MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-183J22
Chromosome	X (Build37)
Map Location	102,895,861 - 103,058,061
singlet/doublet	doublet
Overlap gene	EG633570, Fgf16, Atrx
Upstream gene	Magee2, LOC622098, LOC676331, 5530601H04Rik, 2610029G23Rik, Magee1, LOC622159, LOC668454, E530001F21Rik, LOC622202, LOC100043213, LOC668458, Cypt2
Downstream gene	2610529C04Rik, Cox7b, Atp7a, Tlr13, LOC671297, Pgk1, Taf9b, 5031408O05Rik, EG333563, LOC622494, Gm784, Cysltr1, EG331493, LOC668490, LOC100042772, LOC100043263, Zcchc5
Link	Open Mouse BAC browser

Click to get alignment info.

name	Magee2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:272790 MGI:2148316
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 8 Proteins pseudo : _no_value

name	LOC676331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	5530601H04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71445 MGI:1918695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	2610029G23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67683 MGI:1914933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magee1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:107528 MGI:2148149
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC622159 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins pseudo : _no_value

name	LOC668454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	E530001F21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279610 MGI:3036288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	LOC622202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622202
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	LOC100043213 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC668458 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 12 Proteins pseudo : _no_value

name	Cypt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245566 MGI:2676331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG633570 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633570 MGI:3649027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 256 ESTs, 6 Proteins

name	Fgf16 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:80903 MGI:1931627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atrx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22589 MGI:103067
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2610529C04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67075 MGI:1914325
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cox7b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66142 MGI:1913392
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp7a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11977 MGI:99400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tlr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279572 MGI:3045213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671297 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671297
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Pgk1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18655 MGI:97555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:407786 MGI:3039562
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	5031408O05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331491 MGI:2685621
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG333563 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333563 MGI:3644182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	LOC622494 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	Gm784 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333564 MGI:2685630
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cysltr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58861 MGI:1926218
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG331493 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331493 MGI:3648285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668490 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 3 Proteins pseudo : _no_value

name	LOC100042772 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042772
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC100043263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Zcchc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213436 MGI:2685221
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magee2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:62990116 GeneID:272790 MGI:2148316
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family E, 2 transcript_id : NM_053206.1

name	5530601H04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271853 GeneID:71445 MGI:1918695
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 5530601H04 gene transcript_id : XM_001479596.1

name	2610029G23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803459 GeneID:67683 MGI:1914933
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610029G23 gene transcript_id : NM_026312.3

name	Magee1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111378376 GeneID:107528 MGI:2148149
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family E, 1 transcript_id : NM_053201.3

name	LOC100043213 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271856 GeneID:100043213
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043213 transcript_id : XM_001479629.1

name	Cypt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206397 GeneID:245566 MGI:2676331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich perinuclear theca 2 transcript_id : NM_173436.1

name	EG633570 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407734 GeneID:633570 MGI:3649027
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 256 ESTs, 6 Proteins product : predicted gene, EG633570 transcript_id : XM_001001613.1

name	Fgf16 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126116562 GeneID:80903 MGI:1931627
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fibroblast growth factor 16 transcript_id : NM_030614.2

name	Atrx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678608 GeneID:22589 MGI:103067
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : alpha thalassemia/mental retardation syndrome X-linked homolog (human) transcript_id : NM_009530.1

name	2610529C04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981110 GeneID:67075 MGI:1914325
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610529C04 gene transcript_id : NM_025952.2

name	Cox7b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70909318 GeneID:66142 MGI:1913392
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome c oxidase subunit VIIb transcript_id : NM_025379.2

name	Atp7a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352884 GeneID:11977 MGI:99400
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Cu++ transporting, alpha polypeptide transcript_id : NM_009726.3

name	Tlr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:45429998 GeneID:279572 MGI:3045213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : toll-like receptor 13 transcript_id : NM_205820.1

name	Pgk1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778975 GeneID:18655 MGI:97555
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphoglycerate kinase 1 transcript_id : NM_008828.2

name	Taf9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47564075 GeneID:407786 MGI:3039562
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF9B RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_001001176.1

