MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-186A04
Chromosome	X (Build37)
Map Location	47,338,198 - 47,339,352
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100040295, Enox2, 1100001E04Rik, LOC100041697, Olfr1320, Olfr1321, Igsf1, Olfr1322, LOC100040344
Downstream gene	Olfr1323, EG665816, Olfr1324, LOC100041788, 6720401G13Rik, 2610018G03Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100040295 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Enox2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209224 MGI:2384799
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1100001E04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins pseudo : _no_value

name	Olfr1320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Olfr1322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr1323 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665816 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665816 MGI:3646089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 157 ESTs, 8 Proteins pseudo : _no_value

name	Olfr1324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258289 MGI:3031158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	6720401G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103012 MGI:2147989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2610018G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70415 MGI:1917665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040295 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271532 GeneID:100040295
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : similar to pol protein transcript_id : XM_001474449.1

name	Enox2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801702 GeneID:209224 MGI:2384799
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ecto-NOX disulfide-thiol exchanger 2 transcript_id : NM_145951.3

name	1100001E04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487452 GeneID:75404 MGI:1922654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1100001E04 gene transcript_id : NM_001081123.1

name	Olfr1320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529460 GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1320 transcript_id : NM_207240.2

name	Olfr1321 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421340 GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1321 transcript_id : NM_207631.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34330163 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177591.3

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281998 GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183336.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41282008 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183335.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343783 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177915.3

name	Olfr1322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801353 GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1322 transcript_id : NM_001011794.1

name	Olfr1323 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239073 GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1323 transcript_id : NM_146390.1

name	Olfr1324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129700 GeneID:258289 MGI:3031158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1324 transcript_id : NM_146292.1

name	6720401G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271534 GeneID:103012 MGI:2147989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6720401G13 gene transcript_id : XM_001474597.1

name	2610018G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526919 GeneID:70415 MGI:1917665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610018G03 gene transcript_id : NM_133729.1

name	LOC100040295 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271533 GeneID:100040295
definition	codon_start : 1 product : similar to pol protein protein_id : XP_001474499.1

name	Enox2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122383 CCDS:CCDS30115.1 GeneID:209224 MGI:2384799
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0015035 - protein disulfide oxidoreductase activity [Evidence ISS]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence ISS] [Evidence IEA]; GO:0001558 - regulation of cell growth [Evidence IEA]; GO:0048511 - rhythmic process [Evidence IEA]; GO:0006810 - transport [Evidence IEA]; GO:0007624 - ultradian rhythm [Evidence ISS] codon_start : 1 product : cytosolic ovarian carcinoma antigen 1 protein_id : NP_666063.1

name	1100001E04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487453 GeneID:75404 MGI:1922654
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : Novel RhoGAP domain containing protein product : hypothetical protein LOC75404 protein_id : NP_001074592.1

name	Olfr1320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529461 CCDS:CCDS30116.1 GeneID:236784 MGI:3031154
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2Q64A-11736563-11737522 product : olfactory receptor 1320 protein_id : NP_997123.2

name	Olfr1321 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421341 CCDS:CCDS30117.1 GeneID:236785 MGI:3031155
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11768161-11767223; GA_x5J8B7W1V10-1157-554 product : olfactory receptor 1321 protein_id : NP_997514.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330164 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : long isoform is encoded by transcript variant 1; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 long isoform protein_id : NP_808259.2

