MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-185N19
Chromosome	X (Build37)
Map Location	11,859,967 - 12,002,584
singlet/doublet	doublet
Overlap gene	LOC100043946
Upstream gene	LOC100042922, LOC100042927, LOC100042929, LOC100042931, OTTMUSG00000016790, LOC100042939, LOC100042943, LOC100042944, LOC100042946, EG236663, 8430439B09Rik, LOC669520, Rpl23a-ps, LOC100043945, Bcor, 2900008C10Rik, LOC385323
Downstream gene	LOC628441, Atp6ap2, LOC668986, EG245347, 1810030O07Rik, Crsp2, LOC668987, LOC245350, Ppia-psx_132.1, Usp9x, LOC100043000, LOC100043002, LOC675380, Ddx3x, LOC385326, LOC634019, LOC668990, LOC100043947, LOC100043948
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100042922 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042927 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042931 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	OTTMUSG00000016790 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547160 MGI:3649617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	LOC100042946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins

name	EG236663 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236663 MGI:3643273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	8430439B09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78147 MGI:1925397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	LOC669520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs

name	Rpl23a-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC100043945 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Bcor (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71458 MGI:1918708
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	2900008C10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72937 MGI:1920187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs

name	LOC385323 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385323
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100043946 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC628441 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628441
definition	note : ribosomal protein L30 pseudogene pseudo : _no_value

name	Atp6ap2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70495 MGI:1917745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668986 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins pseudo : _no_value

name	EG245347 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins

name	1810030O07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69155 MGI:1916405
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Crsp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC245350 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:245350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 17 Proteins

name	Ppia-psx_132.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606727
definition	note : peptidylprolyl isomerase A pseudogene x_132.1 pseudo : _no_value

name	Usp9x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043000 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 2589 ESTs, 8 Proteins

name	LOC100043002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins

name	LOC675380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ddx3x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385326 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins pseudo : _no_value

name	LOC634019 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins pseudo : _no_value

name	LOC668990 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	LOC100043947 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC100043948 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043948
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100042922 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270968 GeneID:100042922
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001476992.1

name	LOC100042927 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270970 GeneID:100042927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : hypothetical protein LOC100042927 transcript_id : XM_001477006.1

name	LOC100042929 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270972 GeneID:100042929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477023.1

name	LOC100042931 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270974 GeneID:100042931
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477035.1

name	OTTMUSG00000016790 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347343 GeneID:547160 MGI:3649617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, OTTMUSG00000016790 transcript_id : NM_001025260.2

name	LOC100042939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270976 GeneID:100042939
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477063.1

name	LOC100042943 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270978 GeneID:100042943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477078.1

name	LOC100042944 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270980 GeneID:100042944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477092.1

name	LOC100042946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270982 GeneID:100042946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 6 Proteins product : similar to 1700012L04Rik protein transcript_id : XM_001477106.1

name	EG236663 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20983169 GeneID:236663 MGI:3643273
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : predicted gene, EG236663 transcript_id : XM_141620.1

name	8430439B09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270984 GeneID:78147 MGI:1925397
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 8430439B09 gene transcript_id : XM_001477135.1

name	LOC669520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271041 GeneID:669520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs product : hypothetical LOC669520 transcript_id : XM_001481253.1

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66792787 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175045.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351506 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175046.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365597 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_175044.2

name	Bcor (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346423 GeneID:71458 MGI:1918708
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bcl6 interacting corepressor transcript_id : NM_029510.2

name	2900008C10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270986 GeneID:72937 MGI:1920187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 15 ESTs product : RIKEN cDNA 2900008C10 gene transcript_id : XM_001477165.1

name	LOC100043946 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271044 GeneID:100043946
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100043946 transcript_id : XM_001481254.1

name	Atp6ap2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801711 GeneID:70495 MGI:1917745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal accessory protein 2 transcript_id : NM_027439.3

name	EG245347 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407015 GeneID:245347 MGI:3644533
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs, 6 Proteins product : predicted gene, EG245347 transcript_id : XM_141624.4

name	1810030O07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372747 GeneID:69155 MGI:1916405
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810030O07 gene transcript_id : NM_175141.3

