGCATTTTTATT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTTACTTTTTCCTCTTTTGTCCCATGGTTTTCTTATGCATTTTTATT  381

seq1  TTCTGCTTTCTGTATCTCAAGACTTCATGCAGGCTTCTTTGAAGTAATTC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTGCTTTCTGTATCTCAAGACTTCATGCAGGCTTCTTTGAAGTAATTC  431

seq1  TGTCCTTTCTCCTGTACCACATTTCAGTTTTAACTCTCACTATAATTTTG  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCCTTTCTCCTGTACCACATTTCAGTTTTAACTCTCACTATAATTTTG  481

seq1  CCTGACACTGATCTAGATGTCTGCTCTTCAACACCTTGTCTAGTTAAGCA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTGACACTGATCTAGATGTCTGCTCTTCAACACCTTGTCTAGTTAAGCA  531

seq1  GGCATGGCTGATTACATTTTGGTTGCTTTTCAGTTTTCAATTTTCCAGCT  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGGCTGATTACATTTTGGTTGCTTTTCAGTTTTCAATTTTCCAGCT  581

seq1  CAGAGAATTCACAATTTTTATCCAACTCCTGAGTCACAGAGGCTGGTTGG  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGAATTCACAATTTTTATCCAACTCCTGAGTCACAGAGGCTGGTTGG  631

seq1  ACTCTTTCTATGCCAATTATGTGTCGTCTGAGTATCAACCTCATTGGTAT  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTTTCTATGCCAATTATGTGTCGTCTGAGTATCAACCTCATTGGTAT  681

seq1  CTCCTGGGAACTTGTTAGGAATGTAGAATCTAAGACCCCAGACATTTGAA  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGGGAACTTGTTAGGAATGTAGAATCTAAGACCCCAGACATTTGAA  731

seq1  ATTAGATTCTGTTTAACAAGATTCCCAAGGTGGTTCTGTCAGTACACTAA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGATTCTGTTTAACAAGATTCCCAAGGTGGTTCTGTCAGTACACTAA  781

seq1  ATGTCAGGATCATTGGAATAGATCATTGGTCTATAAAATTATTTTTAATA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTCAGGATCATTGGAATAGATCATTGGTCTATAAAATTATTTTTAATA  831

seq1  TTACTTTCTTTTTAATAAAAAATTGGATACATGTGCTATAAAACATGAAT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACTTTCTTTTTAATAAAAAATTGGATACATGTGCTATAAAACATGAAT  881

seq1  GTTGCAGAGTATCTTAGTAGTAAAATAACATTTTCTTGAGTTTAATAAAA  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGCAGAGTATCTTAGTAGTAAAATAACATTTTCTTGAGTTTAATAAAA  931

seq1  ACCATGGCAAAGAAGTGCTAGCGTCGTAAGTCACAGGTATATAGGACATA  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATGGCAAAGAAGTGCTAGCGTCGTAAGTCACAGGTATATAGGACATA  981

seq1  TTAGATTTCACTTCTGACATAAATGCTTTGTCTTTCAGGTTCGATGACAA  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGATTTCACTTCTGACATAAATGCTTTGTCTTTCAGGTTCGATGACAA  1031

seq1  CTGTGACTGTAGCCATTTACTTGGTTAATTTATCTAATCTGAAAAGATAC  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGACTGTAGCCATTTACTTGGTTAATTTATCTAATCTGAAAAGATAC  1081

seq1  CTTTTTATTTCCATGAGATACATATTTGCAGATATAAGAATTC  1140
      |||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTTATTTCCATGAGATACATATTTGCAGATATAAGAATTC  1124

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information