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281999 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 4 protein_id : NP_899179.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41282009 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 3 protein_id : NP_899178.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244558 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : short isoform is encoded by transcript variant 2; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 short isoform protein_id : NP_808583.1

name	Olfr1322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801354 CCDS:CCDS30118.1 GeneID:257978 MGI:3031156
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11927171-11926215; olfactory receptor MOR264-16P product : olfactory receptor 1322 protein_id : NP_001011794.1

name	Olfr1323 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239074 CCDS:CCDS30119.1 GeneID:258385 MGI:3031157
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12051754-12050825; olfactory receptor MOR216-1 product : olfactory receptor 1323 protein_id : NP_666502.1

name	Olfr1324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129701 CCDS:CCDS30120.1 GeneID:258289 MGI:3031158
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12454598-12453654; olfactory receptor MOR128-2 product : olfactory receptor 1324 protein_id : NP_666404.1

name	6720401G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271535 GeneID:103012 MGI:2147989
definition	codon_start : 1 product : hypothetical protein LOC103012 protein_id : XP_001474647.1

name	2610018G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526920 GeneID:70415 MGI:1917665
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS] codon_start : 1 note : Mst3 and SOK1-related kinase; novel protein containing a protein kinase domain product : serine/threonine protein kinase MST4 protein_id : NP_598490.1

name	LOC100040344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040344
definition	number : 1 pseudo : _no_value

name	LOC100041788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041788
definition	number : 1 pseudo : _no_value

name	LOC100041697 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271560 GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins product : hypothetical protein LOC100041697 pseudo : _no_value transcript_id : XR_032928.1

name	EG665816 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407360 GeneID:665816 MGI:3646089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 157 ESTs, 8 Proteins product : predicted gene, EG665816 pseudo : _no_value transcript_id : XR_001793.1