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270976 GeneID:26896 MGI:1349442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_001048208.1

name	Crsp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115270971 GeneID:26896 MGI:1349442
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cofactor required for Sp1 transcriptional activation, subunit 2 transcript_id : NM_012005.3

name	LOC245350 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407016 GeneID:245350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 16 ESTs, 17 Proteins product : similar to Ubiquitin-conjugating enzyme E2Q (putative) 2 transcript_id : XM_141626.5

name	Usp9x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115511017 GeneID:22284 MGI:894681
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 9, X chromosome transcript_id : NM_009481.2

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270990 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 2286 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 2 transcript_id : XM_001477279.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270992 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 1965 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 3 transcript_id : XM_001477304.1

name	LOC100043000 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270988 GeneID:100043000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 1391 ESTs, 4 Proteins product : similar to ribosomal protein L3, transcript variant 1 transcript_id : XM_001477264.1

name	LOC100043002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270994 GeneID:100043002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 124 ESTs, 3 Proteins product : hypothetical protein LOC100043002 transcript_id : XM_001477326.1

name	Ddx3x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129795 GeneID:13205 MGI:103064
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked transcript_id : NM_010028.2

name	LOC100043947 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271049 GeneID:100043947
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to preferentially expressed antigen in melanoma like 7 transcript_id : XM_001481255.1

name	LOC100042922 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270969 GeneID:100042922
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477042.1

name	LOC100042927 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270971 GeneID:100042927
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477056.1

name	LOC100042929 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270973 GeneID:100042929
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477073.1

name	LOC100042931 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270975 GeneID:100042931
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477085.1

name	OTTMUSG00000016790 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70608196 GeneID:547160 MGI:3649617
definition	codon_start : 1 note : Novel protein similar to Histone H2A product : hypothetical protein LOC547160 protein_id : NP_001020431.1

name	LOC100042939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270977 GeneID:100042939
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477113.1

name	LOC100042943 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270979 GeneID:100042943
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477128.1

name	LOC100042944 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270981 GeneID:100042944
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477142.1

name	LOC100042946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270983 GeneID:100042946
definition	codon_start : 1 product : similar to 1700012L04Rik protein protein_id : XP_001477156.1

name	EG236663 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20983170 GeneID:236663 MGI:3643273
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141620.1

name	8430439B09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270985 GeneID:78147 MGI:1925397
definition	codon_start : 1 product : hypothetical protein LOC78147 protein_id : XP_001477185.1

name	LOC669520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271042 GeneID:669520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481303.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281849 CCDS:CCDS30022.1 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform d is encoded by transcript variant d; BCL-6 corepressor product : BCL-6 interacting corepressor isoform d protein_id : NP_778211.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281843 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform b is encoded by transcript variant b; BCL-6 corepressor product : BCL-6 interacting corepressor isoform b protein_id : NP_778209.1

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66792788 CCDS:CCDS30021.1 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform c is encoded by transcript variant c; BCL-6 corepressor product : BCL-6 interacting corepressor isoform c protein_id : NP_778210.2

name	Bcor (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28144863 GeneID:71458 MGI:1918708
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform a is encoded by transcript variant a; BCL-6 corepressor product : BCL-6 interacting corepressor isoform a protein_id : NP_083786.1

name	2900008C10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270987 GeneID:72937 MGI:1920187
definition	codon_start : 1 product : hypothetical protein LOC72937 protein_id : XP_001477215.1

name	LOC100043946 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271045 GeneID:100043946
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481304.1

