MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-183F03
Chromosome	X (Build37)
Map Location	161,024,987 - 161,025,979
singlet/doublet	singlet
Overlap gene	none
Upstream gene	1700045I19Rik, Ap1s2, Zrsr2, Car5b, Siah1b, Tmem27, Ace2, Bmx, Pir, Figf, Piga, Asb11, Asb9
Downstream gene	Mospd2, Fancb, LOC627045, Glra2
Link	Open Mouse BAC browser

Click to get alignment info.

name	1700045I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74264 MGI:1921514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Ap1s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108012 MGI:1889383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zrsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Car5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56078 MGI:1926249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Siah1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20438 MGI:108063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57394 MGI:1926234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ace2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70008 MGI:1917258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12169 MGI:1101778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pir (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69656 MGI:1916906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Figf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14205 MGI:108037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Piga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18700 MGI:99461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68854 MGI:1916104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69299 MGI:1916549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mospd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76763 MGI:1924013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fancb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237211 MGI:2448558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627045 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Glra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237213 MGI:95748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ap1s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254483 GeneID:108012 MGI:1889383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 1, sigma 2 subunit transcript_id : NM_026887.2

name	Zrsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949799 GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 transcript_id : NM_009453.2

name	Zrsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949774 GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 transcript_id : NM_178794.3

name	Car5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506462 GeneID:56078 MGI:1926249
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5b, mitochondrial transcript_id : NM_019513.1

name	Car5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227235 GeneID:56078 MGI:1926249
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5b, mitochondrial transcript_id : NM_181315.3

name	Siah1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677948 GeneID:20438 MGI:108063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seven in absentia 1B transcript_id : NM_009173.1

name	Tmem27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892354 GeneID:57394 MGI:1926234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 27 transcript_id : NM_020626.2

name	Ace2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389001 GeneID:70008 MGI:1917258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 transcript_id : NM_027286.3

name	Bmx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802105 GeneID:12169 MGI:1101778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BMX non-receptor tyrosine kinase transcript_id : NM_009759.3

name	Pir (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130337 GeneID:69656 MGI:1916906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pirin transcript_id : NM_027153.2

name	Figf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753873 GeneID:14205 MGI:108037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-fos induced growth factor transcript_id : NM_010216.1

name	Piga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273665 GeneID:18700 MGI:99461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class A transcript_id : NM_011081.2

name	Asb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17105325 GeneID:68854 MGI:1916104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 11 transcript_id : NM_026853.1

name	Asb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373912 GeneID:69299 MGI:1916549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 9 transcript_id : NM_027027.2

name	Mospd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356338 GeneID:76763 MGI:1924013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : motile sperm domain containing 2 transcript_id : NM_029730.2

name	Fancb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020736 GeneID:237211 MGI:2448558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group B transcript_id : NM_175027.3

name	Glra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373644 GeneID:237213 MGI:95748
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine receptor, alpha 2 subunit transcript_id : NM_183427.3

name	Ap1s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254484 CCDS:CCDS30514.1 GeneID:108012 MGI:1889383
definition	GO_component : GO:0030121 - AP-1 adaptor complex [Evidence ISS]; GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence ISS] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA] [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : adaptor-related protein complex 1 sigma 2 subunit protein_id : NP_081163.2

name	Zrsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949800 GeneID:22184 MGI:103287
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 isoform 1 protein_id : NP_033479.2

name	Zrsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949775 GeneID:22184 MGI:103287
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 isoform 2 protein_id : NP_848909.2

name	Car5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506463 CCDS:CCDS30515.1 GeneID:56078 MGI:1926249
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carbonic anhydrase VB product : carbonic anhydrase 5b, mitochondrial protein_id : NP_062386.1

name	Car5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044449 CCDS:CCDS30515.1 GeneID:56078 MGI:1926249
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carbonic anhydrase VB product : carbonic anhydrase 5b, mitochondrial protein_id : NP_851832.1

name	Siah1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677949 CCDS:CCDS30516.1 GeneID:20438 MGI:108063
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : seven in absentia 1B protein_id : NP_033199.1

name	Tmem27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181182 CCDS:CCDS30517.1 GeneID:57394 MGI:1926234
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : kidney-specific membrane protein product : transmembrane protein 27 protein_id : NP_065651.1