name	5031408O05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376404 GeneID:331491 MGI:2685621
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5031408O05 gene transcript_id : NM_001033424.2

name	EG333563 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51772285 GeneID:333563 MGI:3644182
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : predicted gene, EG333563 transcript_id : XM_285515.3

name	Gm784 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090555 GeneID:333564 MGI:2685630
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 784, (NCBI) transcript_id : NM_001007580.1

name	Cysltr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388547 GeneID:58861 MGI:1926218
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteinyl leukotriene receptor 1 transcript_id : NM_021476.3

name	EG331493 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359007 GeneID:331493 MGI:3648285
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG331493 transcript_id : NM_001033541.2

name	Zcchc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41054991 GeneID:213436 MGI:2685221
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 5 transcript_id : NM_199468.1

name	Magee2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62990117 CCDS:CCDS30333.1 GeneID:272790 MGI:2148316
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : melanoma antigen, family E, 2 protein_id : NP_444436.1

name	5530601H04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271854 GeneID:71445 MGI:1918695
definition	codon_start : 1 product : hypothetical protein LOC71445 protein_id : XP_001479646.1

name	2610029G23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385810 CCDS:CCDS30334.1 GeneID:67683 MGI:1914933
definition	codon_start : 1 note : novel protein containing Domain of Unknown Function (DUF757) product : hypothetical protein LOC67683 protein_id : NP_080588.1

name	Magee1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111378377 GeneID:107528 MGI:2148149
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030425 - dendrite [Evidence IDA]; GO:0016010 - dystrophin-associated glycoprotein complex [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA]; GO:0048471 - perinuclear region [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0045211 - postsynaptic membrane [Evidence IDA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IPI] [Evidence IEP] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : melanoma antigen, family E, 1 protein_id : NP_444431.3

name	LOC100043213 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271857 GeneID:100043213
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001479679.1

name	Cypt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91206398 CCDS:CCDS30335.1 GeneID:245566 MGI:2676331
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : cysteine-rich perinuclear theca 2 protein_id : NP_775612.1

name	EG633570 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407735 GeneID:633570 MGI:3649027
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001613.1

name	Fgf16 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126116563 CCDS:CCDS30336.1 GeneID:80903 MGI:1931627
definition	codon_start : 1 product : fibroblast growth factor 16 protein_id : NP_085117.2

name	Atrx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678609 GeneID:22589 MGI:103067
definition	GO_component : GO:0000792 - heterochromatin [Evidence IDA]; GO:0000228 - nuclear chromosome [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence IDA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0030900 - forebrain development [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : X-linked nuclear protein; alpha thalassemia/mental retardation syndrome (X-linked) product : alpha thalassemia/mental retardation syndrome X-linked homolog protein_id : NP_033556.1

name	2610529C04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981111 GeneID:67075 MGI:1914325
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0008250 - oligosaccharyl transferase complex [Evidence ISS] GO_function : GO:0004579 - dolichyl-diphosphooligosaccharide-protein glycotransferase activity [Evidence ISS] GO_process : GO:0018279 - protein amino acid N-linked glycosylation via asparagine [Evidence ISS] codon_start : 1 exception : mismatches in translation product : implantation-associated protein protein_id : NP_080228.2

name	Cox7b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384754 GeneID:66142 MGI:1913392
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005746 - mitochondrial electron transport chain [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : cytochrome c oxidase subunit VIIb protein_id : NP_079655.1