name	Atp6ap2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21361250 CCDS:CCDS30023.1 GeneID:70495 MGI:1917745
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : ATPase, H+ transporting, lysosomal interacting protein 1; ATPase, H+ transporting, lysosomal interacting protein 2 product : ATPase, H+ transporting, lysosomal accessory protein 2 protein_id : NP_081715.1

name	EG245347 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999881 GeneID:245347 MGI:3644533
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141624.3

name	1810030O07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424732 CCDS:CCDS30024.1 GeneID:69155 MGI:1916405
definition	codon_start : 1 note : Novel transcript product : hypothetical protein LOC69155 protein_id : NP_780350.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270977 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform a is encoded by transcript variant 1; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform a protein_id : NP_001041673.1

name	Crsp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115270972 GeneID:26896 MGI:1349442
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : isoform b is encoded by transcript variant 2; cofactor required for Sp1 transcriptional activation subunit 2 (150 kDa) product : cofactor required for Sp1 transcriptional activation, subunit 2 isoform b protein_id : NP_036135.3

name	LOC245350 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51830637 GeneID:245350
definition	codon_start : 1 product : similar to Ubiquitin-conjugating enzyme E2Q (putative) 2 protein_id : XP_141626.3

name	Usp9x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115511018 GeneID:22284 MGI:894681
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005544 - calcium-dependent phospholipid binding [Evidence IEA]; GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 note : fats facets protein related, X; ubiquitin specific protease 9 SSSRF- isoform product : ubiquitin specific protease 9, X chromosome protein_id : NP_033507.2

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270989 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 1 protein_id : XP_001477314.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270991 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 2 protein_id : XP_001477329.1

name	LOC100043000 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270993 GeneID:100043000
definition	codon_start : 1 product : similar to ribosomal protein L3 isoform 3 protein_id : XP_001477354.1

name	LOC100043002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270995 GeneID:100043002
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477376.1

name	Ddx3x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753620 CCDS:CCDS30027.1 GeneID:13205 MGI:103064
definition	GO_component : GO:0005737 - cytoplasm [Evidence ISS]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0008026 - ATP-dependent helicase activity [Evidence IEA]; GO:0004004 - ATP-dependent RNA helicase activity [Evidence ISS]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0003724 - RNA helicase activity [Evidence IEA] codon_start : 1 note : D-E-A-D (aspartate-glutamate-alanine-aspartate) box polypeptide 3; DEAD (aspartate-glutamate-alanine-aspartate) box polypeptide 3; embryonic RNA helicase; fibroblast growth factor inducible 14 product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked protein_id : NP_034158.1

name	LOC100043947 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271050 GeneID:100043947
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481305.1

name	Rpl23a-ps (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628338
definition	number : 1 pseudo : _no_value

name	LOC385323 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385323
definition	number : 2 pseudo : _no_value

name	LOC385323 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385323
definition	number : 1 pseudo : _no_value

name	LOC668987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668987
definition	number : 1 pseudo : _no_value

name	LOC668987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668987
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 1 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 2 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 3 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 4 pseudo : _no_value

name	LOC675380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:675380
definition	number : 5 pseudo : _no_value

name	LOC100043948 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043948
definition	number : 1 pseudo : _no_value

name	LOC100043945 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271043 GeneID:100043945
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to glyceraldehyde-3-phosphate dehydrogenase (phosphorylating)-like pseudo : _no_value transcript_id : XR_035068.1

name	LOC668986 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271046 GeneID:668986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 5 Proteins product : similar to Nol5a protein pseudo : _no_value transcript_id : XR_035069.1

name	LOC385326 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271047 GeneID:385326
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 12 Proteins product : similar to Chaperonin subunit 7 (eta) pseudo : _no_value transcript_id : XR_035070.1

name	LOC634019 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270996 GeneID:634019
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 19 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_033207.1

name	LOC668990 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271048 GeneID:668990
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to vitamin D receptor interacting protein pseudo : _no_value transcript_id : XR_035071.1