name	Ace2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582782 CCDS:CCDS30518.1 GeneID:70008 MGI:1917258
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence TAS]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 protein_id : NP_081562.2

name	Bmx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753196 CCDS:CCDS30519.1 GeneID:12169 MGI:1101778
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : TYRO8 protein tyrosine kinase 8 product : BMX non-receptor tyrosine kinase protein_id : NP_033889.1

name	Pir (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317401 CCDS:CCDS30520.1 GeneID:69656 MGI:1916906
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : iron-binding nuclear protein product : pirin protein_id : NP_081429.1

name	Figf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753874 CCDS:CCDS30521.1 GeneID:14205 MGI:108037
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005172 - vascular endothelial growth factor receptor binding [Evidence TAS] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : c-fos induced growth factor protein_id : NP_034346.1

name	Piga (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126273666 CCDS:CCDS30522.1 GeneID:18700 MGI:99461
definition	EC_number : 2.4.1.198 GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0000506 - glycosylphosphatidylinositol-N- acetylglucosaminyltransferase (GPI-GnT) complex [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS] [Evidence IEA]; GO:0009893 - positive regulation of metabolism [Evidence ISS] codon_start : 1 note : phosphatidylinositolglycan class A product : phosphatidylinositol glycan, class A protein_id : NP_035211.2

name	Asb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17105326 CCDS:CCDS30523.1 GeneID:68854 MGI:1916104
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 11 protein_id : NP_081129.1

name	Asb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311897 CCDS:CCDS30524.1 GeneID:69299 MGI:1916549
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 9 protein_id : NP_081303.1

name	Mospd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626072 GeneID:76763 MGI:1924013
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : motile sperm domain containing 2 protein_id : NP_084006.1

name	Fancb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020737 GeneID:237211 MGI:2448558
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : Fanconi anemia, complementation group B protein_id : NP_778192.2

name	Glra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34556195 GeneID:237213 MGI:95748
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0004890 - GABA-A receptor activity [Evidence IEA]; GO:0016934 - glycine-gated chloride channel activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : glycine receptor, alpha 2 subunit protein_id : NP_906272.1

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 1 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 2 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 3 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 4 pseudo : _no_value

name	1700045I19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272401 GeneID:74264 MGI:1921514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700045I19 gene pseudo : _no_value transcript_id : XR_035172.1