name	Atp7a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982812 GeneID:11977 MGI:99400
definition	GO_component : GO:0043025 - cell soma [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IDA] [Evidence IEA]; GO:0030140 - trans-Golgi network transport vesicle [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0015662 - ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0005507 - copper ion binding [Evidence ISS] [Evidence IEA]; GO:0005375 - copper ion transporter activity [Evidence IEA]; GO:0004008 - copper-exporting ATPase activity [Evidence ISS] [Evidence IDA] [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0046873 - metal ion transporter activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006812 - cation transport [Evidence IEA]; GO:0030199 - collagen fibril organization [Evidence IMP]; GO:0006878 - copper ion homeostasis [Evidence IMP]; GO:0006825 - copper ion transport [Evidence IMP] [Evidence IDA] [Evidence ISS]; GO:0042417 - dopamine metabolism [Evidence IMP]; GO:0042414 - epinephrine metabolism [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0007626 - locomotory behavior [Evidence IMP]; GO:0008152 - metabolism [Evidence IEA]; GO:0030001 - metal ion transport [Evidence IEA]; GO:0042421 - norepinephrine biosynthesis [Evidence IMP]; GO:0042415 - norepinephrine metabolism [Evidence IMP]; GO:0018205 - peptidyl-lysine modification [Evidence IMP]; GO:0043473 - pigmentation [Evidence IMP]; GO:0043588 - skin development [Evidence IMP]; GO:0006810 - transport [Evidence IEA]; GO:0006568 - tryptophan metabolism [Evidence IMP]; GO:0006570 - tyrosine metabolism [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Menkes protein product : ATPase, Cu++ transporting, alpha polypeptide protein_id : NP_033856.2

name	Tlr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45429999 CCDS:CCDS30338.1 GeneID:279572 MGI:3045213
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0004888 - transmembrane receptor activity [Evidence IEA] GO_process : GO:0006955 - immune response [Evidence IEA]; GO:0006954 - inflammatory response [Evidence IEA]; GO:0045087 - innate immune response [Evidence IEA] codon_start : 1 product : toll-like receptor 13 protein_id : NP_991389.1

name	Pgk1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778976 CCDS:CCDS30339.1 GeneID:18655 MGI:97555
definition	GO_function : GO:0005524 - ATP binding [Evidence ISS] [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004618 - phosphoglycerate kinase activity [Evidence IDA] [Evidence ISS]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006096 - glycolysis [Evidence ISS] [Evidence IEA]; GO:0016310 - phosphorylation [Evidence ISS] codon_start : 1 product : phosphoglycerate kinase 1 protein_id : NP_032854.2

name	Taf9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47564076 CCDS:CCDS30340.1 GeneID:407786 MGI:3039562
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005669 - transcription factor TFIID complex [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 exception : mismatches in translation product : TAF9-like RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_001001176.1

name	5031408O05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701925 CCDS:CCDS30341.1 GeneID:331491 MGI:2685621
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC331491 protein_id : NP_001028596.1

name	EG333563 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772286 GeneID:333563 MGI:3644182
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285515.3

name	Gm784 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090556 CCDS:CCDS30342.1 GeneID:333564 MGI:2685630
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : fibronectin domain-containing protein 3c product : hypothetical protein LOC333564 protein_id : NP_001007581.1

name	Cysltr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542449 GeneID:58861 MGI:1926218
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004974 - leukotriene receptor activity [Evidence IDA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IDA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : leukotriene D4 receptor; LTD4 receptor; cysteinyl leukotriene 1 receptor product : cysteinyl leukotriene receptor 1 protein_id : NP_067451.2

name	EG331493 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702049 CCDS:CCDS30343.1 GeneID:331493 MGI:3648285
definition	codon_start : 1 note : novel protein containing 7 transmembrane receptor (rhodopsin family) domain product : hypothetical protein B130007I08 protein_id : NP_001028713.1

name	Zcchc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41054992 CCDS:CCDS30344.1 GeneID:213436 MGI:2685221
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger CCHC domain containing 5 product : zinc finger, CCHC domain containing 5 protein_id : NP_955762.1

name	LOC676331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676331
definition	number : 1 pseudo : _no_value

name	LOC668454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668454
definition	number : 2 pseudo : _no_value

name	LOC668454 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668454
definition	number : 1 pseudo : _no_value

name	LOC671297 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671297
definition	number : 1 pseudo : _no_value

name	LOC671297 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671297
definition	number : 2 pseudo : _no_value

name	LOC100042772 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042772
definition	number : 1 pseudo : _no_value

name	LOC100042772 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042772
definition	number : 2 pseudo : _no_value

name	LOC100043263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043263
definition	number : 1 pseudo : _no_value

name	LOC622098 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271852 GeneID:622098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 46 ESTs, 8 Proteins product : similar to Ribosomal protein L12 pseudo : _no_value transcript_id : XR_034284.1