clone name	MSMg01-541B03
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-485P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-411O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-500I13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486L07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-080D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-490N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186H02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-303F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505C04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-467D08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513G14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-268B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-169B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265G21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-448J14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-525F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-231K09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-171O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-398A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-328F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-089G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-450M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-189J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-110C19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-163L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494C01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465D12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-259P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261D15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-326H14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-230D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012B12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237G14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-169G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-187E22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151E17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323P18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-325F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160F15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-185N19.b	B6Ng01-185N19.g
ACC	GA010858	GA010859
length	531	1,064
definition	B6Ng01-185N19.b	B6Ng01-185N19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(12,002,048 - 12,002,584)	(11,859,967 - 11,861,008)
sequence	caggcagctggagcttgtggccagggcccttcacatctccgaagcagaca ggcagcagagaactgctagaacccagaaacagatttaacatcaaggcccc atcccttgtgacccactgcttctggctaagccacagtcccatagaattct aaactctttccaaacagtgccagtagctgggaatcaagtgttcaaataca taatcgtgtgtggatagggctttgatagtcaaatcataatagtagggctg acaagatggcttgctgtgtaagaatgctttctgccaagactttatgagcc aagttcaaactccagaacccacaagatggaagctgacttctgcaagttgt cctttaccttgcacacacatgcaccatagcatgcccccacctcacaagta aatgttctcttttaaagcaaatcactttactgtctaccttctccaagtta taaatagctttataacacctgagaactcatcacatccccctctttaaagg gggaattggaatgtgtgtgtgaaggaggagg	gaattcttccttcccatctgcctgccatggtacctgtcacatgcagcact ctcccaagtgtagctgtgatgtggagctgatggtgggcactcacagttgg catacccccacccaccttccactgtgagtggtaggtgcacctataacatg cttaatagatgtcaccagcagggatgctacctcaatatgcaacctgactt ttaaaaaatattgtatttatagtgtgtgtgttccaaggacaatcagcagg