clone name	MSMg01-125O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046C15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-141P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-205F21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265D09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-099G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-306C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-172E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023G10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-008D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108O24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283O19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-033H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032H15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-186A04.b	B6Ng01-186A04.g
ACC	GA010968	GA010969
length	1,178	856
definition	B6Ng01-186A04.b	B6Ng01-186A04.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttaagccacaagttcttggtcctggaatgtgccaggcatgggct tcattttgtcacatgggaaataaatccattaagaaggtattggctgttct tataatattaatatcactgttgcacccatgggcatgtttttctatgtagg tcattattttatcttgtattgttcatggctgggtaagattagtggctgct tttctccttcggtagtgtcatgtgaaattcaaatttcaatttttaatttg gacctcaccaaagaattaaggaaagacctcttagaccaaaatggccaaga gatgatgggtcttttttagtttcactcacatattatattgatatttaaaa tttaatgaacataatgttatgatttgatatatgctatgcacacaaagtat agcaataaaattagcatagaaaagttcctatctatgaatatttttgtttt tgatatagaaaatgatttaaaatttataatatcacaaaaatacaccattg ctgttgatttaagcagttatattttagacttttaaaagtatagatgtatt tcaaggtcttagtttcttttctactagaatttaaaagaaaaagtacttta atgatatttaatatgttccagaacaaagaaaaaggaaagactcaaatgcc aaaactgagaaatcataattaattctttattattgccaataaaagatatc aaattaaatgctaacaaatagaggacttagccccattaaaagagaaaagt aaaccaaggtgataagtttcatgatggaaaaatttaaaagattaaatatt gggaaatggagcacagttttatcaaataaaatctgacaataatttcctta aataacattaattttataaaattttcaataaatatgattaatcaaaacag attgaaacagtgaaaaaatagtaaaattagaattttagaaaatctctatt atcctgtttactggttaagaccactgaagaaggtattaccaatgtcaagg aatgcagtcaatagggtctggtaatcacttctgacatttttgttatttgg ggtggcacctctagtataactaggaaaaagctagaagataaggatattta aatattggaaacataaaacggtttcattatccatgggacattgattacat tacctgtaagataatacgatgtgaacaa	gaattctgggtacccctgcatttggagcaaagatgttcagaattgagagt tcttcttggtagatttttccttagatgagtatgaagtgtccttccttatc gtttttgatgactttcgtttgaaagtcaattttctccaatattagaatgg ctactgcatcttgtttcttgggaccatttgcatggaaaattgtgttgaag cactttactctgaggaagtgtttgtctttgacactggggtgcttttccct tgtgcagcaaaatgttcctgtttgcatatccagtctgttaatgtcttttt attggagaattgagtccacttatattaagagagactaaggaatagagatt gttgctctctgttattattgatgttatttttgtttctgtggttctctttt actgggtttgttaaaagaagattactttcttgctttctgaagggtgtagt ttccttccatgtgttgttgttttccatcaatcatcctttgtagggctgga tatgtggaaagatattgtgtaaatttggttttatcatggaatgtcttggt ttctacctctatggtaattgacagttttgctgcatataatagtctgtgct gtcatttgtgttcctttagggtctgtatgagatctaagcagaatcttcta gcttttggagtctattgtgagaagtttggtgtaatttctgataggtctgc cttcatatgttacttgacctttttccctttaatgctttttaatattcttt gtttagtgcatttgatcttttgattatatgttccttttctggtccactgt atttggggttctgttgaccttcttgtatgttcatgggcaattctttcttt tgggtg
quality values	Open. Hide. 58 38 19 22 58 58 58 54 58 45 48 58 34 30 54 42 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 49 62 39 54 44 43 56 44 20 38 49 56 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 54 54 58 58 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 54 40 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 43 58 58 58 48 58 58 52 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 54 50 51 58 51 51 58 58 54 58 46 45 49 58 53 39 54 58 49 49 49 58 58 51 58 58 58 58 48 48 58 47 58 58 58 58 33 58 51 50 58 58 51 58 48 49 46 58 58 49 53 54 58 58 32 58 58 43 31 52 50 51 50 51 47 39 40 48 37 58 54 53 58 52 52 53 39 52 39 58 54 39 37 23 58 54 53 58 58 50 53 53 34 52 51 50 44 41 42 40 49 34 58 40 49 58 40 50 49 50 50 32 58 50 50 53 53 49 40 49 39 26 47 51 49 42 51 54 51 54 22 50 54 38 54 54 50 38 51 29 41 54 54 40 38 37 39 33 42 37 52 32 42 32 54 39 39 35 31 26 33 33 50 54 52 39 36 45 51 53 34 54 54 41 54 54 54 29 26 54 37 33 54 54 52 33 41 16 52 32 54 44 41 40 45 40 33 15 33 40 54 40 32 34 47 31 24 45 40 37 33 32 52 53 49 25 31 37 34 32 53 52 34 33 52 53 53 40 40 31 31 32 21 24 32 34 52 26 34 52 33 18 33 28 52 34 53 34 31 20 32 31 31 36 24 35 13 16 51 51 33 24 30 31 51 51 17 11 37 37 20 22 18 31 31 35 51 27 30 26 42 31 19 8 51 31 46 21 28 25 51 51 28 9 15 29 20 18 38 37 19 46 31 31 19 31 31 42 36 48 46 46 46 23 27 42 21 9 16 36 46 14 31 29 16 7 21 24 43 46 46 31 26 13 21 31 30 15 25 35 32 31 21 20 29 20 25 13 28 13 15 39 37 23 25 6 13 15 25 33 7 9 31 19 18 31 7 13 16 30 34 31 23 36 14 18 44 6 6 13 12 6 7 5 13 10 13 14 20 20 14 24 17 36 14 9 33 22 20 28 15 15 14 21 27 29 9 13 19 18 44 24 22 26 16 22 29 25 26 23 32 33 15 11 25 16 11 16 30 32 19 5 11 43 33 39 10 14 10 24 27 33 39 28 13 34 32 18 6 7 22 24 17 27 13 16 26 22 22 21 10 5 4 5 29 30 28 17 8 5 14 43 39 24 21 28 26 11 16 4 3 3 3 6 23 20 29 8 7 15 5 13 9 20 7 7 28 14 11 13 12 19 7 3 5 29 5 6 4 4 3 30 34 16 7 5 12 26 18 7 8 6 20 5 6 7 6 10 24 13 19 17 15 6 10 9 9 4 3 6 17 7 5 13 5 7 4 6 7 17 5 11 4 7 4 7 8 4 14 9 3 2 3 7 3 3 5 8 6 25 12 9 6 3	Open. Hide. 62 47 42 39 62 62 49 62 62 62 62 51 47 62 56 43 28 37 25 38 62 56 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 49 62 62 62 62 62 62 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 47 46 54 62 62 62 62 62 62 62 62 62 54 62 62 62 54 45 62 62 54 54 62 48 62 62 58 58 58 58 43 58 54 58 58 58 58 45 54 58 58 54 58 42 42 58 58 58 54 54 58 54 54 42 58 58 49 58 58 58 47 52 58 47 58 58 58 58 54 58 54 54 54 54 53 54 39 58 54 58 54 54 58 58 58 53 51 58 58 58 49 51 50 51 58 58 58 46 45 42 51 52 58 49 58 51 50 27 58 51 50 52 51 54 50 47 53 52 58 42 42 48 48 50 51 51 32 38 46 19 49 33 39 50 53 51 48 49 35 42 43 54 51 58 50 49 29 51 46 50 50 50 50 39 58 58 52 53 53 35 53 39 32 39 51 38 37 39 29 58 22 30 52 26 58 16 25 47 30 41 43 38 49 54 32 54 52 53 13 46 28 47 33 26 35 52 45 54 54 31 37 50 52 53 34 29 26 47 40 50 52 53 49 37 38 28 19 30 10 18 21 31 53 31 40 51 41 45 19 35 35 37 53 53 53 41 31 45 46 47 18 40 38 33 31 24 34 29 32 46 52 31 27 10 10 51 25 31 32 32 28 45 18 26 31 22 6 17 53 26 33 33 27 31 30 31 20 20 20 22 28 26 45 25 34 28 24 23 4 7 18 31 31 40 27 31 19 25 16 9 9 24 12 9 6 7 9 12 30 12 31 21 22 18 6 8 13 31 15 30 26 6 9 12 10 8 15 23 13 11 20 15 12 21 16 6 7 9 8 9 4 9 6 25 18