name	LOC622159 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271855 GeneID:622159
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 2 Proteins product : similar to spermine synthase pseudo : _no_value transcript_id : XR_034293.1

name	E530001F21Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:95006997 GeneID:279610 MGI:3036288
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA E530001F21 gene pseudo : _no_value transcript_id : NR_002167.2

name	LOC668458 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271858 GeneID:668458
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 12 Proteins product : similar to small GTP binding protein pseudo : _no_value transcript_id : XR_034298.1

name	LOC622494 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271859 GeneID:622494
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : hypothetical LOC622494 pseudo : _no_value transcript_id : XR_034323.1

name	LOC668490 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271824 GeneID:668490
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 3 Proteins product : similar to Zinc finger protein 277 pseudo : _no_value transcript_id : XR_033882.1

clone name	MSMg01-376L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-477B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-215L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-135G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-235B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055F12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-093K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359H06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-297D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291K12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-424A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124L06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-490P07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133I24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-442O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-085N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188F21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-163E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138G08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174I11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-357E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-114E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-032C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338C21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-250H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-176P15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-113A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-231P20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-326E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-048B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093C22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218L04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019A16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324P02
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-183J22.b	B6Ng01-183J22.g
ACC	GA009198	GA009199
length	1,068	934
definition	B6Ng01-183J22.b	B6Ng01-183J22.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(102,895,861 - 102,896,918)	(103,057,143 - 103,058,061)
sequence	gaattcatctgtttgtttggattcacctttaggccactgatcatttttcc taatgaacttctgaagtcttcatctagccttttacccatttcagaatcat ccagtggtagttgaagtggatgcatgctaacttactttttcatgtgatac ggtttgaaaatctgttggtcttgatatctcttccaatttgatatagggat attattgagtagtctactctggagtgttccattttacttaataacaagaa atctgctgtagcagcaacaacattgacctttacaatagagggaactgtac ttacaattgactaaaggctactaatcaccaatgtccactctccagcaggt aaacattactgtacaatgtgaagaacaccatgtgaaaaaaaaatcattta gggtaaaagtgcacacaggaagtgtgtgctagatgaagaaggaagaagag ggtagaaaccaaggagaaacaaggctaaagcacttaagagacaaagatga tcagctgggaaagggggaatacggtcaagatacattgtgtgggattctca agtcattagtgaaatactgtaattccaactcaattcttcaacgaattaaa aagggcaattggcagattcatctggaataacaaaaaacctaggatagcaa aaactcttctcaaggataaaagaacctctggtggaatcaccatgcccgac ctaaagctgtactacagagcaattgtgataaaaaaaaaaaactgcatggt actggtatagtgacagacaaatagaccaatggaacagaattgaagaccca gagatgaacccacacacctatggtcacttgatctttgacaagggagctaa aaccatccagtggaaaaaagacggcatttttcaacaattggtgctgggca caactggctgttatcatgtagaagattgtgaattgatccatttctatctc cttgtactaaaggtcaaatctaagtgcattaaggaactccacataaaacg agagaccactgaaaacttatagaggaagaaagtagggaaaaagcctcgaa gattatgggtacagggga	gaattctttaatatgactaattgtcctgtattgatgttaatattattttt tcttaataaaattcttctaaaagcttagatttttaaaaagatttatttac ttattcatttatttatattatatgagtgatatatctgcatgtatatctgc atgccagaaggggacatctgatcccaggatagatggttgtgaatcaccac gtggttgctgggaattgaactcaggacctctggaagagcagacagtgctc tttacctctgagccatctctccagccccctaatttttgttaagtaaagcc aggagatactcactttcttattttccttttctcttaattgttttgatttt tgaagactggtgtatatatgtgtgtatgcgtgtgtatgtttgtatgtgtg tatagccttggctgtcttggaacttgctctgtaggccaggttagcctcaa actcagagagttctgcctgtctctgcctcctgggtgcttgggttaaaggt gtgcaccaccttgcctagctgaaatattcattttctaatttgtgtgcttt aagcagaatgcatcatgtataaaacattaacaaccatgggttcttttgtg gtgttctttttttttttcttgtcttaaacatttcctaagccctggagctc actgttagaccaggctgtccttgaactcgaagctccacctgcctttgctg cgttagtgcaagggataaaaggcatgtgccacccactgtctttgggccct aactatgatttcatattagctagtcctgatttttttaaaaagaaaatttt tgatatttaatttttctggtacagggctggtcttgtcctttgaatacaga ctatataaggaccacatggattgaagaattgattagagcagttgtttaat cctttgattattaataggtttgttatgaagtttt