clone name	MSMg01-275I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368J12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-435K21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290G01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476L21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201O06
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-183F03.b	B6Ng01-183F03.g
ACC	GA008976	GA008977
length	1,133	999
definition	B6Ng01-183F03.b	B6Ng01-183F03.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcacattcctctacattataagtgccatttgtgccagcactatttg ttgaaaatgctgtctttttttccactggatggttttagctcccttgtcaa aaatcaattgaccataggtttgtgggttcattcctgggtcttcaattata ttccattggtctacttgtctgctggtgtaccagtaccatgcagtttttaa tcacaattgcattgaagtacagctttaggtcaggcatggtgattccacca gagtttttttattttatcattgagacgaaattttgctatcctatgttttt tgttattccagatgaattttcagttgccctttctaattggttgaagaata gagttggaattttgaggggggttccttgaatttgtagattgcttttggca agatagccctttttactatattggtcctttcaatccatgagcatgggaca tcttttcatcttctgagatcatctttaatttctttcttcagagtcttgaa gttcttatcatacaatctttcacttccttagttagagtcacaccaaggta ttttataatatttgtgacctttgagaaagttgttgtttcccttatttctt tctcagcctgtttatcctttgtgtagagcaaggccattgacttgtttgag ttaattttatattcagctacttcattcaagctgtttatcaagtttaggag ttctctggtggaaattttagggtcacttatatatactatcagatcatttg caaaaagtgatatttttgacttcttcctttccaatttgtatcacattgat ctccttttgttgtcgaattgctctggctacgatttcaagtacaatgttca atagatagggagaaagtggggagccttgtctagtccctgattttagtgag attgcttccagcttctcactatttacactgatcttggcctactggtttgc tgtagaattggttttatcatgttaaggtatgggccttgaattcctggtct tttccaagacttttatcacgaatgggtgttgaattttgtcaatgtttttc tcagcatcctaacgagatgattatgtagtttttggtccttgtacttgctt tatacagtggacattaccatgtaacagtgaact	gaattctttgaatgaaagccatttctaagttcatgctttcaatgtcctta gcaactgttggtgcccagtgggtttacgtggccctttctacatgtttttt aaaatataatcacatgtcacttttagccagcagccctcatcttgttaatc cacatttctcagtctctgcttttatagctaagggtaaattgaagaaaaaa aaagcaaaattctgcctgatgagtgtttcactcaatgaatagttttctta ttctgtcatgtacacaatgaaatcactttagattcagacctttcttaaca cttgaattatcttagcactctctttctaccctctgccttcctctttcatc ttttataccctttcccgttcatcaaagataaaggacctatgaaatgaaat ctttcctaaaactcaatatgtgctccctgagcctcacaatggtgttcacc cacaaagtctctctaactgggcatcatcaaaaaggaaataaacagttaaa attcgtttagttattgcataagtaataattaaatacatttaaaccaatat ttgttaatgtggagtgatctggtagacaaggtgaccttcacagtgtttgc agagatttttagttgtcattaattcgaagggtgttattgtggagcagtgt gttgggaattatttaggggattgctgagctcattgcttacacagacaaag aactgagccttcaggaaagacagaaaactaagccaaagaaagcaggaaag taacagctttatctttttctggagggaacaggctttaagtatgaaagtca gttaaatggatgatggatagggcaaattcattggctcctcccttttcccc tcttggtcctgtttagatggatgccttccatgacttccgaagatcctcct cactattgtcttctgggagcattgtaactccctcctatttcagaaagcat gtgtttgcttattttgctatctatgttcatctaacttctttttcaactg
quality values	Open. Hide. 41 31 34 26 58 28 27 49 38 62 62 62 62 62 62 54 56 47 26 62 49 62 62 62 62 62 62 49 62 47 47 62 62 62 34 30 25 29 21 15 23 28 28 24 29 29 38 54 62 62 62 62 62 59 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 59 49 42 42 48 59 56 59 59 56 42 42 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 56 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 41 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 42 42 40 52 54 58 58 58 54 52 58 58 58 54 58 58 58 54 58 54 54 42 58 52 54 51 54 46 58 52 58 52 45 54 58 37 47 58 54 58 52 58 45 58 58 42 58 54 51 53 39 58 58 52 54 49 52 54 58 58 52 52 58 58 46 58 52 58 42 52 49 52 54 23 46 49 58 58 58 40 58 41 50 52 