agttggctttttgtttgtttgtttgtttgtttttccctttaccgtgtggg tcttaaggatccaattcgggtcttcaggcttagcagcaagggccattacc cactctccaactctctagcccacacagcctgtctctcaaaagccacactc ctggttcttactactccgaggaacccaggctttctacaacaggcaggaag gtacaacctgggcagaaagagctggagtgattggacaggagttgcccagg cttccctcctcagacttgcagctggctggctctatcctggtgtgctgtgc tctcataatcttcttctcaaagaggcagagccccagctgactattgatcc ccctcactttgtgggaatctaggacaaatgtacacacagaggccctcgtg cacaccatatctgtaaatatttaacaatgaaaatgaagcttgcaggctgt ttcttagcatatgcccatgagcatgccgtcctggtgatagggaaggccag gtatgaattttagatttcttttttctttttcttttttttaattccccaga gtttgtttcagtcaggaagcattgaagtactagagaagaggcttcccatt ttctttctgatgacaccaataaggggccttatgtgctaacaagtgtatcc taccccccagcccatcttgtttttgtcttgattctgctctcttggtccat tcctaccccccagccaagccctccccctgaacaacagaaaccttcaatgt tcaatcactcggaactttcttcccaaattaattccgtccaaagtttcttt ttgctcaacgagtt
quality values	Open. Hide. 31 11 62 62 54 62 62 62 62 62 62 47 62 62 62 62 62 62 62 44 51 47 39 62 62 62 62 62 62 49 38 46 51 56 29 49 56 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 59 62 54 54 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 54 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 49 58 58 58 58 58 58 54 58 58 58 58 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 52 58 58 58 58 58 41 58 58 58 58 58 58 58 58 58 41 49 45 58 58 58 58 58 58 58 58 58 48 58 49 25 58 38 6 5	Open. Hide. 62 47 36 36 62 62 62 62 62 62 62 62 62 56 39 22 38 38 38 49 38 46 56 62 62 59 43 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 59 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 54 62 62 62 62 56 54 62 62 62 62 62 56 56 56 36 46 56 56 62 49 54 47 62 62 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 56 62 62 47 38 62 62 62 62 50 62 54 62 62 56 62 62 62 62 62 62 62 48 62 62 62 62 62 62 62 62 62 62 62 62 62 42 47 47 62 62 62 62 62 41 62 62 62 49 43 62 62 62 62 62 62 54 62 58 58 58 58 58 54 52 58 54 58 35 58 58 50 58 58 58 54 58 58 58 54 58 41 54 58 58 58 58 58 58 58 54 42 41 58 58 52 58 52 58 34 58 41 54 40 52 54 52 41 44 40 54 54 54 58 43 54 52 49 58 58 36 54 54 54 52 54 58 54 52 52 52 54 54 52 58 52 58 58 46 29 27 26 54 39 54 52 41 28 32 37 51 49 50 51 50 52 52 46 50 42 58 40 43 45 32 51 50 49 50 52 52 48 48 58 49 50 46 50 41 42 41 52 51 50 58 42 45 42 46 58 51 38 40 49 58 50 37 47 42 40 42 42 58 41 49 29 36 53 46 53 50 27 39 53 50 46 37 30 7 21 29 53 53 50 58 50 47 50 51 31 24 39 37 39 33 39 52 23 50 22 17 32 22 54 15 51 27 28 50 44 43 39 52 39 53 50 40 14 19 30 37 37 40 22 58 51 39 49 30 50 21 43 27 37 54 39 50 42 31 32 50 10 58 54 6 6 18 49 32 54 42 37 30 49 51 49 44 32 22 10 52 44 44 18 30 32 54 54 54 54 54 52 27 12 25 29 26 29 54 50 46 18 14 37 13 25 33 38 51 35 54 32 35 23 20 35 37 20 8 36 13 32 9 19 9 9 14 14 46 34 14 20 24 22 26 32 32 51 14 34 27 15 51 23 26 9 13 9 19 13 22 26 18 46 46 23 6 6 52 8 9 27 29 14 6 16 31 20 11 23 19 22 10 8 32 13 33 40 37 32 26 33 25 11 20 28 42 32 31 15 9 11 33 16 23 31 18 32 42 31 21 25 31 17 7 31 33 29 31 18 17 31 30 31 31 45 30 21 31 9 12 17 32 33 46 51 51 21 31 25 30 30 23 28 14 9 27 6 12 28 19 31 9 8 7 6 19 23 42 30 42 10 12 30 33 14 16 15 25 9 46 46 46 46 18 14 24 7 21 12 7 11 27 37 26 15 14 30 25 20 9 12 13 19 6 7 9 18 13 7 5 10 25 31 29 33 15 19 11 6 7 7 8 8 7 29 6 11 25 11 25 14 19 14 5 8 14 11 24 7 36 25 21 9 15 31 38 17 18 32 29 8 44 13 17 23 14 31 14 22 32 21 13 30 33 17 10 9 38 19 9 6 17 30 12 18 9 10 7 11 7 6 10 5 25 10 14 16