quality values	Open. Hide. 47 26 24 32 58 25 13 54 58 58 49 58 62 62 54 62 62 62 62 49 41 39 62 39 24 62 62 62 62 47 56 44 10 11 20 10 13 10 9 12 19 9 19 18 25 23 28 43 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 59 62 24 40 30 34 34 30 28 34 27 28 29 28 32 45 49 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 59 56 62 62 54 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 54 62 59 59 62 50 56 54 48 59 62 62 59 62 62 62 62 62 59 56 46 59 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 50 56 56 38 34 46 56 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 59 62 49 49 33 43 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 49 62 62 62 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 56 62 56 54 56 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 39 62 62 62 62 62 62 62 62 62 48 62 62 62 49 62 62 62 62 54 62 62 49 62 62 62 49 62 54 62 62 54 24 62 62 62 52 53 62 62 62 62 54 58 58 49 58 58 54 58 58 46 54 42 54 58 58 58 54 58 46 52 54 44 45 58 58 42 40 52 42 45 42 58 54 52 58 58 58 58 54 58 52 52 52 52 52 42 54 58 54 58 58 48 58 58 58 54 58 42 34 52 52 48 34 47 41 52 52 54 58 58 58 58 46 51 38 34 41 43 58 45 35 47 58 58 58 46 58 47 35 58 38 58 51 49 58 34 58 44 49 49 52 51 40 47 51 35 54 54 50 47 41 33 46 22 58 54 46 58 51 49 37 50 50 58 29 39 41 39 52 42 39 46 25 46 42 50 51 58 53 53 58 32 27 25 58 58 51 58 54 54 58 58 58 58 44 40 52 54 50 32 53 58 58 35 50 50 30 58 51 41 37 27 29 21 13 25 24 39 26 24 32 30 25 54 39 45 52 40 24 16 15 13 16 32 32 14 16 13 11 11 11 33 33 49 33 39 53 53 42 39 23 54 51 12 30 51 45 33 39 34 46 32 36 49 34 30 42 52 53 33 54 42 38 39 21 28 34 21 41 36 33 42 30 21 28 31 32 18 33 9 12 14 29 18 21 9 31 23 41 19 30 52 30 49 40 20 32 32 15 31 28 41 32 28 20 31 16 41 46 45 45 40 36 23 35 26 7 46 25 23 43 51 51 51 21 11 13 19 26 16 11 28 23 33 31 26 31 31 31 23 46 26 29 29 35 32 33 38 30 20 17 11 24 17 13 18 26 31 29 29 16 29 29 33 18 46 41 10 31 25 17 30 23 27 25 16 17 28 41 31 38 21 38 26 33 48 30 26 11 12 7 7 12 16 41 22 23 31 31 24 31 14 18 41 15 33 30 11 10 30 44 27 18 20 11 13 21 18 21 20 20 21 21 26 14 28 24 19 16 30 8 13 23 31 11 10 10 22 17 39 39 24 21 24 32 21 29 7 24 6 8 8 13 28 29 17 28 28 9 19 32 34 24 8 5 4 9 15 29 19 11 5 24 32 25 9 9 17 25 31 17 12 29 40 33 27 7 5 9 16 21 16 27 17 15 11 6 16 9 11 15 30 20 9 14 20 7 18 28 28 8 31	Open. Hide. 46 35 44 44 62 62 62 62 59 62 62 62 15 11 12 12 19 17 12 25 17 23 27 13 18 34 29 49 54 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 30 34 34 34 34 36 28 27 27 28 23 28 28 28 56 56 62 62 62 62 42 54 62 62 62 62 59 62 62 62 62 54 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 54 54 42 62 62 62 62 62 62 54 54 62 62 62 62 54 62 62 62 62 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 49 54 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 54 62 62 62 62 62 62 54 59 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 36 43 43 43 48 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 49 62 56 62 62 62 62 56 62 62 62 62 62 62 62 56 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 54 62 62 62 62 62 62 56 62 62 62 62 62 62 47 62 62 56 54 54 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 42 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 54 62 62 58 58 58 54 50 47 43 40 58 52 54 58 54 58 58 58 58 58 58 58 58 58 46 52 47 58 58 52 46 58 40 47 58 54 52 52 52 58 58 52 54 32 54 54 52 52 52 54 46 54 44 58 42 54 54 52 34 34 52 58 58 58 43 49 58 33 47 52 50 54 40 51 37 27 41 43 50 49 46 58 19 36 51 48 21 29 51 25 49 47 52 51 25 58 40 47 50 52 49 39 58 58 26 37 51 29 22 42 48 35 51 41 25 41 37 25 20 25 39 19 31 25 6 35 28 40 21 50 24 14 26 40 50 35 25 32 31 30 28 15 15 32 39 40 12 6 12 37 13 19 44 16 12 29 26 31 18 25 12 15 17 17 10 14 8 13 16 50 19 33 28 13 10 19 21 15 13 25 34 30 31 25 19 34 32 29 38 26 32 23 23 25 32 42 36 47 35 13 35 28 40 27 25 40 39 40 27 30 18 14 18 19 24 16 13 22 28 35 24 26 23 26 18 31 35 6 12 21 22 9 44 18 10 11 9 16 10 10 19 11 23 6 9 6 10 12 16 13 27 7 19 11 21 15 22 24 10 21 6 16 17 5 6 11 7 24 29 11 14 18 31 8 31 16 9 33 33 31 21 17 18 14 22 14 21 8 10 18 35 16 9 14 43 7 17 42 22 8 28 30 29 32 10 12 17 9 12 9 31 18 28 23 21 13 13 10 10 11 9 6 8 7 23 18 9 6 5 23 25 16 31 6 10 16 22 8 7 6 11 11