50 53 58 52 52 58 50 51 35 54 58 32 58 58 40 53 53 47 45 34 18 58 34 47 58 48 39 58 58 54 50 34 58 58 32 41 50 53 53 49 50 47 32 53 30 49 50 51 46 50 51 52 51 32 51 40 53 42 33 58 49 50 53 28 49 51 36 58 47 52 51 49 38 39 28 58 58 58 11 32 41 35 46 53 41 21 21 36 52 42 58 43 31 39 26 51 51 58 40 53 31 39 41 37 39 32 37 42 49 41 31 42 42 39 41 45 44 54 54 38 49 18 44 40 36 41 16 54 53 42 39 52 31 53 40 43 41 32 38 23 30 42 16 53 41 54 32 34 33 16 28 33 26 30 17 54 37 54 38 12 37 14 46 40 45 26 31 31 29 18 52 32 53 33 18 32 41 26 33 53 53 46 25 34 13 32 32 39 35 37 30 32 33 32 25 21 39 53 31 31 42 22 15 51 51 38 30 26 31 29 36 28 43 25 30 31 31 33 32 31 32 23 31 30 30 37 43 17 28 31 36 34 42 35 46 37 25 29 19 31 17 29 14 26 23 14 28 27 42 18 12 32 26 31 23 43 46 31 46 6 9 23 24 26 21 31 17 36 20 31 15 33 30 23 46 39 32 31 38 16 14 27 38 17 19 11 16 21 30 7 20 20 33 36 24 19 44 21 27 29 19 10 14 33 20 11 7 26 19 25 17 16 44 44 15 24 27 31 18 6 7 13 42 42 31 18 16 10 15 24 31 13 18 17 13 31 38 24 6 7 12 9 20 37 33 32 48 48 31 32 23 12 31 25 5 19 16 39 34 39 7 18 24 31 32 9 32 22 11 8 12 19 10 17 23 11 34 16 23 18 13 23 25 12 28 25 17 10 15 15 15 11 27 22 20 6 12 10 12 15 27 19 9 6 3 3 3 7 4 5 5 6 7 8 4 4 5 10 8 10 21 13 5 8 6 4 3 8 5 4 4 6 4 3 5 4 6 5 14 10 8 12 18 4 10	Open. Hide. 62 47 42 42 62 62 62 62 62 62 47 45 15 23 18 13 18 13 18 19 19 28 28 28 27 38 46 59 59 62 62 59 59 62 62 62 62 62 62 59 51 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 43 46 56 50 46 56 46 50 50 51 43 29 54 56 56 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 56 59 49 59 59 54 59 56 62 62 59 59 59 59 59 62 59 62 59 62 62 62 56 56 46 54 54 59 46 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 56 62 59 62 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 56 62 56 59 59 48 56 56 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 59 59 59 62 59 62 59 62 62 59 59 62 62 62 62 62 56 56 56 62 62 62 62 47 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 56 62 62 62 62 54 62 62 62 56 62 62 54 62 62 47 62 62 62 56 62 62 47 62 62 62 62 47 47 62 62 62 62 62 62 62 62 54 62 62 47 54 56 62 62 62 56 62 62 62 56 62 62 62 62 47 62 56 62 62 62 62 48 62 31 47 42 45 62 62 49 46 38 41 43 42 48 62 47 62 62 52 54 47 52 62 49 38 23 62 62 58 58 50 40 54 58 58 54 54 54 31 26 28 58 54 54 58 39 45 58 33 58 54 50 58 42 54 20 20 38 54 30 58 48 58 32 54 54 49 35 45 54 58 42 58 52 54 54 58 39 25 54 39 42 58 42 46 39 50 48 40 48 24 49 58 52 58 54 49 14 51 58 53 39 51 51 58 49 54 51 41 40 39 46 34 23 47 35 16 51 46 32 50 46 28 37 46 49 20 35 48 48 40 50 47 24 58 46 52 39 31 40 25 28 23 58 51 51 40 32 52 40 40 29 35 39 45 34 32 13 15 18 17 21 35 26 6 43 32 40 46 37 42 47 25 37 28 25 35 49 42 39 34 35 39 32 54 54 54 26 37 43 53 32 32 17 51 35 28 31 32 35 16 26 17 13 51 42 29 33 37 53 42 53 32 35 51 33 32 38 28 33 9 12 37 45 34 17 11 33 38 29 25 31 45 10 31 29 31 31 34 34 47 33 9 25 52 19 20 53 34 18 25 18 24 28 22 33 30 34 45 42 51 30 43 51 51 30 31 51 51 28 20 31 31 30 46 18 9 18 30 26 42 13 25 16 19 12 29 12 36 31 34 20 12 12 48 14 9 42 17 29 32 37 19 20 29 46 22 13 11 25 17 6 31 18 25 23 11 24 31 30 34 27 25 13 27 19 9 9 17 37 14 31 24 15 21 24 22 33 19 25 14 19 9 10 9 17 17 12 6 20 28 11 6 22 5 5 22 42 48 31 9 7 9 30 42 28 23 27 16 12 10 6 10 5 32 18 14 19 23 25 15 6 33 43 21 5 6 4 5 4 5 11 10 28 23 10 34 15 15 32 16 8 6 9 9 16 10 29 10 39 37 36 32 15 5 11 18 23 26