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_12002048_12002584
seq2: B6Ng01-185N19.b_47_583 (reverse)

seq1  CCTCCTCCTTCACACACACATTCCAATTCCCCCTTTAAAGAGGGGGATGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCCTCCTTCACACACACATTCCAATTCCCCCTTTAAAGAGGGGGATGT  50

seq1  GATGAGTTCTCAGGTGTTATAAAGCTATTTATAACTTGGAGAAGGTAGAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAGTTCTCAGGTGTTATAAAGCTATTTATAACTTGGAGAAGGTAGAC  100

seq1  AGTAAAGTGATTTGCTTTAAAAGAGAACATTTACTTGTGAGGTGGGGGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTAAAGTGATTTGCTTTAAAAGAGAACATTTACTTGTGAGGTGGGGGCA  150

seq1  TGCTATGGTGCATGTGTGTGCAAGGTAAAGGACAACTTGCAGAAGTCAGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATGGTGCATGTGTGTGCAAGGTAAAGGACAACTTGCAGAAGTCAGC  200

seq1  TTCCATCTTGTGGGTTCTGGAGTTTGAACTTGGCTCATAAAGTCTTGGCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCATCTTGTGGGTTCTGGAGTTTGAACTTGGCTCATAAAGTCTTGGCA  250

seq1  GAAAGCATTCTTACACAGCAAGCCATCTTGTCAGCCCTACTATTATGATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGCATTCTTACACAGCAAGCCATCTTGTCAGCCCTACTATTATGATT  300

seq1  TGACTATCAAAGCCCTATCCACACACGATTATGTATTTGAACACTTGATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACTATCAAAGCCCTATCCACACACGATTATGTATTTGAACACTTGATT  350

seq1  CCCAGCTACTGGCACTGTTTGGAAAGAGTTTAGAATTCTATGGGACTGTG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAGCTACTGGCACTGTTTGGAAAGAGTTTAGAATTCTATGGGACTGTG  400

seq1  GCTTAGCCAGAAGCAGTGGGTCACAAGGGATGGGGCCTTGATGTTAAATC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTAGCCAGAAGCAGTGGGTCACAAGGGATGGGGCCTTGATGTTAAATC  450

seq1  TGTTTCTGGGTTCTAGCAGTTCTCTGCTGCCTGTCTGCTTCGGAGATGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTCTGGGTTCTAGCAGTTCTCTGCTGCCTGTCTGCTTCGGAGATGTG  500

seq1  AAGGGCCCTGGCCACAAGCTCCAGCTGCCTGGAATTC  537
      |||||||||||||||||||||||||||||||||||||
seq2  AAGGGCCCTGGCCACAAGCTCCAGCTGCCTGGAATTC  537

seq1: chrX_11859967_11861008
seq2: B6Ng01-185N19.g_69_1132

seq1  GAATTCTTCCTTCCCATCTGCCTGCCATGGTACCTGTCACATGCAGCACT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTCCTTCCCATCTGCCTGCCATGGTACCTGTCACATGCAGCACT  50

seq1  CTCCCAAGTGTAGCTGTGATGTGGAGCTGATGGTGGGCACTCACAGTTGG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCCAAGTGTAGCTGTGATGTGGAGCTGATGGTGGGCACTCACAGTTGG  100

seq1  CATACCCCCACCCACCTTCCACTGTGAGTGGTAGGTGCACCTATAACATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATACCCCCACCCACCTTCCACTGTGAGTGGTAGGTGCACCTATAACATG  150

seq1  CTTAATAGATGTCACCAGCAGGGATGCTACCTCAATATGCAACCTGACTT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTAATAGATGTCACCAGCAGGGATGCTACCTCAATATGCAACCTGACTT  200

seq1  TTAAAAAATATTGTATTTATAGTGTGTGTGTTCCAAGGACAATCAGCAGG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAAAAATATTGTATTTATAGTGTGTGTGTTCCAAGGACAATCAGCAGG  250

seq1  AGTTGGCTTTTTGTTTGTTTGTTTGTTTGTTTTTCCCTTTACCGTGTGGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTGGCTTTTTGTTTGTTTGTTTGTTTGTTTTTCCCTTTACCGTGTGGG  300

seq1  TCTTAAGGATCCAATTCGGGTCTTCAGGCTTAGCAGCAAGGGCCATTACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTAAGGATCCAATTCGGGTCTTCAGGCTTAGCAGCAAGGGCCATTACC  350

seq1  CACTCTCCAACTCTCTAGCCCACACAGCCTGTCTCTCAAAAGCCACACTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTCTCCAACTCTCTAGCCCACACAGCCTGTCTCTCAAAAGCCACACTC  400