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_102895861_102896918
seq2: B6Ng01-183J22.b_46_1111

seq1  GAATTCATCTGTTTGTTTGGATTCACCTTTAGGCCACTGATCATTTTTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATCTGTTTGTTTGGATTCACCTTTAGGCCACTGATCATTTTTCC  50

seq1  TAATGAACTTCTGAAGTCTTCATCTAGCCTTTTACCCATTTCAGAATCAT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGAACTTCTGAAGTCTTCATCTAGCCTTTTACCCATTTCAGAATCAT  100

seq1  CCAGTGGTAGTTGAAGTGGATGCATGCTAACTTACTTTTTCATGTGATAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGTGGTAGTTGAAGTGGATGCATGCTAACTTACTTTTTCATGTGATAC  150

seq1  GGTTTGAAAATCTGTTGGTCTTGATATCTCTTCCAATTTGATATAGGGAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTGAAAATCTGTTGGTCTTGATATCTCTTCCAATTTGATATAGGGAT  200

seq1  ATTATTGAGTAGTCTACTCTGGAGTGTTCCATTTTACTTAATAACAAGAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATTGAGTAGTCTACTCTGGAGTGTTCCATTTTACTTAATAACAAGAA  250

seq1  ATCTGCTGTAGCAGCAACAACATTGACCTTTACAATAGAGGGAACTGTAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGCTGTAGCAGCAACAACATTGACCTTTACAATAGAGGGAACTGTAC  300

seq1  TTACAATTGACTAAAGGCTACTAATCACCAATGTCCACTCTCCAGCAGGT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTACAATTGACTAAAGGCTACTAATCACCAATGTCCACTCTCCAGCAGGT  350

seq1  AAACATTACTGTACAATGTGAAGAACACCATGTGAAAAAAAAATCATTTA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACATTACTGTACAATGTGAAGAACACCATGTGAAAAAAAAATCATTTA  400