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_47338198_47339352
seq2: B6Ng01-186A04.b_44_1221

seq1  GAATTCTTAAGCCACAAGTTCTTGGTCCTGGAATGTGCCAGGCATGGGCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAAGCCACAAGTTCTTGGTCCTGGAATGTGCCAGGCATGGGCT  50

seq1  TCATTTTGTCACATGGGAAATAAATCCATTAAGAAGGTATTGGCTGTTCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTTTGTCACATGGGAAATAAATCCATTAAGAAGGTATTGGCTGTTCT  100

seq1  TATAATATTAATATCACTGTTGCACCCATGGGCATGTTTTTCTATGTAGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAATATTAATATCACTGTTGCACCCATGGGCATGTTTTTCTATGTAGG  150

seq1  TCATTATTTTATCTTGTATTGTTCATGGCTGGGTAAGATTAGTGGCTGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTATTTTATCTTGTATTGTTCATGGCTGGGTAAGATTAGTGGCTGCT  200

seq1  TTTCTCCTTCGGTAGTGTCATGTGAAATTCAAATTTCAATTTTTAATTTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCTCCTTCGGTAGTGTCATGTGAAATTCAAATTTCAATTTTTAATTTG  250

seq1  GACCTCACCAAAGAATTAAGGAAAGACCTCTTAGACCAAAATGGCCAAGA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCTCACCAAAGAATTAAGGAAAGACCTCTTAGACCAAAATGGCCAAGA  300

seq1  GATGATGGGTCTTTTTTAGTTTCACTCACATATTATATTGATATTTAAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGATGGGTCTTTTTTAGTTTCACTCACATATTATATTGATATTTAAAA  350