seq1  CTGGTTCTTACTACTCCGAGGAACCCAGGCTTTCTACAACAGGCAGGAAG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTTCTTACTACTCCGAGGAACCCAGGCTTTCTACAACAGGCAGGAAG  450

seq1  GTACAACCTGGGCAGAAAGAGCTGGAGTGATTGGACAGGAGTTGCCCAGG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACAACCTGGGCAGAAAGAGCTGGAGTGATTGGACAGGAGTTGCCCAGG  500

seq1  CTTCCCTCCTCAGACTTGCAGCTGGCTGGCTCTATCCTGGTGTGCTGTGC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCCCTCCTCAGACTTGCAGCTGGCTGGCTCTATCCTGGTGTGCTGTGC  550

seq1  TCTCATAATCTTCTTCTCAAAGAGGCAGAGCCCCAGCTGACTATTGATCC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCATAATCTTCTTCTCAAAGAGGCAGAGCCCCAGCTGACTATTGATCC  600

seq1  CCCTCACTTTGTGGGAATCTAGGACAAATGTACACACAGAGGCCCTCGTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTCACTTTGTGGGAATCTAGGACAAATGTACACACAGAGGCCCTCGTG  650

seq1  CACACCATATCTGTAAATATTTAACAATGAAAATGAAGCTTGCAGGCTGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCATATCTGTAAATATTTAACAATGAAAATGAAGCTTGCAGGCTGT  700

seq1  TTCTTAGCATATGCCCATGAGCATGCCGTCCTGGTGATAGGGAAGGCCAG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTAGCATATGCCCATGAGCATGCCGTCCTGGTGATAGGGAAGGCCAG  750

seq1  GTATGAA-TTTAGATTTCTTTTTTC-TTTTCTTTTTTTTAATTCCCCAGA  798
      ||||||| ||||||||||||||||| ||||||||||||||||||||||||
seq2  GTATGAATTTTAGATTTCTTTTTTCTTTTTCTTTTTTTTAATTCCCCAGA  800

seq1  GTTTGTTTCAGTCAGG-AGCATTGAAGTACTAGAGAAGAGGC-TCCCATT  846
      |||||||||||||||| ||||||||||||||||||||||||| |||||||
seq2  GTTTGTTTCAGTCAGGAAGCATTGAAGTACTAGAGAAGAGGCTTCCCATT  850

seq1  TTTCTTCTGATGACACCAA-AAGGGGCCTTATGTGCTAACAAGTGTATCC  895
      ||  ||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TTCTTTCTGATGACACCAATAAGGGGCCTTATGTGCTAACAAGTGTATCC  900

seq1  CA-CCCCCAGCCCATC-TGTTTTTGTCTTGA-TCTGCTCTC-TGGTCCAT  941
       | ||||||||||||| |||||||||||||| ||||||||| ||||||||
seq2  TACCCCCCAGCCCATCTTGTTTTTGTCTTGATTCTGCTCTCTTGGTCCAT  950

seq1  T-CTA-CCCCCAGCC-AGCCCTCCCCCTG-ACAACAGAAACCT--CATG-  984
      | ||| ||||||||| ||||||||||||| |||||||||||||   ||| 
seq2  TCCTACCCCCCAGCCAAGCCCTCCCCCTGAACAACAGAAACCTTCAATGT  1000

seq1  TCCATCACTCGG-ACCTTCCTCCCAAATT-ATTCCGT-CAAAGTTTCTTT  1031
      || ||||||||| || ||| ||||||||| ||||||| ||||||||||||
seq2  TCAATCACTCGGAACTTTCTTCCCAAATTAATTCCGTCCAAAGTTTCTTT  1050

seq1  ---GTCCACGAGTT  1042
          || |||||||
seq2  TTGCTCAACGAGTT  1064

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information