seq1  GGGTAAAAGTGCACACAGGAAGTGTGTGCTAGATGAAGAAGGAAGAAGAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTAAAAGTGCACACAGGAAGTGTGTGCTAGATGAAGAAGGAAGAAGAG  450

seq1  GGTAGAAACCAAGGAGAAACAAGGCTAAAGCACTTAAGAGACAAAGATGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTAGAAACCAAGGAGAAACAAGGCTAAAGCACTTAAGAGACAAAGATGA  500

seq1  TCAGCTGGGAAAGGGGGAATACGGTCAAGATACATTGTGTGGGATTCTCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCTGGGAAAGGGGGAATACGGTCAAGATACATTGTGTGGGATTCTCA  550

seq1  AGTCATTAGTGAAATACTGTAATTCCAACTCAATTCTTCAACGAATTAAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCATTAGTGAAATACTGTAATTCCAACTCAATTCTTCAACGAATTAAA  600

seq1  AAGGGCAATTGGCAGATTCATCTGGAATAACAAAAAACCTAGGATAGCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGCAATTGGCAGATTCATCTGGAATAACAAAAAACCTAGGATAGCAA  650

seq1  AAACTCTTCTCAAGGATAAAAGAACCTCTGGTGGAATCACCATGCCCGAC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCTTCTCAAGGATAAAAGAACCTCTGGTGGAATCACCATGCCCGAC  700

seq1  CTAAAGCTGTACTACAGAGCAATTGTGATAAAAAAAAAAAACTGCATGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAGCTGTACTACAGAGCAATTGTGATAAAAAAAAAAAACTGCATGGT  750

seq1  ACTGGTATAGTGACAGACAAATAGACCAATGGAACAGAATTGAAGACCCA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGTATAGTGACAGACAAATAGACCAATGGAACAGAATTGAAGACCCA  800

seq1  GAGATGAACCCACACACCTATGGTCACTTGATCTTTGACAAGGGAGCTAA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGATGAACCCACACACCTATGGTCACTTGATCTTTGACAAGGGAGCTAA  850

seq1  AACCATCCAGTGGAAAAAAGACGGCA-TTTTCAACAATTGGTGCT-GGCA  898
      |||||||||||||||||||||||||| |||||||||||||||||| ||||
seq2  AACCATCCAGTGGAAAAAAGACGGCATTTTTCAACAATTGGTGCTGGGCA  900

seq1  CAACTGGCTGTTATCATGTAGAAGATTGTGAATTGATCCATTTCTATCTC  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACTGGCTGTTATCATGTAGAAGATTGTGAATTGATCCATTTCTATCTC  950

seq1  CTTGTACT-AAGGTCAAATCTAAGTGCATTAAGGAACTCCACATAAAACG  997
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  CTTGTACTAAAGGTCAAATCTAAGTGCATTAAGGAACTCCACATAAAACG  1000

seq1  AGAGA-CACTG-AAACTTATAGAGG-AGAAAGTAGGG-AAAAGCCTCGAA  1043
      ||||| ||||| ||||||||||||| ||||||||||| ||||||||||||
seq2  AGAGACCACTGAAAACTTATAGAGGAAGAAAGTAGGGAAAAAGCCTCGAA  1050

seq1  GA-TATGGGTACAGGG  1058
      || |||||||||||||
seq2  GATTATGGGTACAGGG  1066

seq1: chrX_103057143_103058061
seq2: B6Ng01-183J22.g_68_1001 (reverse)

seq1  AAAAC-TCATAACAAACCAATAAATAATCAAAAG-CTAAACAACTGCTCT  48
      ||||| |||||||||||| || |||||||||| |  ||||||||||||||
seq2  AAAACTTCATAACAAACCTATTAATAATCAAAGGATTAAACAACTGCTCT  50

seq1  AATC-ACTCTTCAAT-CATGT-GTCC-TATTAAGTCTGTATTC-AATGAC  93
      |||| | |||||||| ||||| |||| |||  ||||||||||| || |||
seq2  AATCAATTCTTCAATCCATGTGGTCCTTATATAGTCTGTATTCAAAGGAC  100