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_161024987_161025979
seq2: B6Ng01-183F03.g_70_1068 (reverse)

seq1  CAGTTG-AAAAGGAGTTAGATGAACATAGATAGACAAATTAAGCAAACAC  49
      |||||| ||||| |||||||||||||||||||| |||| |||||||||||
seq2  CAGTTGAAAAAGAAGTTAGATGAACATAGATAG-CAAAATAAGCAAACAC  49

seq1  ATGCTTTCTGAAATGGGGGGGGGTTAC-ATGCTCCCAGAAGAC-ATAGTG  97
      |||||||||||||| || ||| ||||| ||||||||||||||| ||||||
seq2  ATGCTTTCTGAAATAGGAGGGAGTTACAATGCTCCCAGAAGACAATAGTG  99

seq1  AGGAGGATCTTCGGAAGTCATGG-AGGCATCCATCTAAACAGGACCAAGA  146
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  AGGAGGATCTTCGGAAGTCATGGAAGGCATCCATCTAAACAGGACCAAGA  149

seq1  GGGGAAAAGGGAGGAGCCAATGAA-TTGCCCTATCCATCATCCATTTAAC  195
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  GGGGAAAAGGGAGGAGCCAATGAATTTGCCCTATCCATCATCCATTTAAC  199

seq1  TGACTTTCATACTT-AAGCCTGTTCCCTCCAG-AAAAGATAAAGCTGTTA  243
      |||||||||||||| ||||||||||||||||| |||||||||||||||||
seq2  TGACTTTCATACTTAAAGCCTGTTCCCTCCAGAAAAAGATAAAGCTGTTA  249

seq1  CTTTCCTGCTTTCTTTGGCTTAGTTTTCTGTCTTTCCTGAAGGCTCAGTT  293
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTCCTGCTTTCTTTGGCTTAGTTTTCTGTCTTTCCTGAAGGCTCAGTT  299

seq1  CTTTGTCTGTGTAAGCAATGAGCTCAGCAATCCCCTAAATAATTCCCAAC  343
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTGTCTGTGTAAGCAATGAGCTCAGCAATCCCCTAAATAATTCCCAAC  349

seq1  ACACTGCTCCACAATAACACCCTTCGAATTAATGACAACTAAAAATCTCT  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACTGCTCCACAATAACACCCTTCGAATTAATGACAACTAAAAATCTCT  399

seq1  GCAAACACTGTGAAGGTCACCTTGTCTACCAGATCACTCCACATTAACAA  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAACACTGTGAAGGTCACCTTGTCTACCAGATCACTCCACATTAACAA  449

seq1  ATATTGGTTTAAATGTATTTAATTATTACTTATGCAATAACTAAACGAAT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGGTTTAAATGTATTTAATTATTACTTATGCAATAACTAAACGAAT  499

seq1  TTTAACTGTTTATTTCCTTTTTGATGATGCCCAGTTAGAGAGACTTTGTG  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAACTGTTTATTTCCTTTTTGATGATGCCCAGTTAGAGAGACTTTGTG  549

seq1  GGTGAACACCATTGTGAGGCTCAGGGAGCACATATTGAGTTTTAGGAAAG  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGAACACCATTGTGAGGCTCAGGGAGCACATATTGAGTTTTAGGAAAG  599

seq1  ATTTCATTTCATAGGTCCTTTATCTTTGATGAACGGGAAAGGGTATAAAA  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTCATTTCATAGGTCCTTTATCTTTGATGAACGGGAAAGGGTATAAAA  649

seq1  GATGAAAGAGGAAGGCAGAGGGTAGAAAGAGAGTGCTAAGATAATTCAAG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAAAGAGGAAGGCAGAGGGTAGAAAGAGAGTGCTAAGATAATTCAAG  699

seq1  TGTTAAGAAAGGTCTGAATCTAAAGTGATTTCATTGTGTACATGACAGAA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTAAGAAAGGTCTGAATCTAAAGTGATTTCATTGTGTACATGACAGAA  749

seq1  TAAGAAAACTATTCATTGAGTGAAACACTCATCAGGCAGAATTTTGCTTT  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGAAAACTATTCATTGAGTGAAACACTCATCAGGCAGAATTTTGCTTT  799

seq1  TTTTTTCTTCAATTTACCCTTAGCTATAAAAGCAGAGACTGAGAAATGTG  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTCTTCAATTTACCCTTAGCTATAAAAGCAGAGACTGAGAAATGTG  849

seq1  GATTAACAAGATGAGGGCTGCTGGCTAAAAGTGACATGTGATTATATTTT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAACAAGATGAGGGCTGCTGGCTAAAAGTGACATGTGATTATATTTT  899

seq1  AAAAAACATGTAGAAAGGGCCACGTAAACCCACTGGGCACCAACAGTTGC  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAACATGTAGAAAGGGCCACGTAAACCCACTGGGCACCAACAGTTGC  949

seq1  TAAGGACATTGAAAGCATGAACTTAGAAATGGCTTTCATTCAAAGAATTC  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGACATTGAAAGCATGAACTTAGAAATGGCTTTCATTCAAAGAATTC  999

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information