seq1  AAG--CAGCCCTGTACCAGAAAAATT-AATATC-AAAATTTTC-TTTTAA  138
      |||  ||||||||||||||||||||| |||||| ||||||||| ||||||
seq2  AAGACCAGCCCTGTACCAGAAAAATTAAATATCAAAAATTTTCTTTTTAA  150

seq1  AAAAATCAGGACTAGCT-ATATGAAATCATAGTTAGGGCCC-AAGACAGT  186
      ||||||||||||||||| ||||||||||||||||||||||| ||||||||
seq2  AAAAATCAGGACTAGCTAATATGAAATCATAGTTAGGGCCCAAAGACAGT  200

seq1  GGGTGGCACATGCCTTTTATCCC-TGCACTAACGCAGCAAAGGCAGGTGG  235
      ||||||||||||||||||||||| ||||||||||||||||||||||||||
seq2  GGGTGGCACATGCCTTTTATCCCTTGCACTAACGCAGCAAAGGCAGGTGG  250

seq1  AGCTTCGAGTTCAAGGACAGCCTGGTCTAACAGTGAGCTCCAGGGCTTAG  285
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTCGAGTTCAAGGACAGCCTGGTCTAACAGTGAGCTCCAGGGCTTAG  300

seq1  GAAATGTTTAAGACAAGAAAAAAAAAAAGAACACCACAAAAGAACCCATG  335
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATGTTTAAGACAAGAAAAAAAAAAAGAACACCACAAAAGAACCCATG  350

seq1  GTTGTTAATGTTTTATACATGATGCATTCTGCTTAAAGCACACAAATTAG  385
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTTAATGTTTTATACATGATGCATTCTGCTTAAAGCACACAAATTAG  400

seq1  AAAATGAATATTTCAGCTAGGCAAGGTGGTGCACACCTTTAACCCAAGCA  435
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATGAATATTTCAGCTAGGCAAGGTGGTGCACACCTTTAACCCAAGCA  450

seq1  CCCAGGAGGCAGAGACAGGCAGAACTCTCTGAGTTTGAGGCTAACCTGGC  485
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGGAGGCAGAGACAGGCAGAACTCTCTGAGTTTGAGGCTAACCTGGC  500

seq1  CTACAGAGCAAGTTCCAAGACAGCCAAGGCTATACACACATACAAACATA  535
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACAGAGCAAGTTCCAAGACAGCCAAGGCTATACACACATACAAACATA  550

seq1  CACACGCATACACACATATATACACCAGTCTTCAAAAATCAAAACAATTA  585
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACGCATACACACATATATACACCAGTCTTCAAAAATCAAAACAATTA  600

seq1  AGAGAAAAGGAAAATAAGAAAGTGAGTATCTCCTGGCTTTACTTAACAAA  635
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAAAAGGAAAATAAGAAAGTGAGTATCTCCTGGCTTTACTTAACAAA  650

seq1  AATTAGGGGGCTGGAGAGATGGCTCAGAGGTAAAGAGCACTGTCTGCTCT  685
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAGGGGGCTGGAGAGATGGCTCAGAGGTAAAGAGCACTGTCTGCTCT  700

seq1  TCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACGTGGTGATTCACAACC  735
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACGTGGTGATTCACAACC  750

seq1  ATCTATCCTGGGATCAGATGTCCCCTTCTGGCATGCAGATATACATGCAG  785
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTATCCTGGGATCAGATGTCCCCTTCTGGCATGCAGATATACATGCAG  800

seq1  ATATATCACTCATATAATATAAATAAATGAATAAGTAAATAAATCTTTTT  835
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATATCACTCATATAATATAAATAAATGAATAAGTAAATAAATCTTTTT  850

seq1  AAAAATCTAAGCTTTTAGAAGAATTTTATTAAGAAAAAATAATATTAACA  885
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAATCTAAGCTTTTAGAAGAATTTTATTAAGAAAAAATAATATTAACA  900

seq1  TCAATACAGGACAATTAGTCATATTAAAGAATTC  919
      ||||||||||||||||||||||||||||||||||
seq2  TCAATACAGGACAATTAGTCATATTAAAGAATTC  934

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information