seq1  TTTAATGAACATAATGTTATGATTTGATATATGCTATGCACACAAAGTAT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAATGAACATAATGTTATGATTTGATATATGCTATGCACACAAAGTAT  400

seq1  AGCAATAAAATTAGCATAGAAAAGTTCCTATCTATGAATATTTTTGTTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAATAAAATTAGCATAGAAAAGTTCCTATCTATGAATATTTTTGTTTT  450

seq1  TGATATAGAAAATGATTTAAAATTTATAATATCACAAAAATACACCATTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATATAGAAAATGATTTAAAATTTATAATATCACAAAAATACACCATTG  500

seq1  CTGTTGATTTAAGCAGTTATATTTTAGACTTTTAAAAGTATAGATGTATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTGATTTAAGCAGTTATATTTTAGACTTTTAAAAGTATAGATGTATT  550

seq1  TCAAGGTCTTAGTTTCTTTTCTACTAGAATTTAAAAGAAAAAGTACTTTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAGGTCTTAGTTTCTTTTCTACTAGAATTTAAAAGAAAAAGTACTTTA  600

seq1  ATGATATTTAATATGTTCCAGAACAAAGAAAAAGGAAAGACTCAAATGCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATATTTAATATGTTCCAGAACAAAGAAAAAGGAAAGACTCAAATGCC  650

seq1  AAAACTGAGAAATCATAATTAATTCTTTATTATTGCCAATAAAAGATATC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACTGAGAAATCATAATTAATTCTTTATTATTGCCAATAAAAGATATC  700

seq1  AAATTAAATGCTAACAAATAGAGGACTTAGCCCCATTAAAAGAGAAAAGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTAAATGCTAACAAATAGAGGACTTAGCCCCATTAAAAGAGAAAAGT  750

seq1  AAACCAAGGTGATAAGTTTCATGATGGAAAAATTTAAAAGATTAAATATT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCAAGGTGATAAGTTTCATGATGGAAAAATTTAAAAGATTAAATATT  800

seq1  GGGAAATGGAGCACAGTTTTATCAAATAAAATCTGACAATAATTTCCTTA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGAAATGGAGCACAGTTTTATCAAATAAAATCTGACAATAATTTCCTTA  850

seq1  AATAACATTAATTTTATAAAA-TTTCAATAAATATGATTAATCAAAACAG  899
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  AATAACATTAATTTTATAAAATTTTCAATAAATATGATTAATCAAAACAG  900

seq1  ATTGAAACAGTGAAAAAATAGTAAAATTAGAATTTTAG-AAATCTCTATT  948
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  ATTGAAACAGTGAAAAAATAGTAAAATTAGAATTTTAGAAAATCTCTATT  950

seq1  ATCCTGTTTACTGG-TAAGA-CACTGAAGAA-GTA-TACCAATGTCAA-G  993
      |||||||||||||| ||||| |||||||||| ||| |||||||||||| |
seq2  ATCCTGTTTACTGGTTAAGACCACTGAAGAAGGTATTACCAATGTCAAGG  1000

seq1  AATGCAGTCAATA-GGTCT-GTAATCACTTCTGACA-TTTTGTTATTTGG  1040
      ||||||||||||| ||||| |||||||||||||||| |||||||||||||
seq2  AATGCAGTCAATAGGGTCTGGTAATCACTTCTGACATTTTTGTTATTTGG  1050

seq1  G--TGCA-CTCTAGTATAACTA-GAAAAAGCTAAGAAAATAAG---ATAT  1083
      |   ||| |||||||||||||| ||||||||| |||| |||||   || |
seq2  GGTGGCACCTCTAGTATAACTAGGAAAAAGCT-AGAAGATAAGGATATTT  1099

seq1  AAATATTGGAAACATTAAAACGTTTCATTATTCAT-GGACA-TGATTACA  1131
      ||||||||||||||| |||  |||||||||| ||| ||||| ||||||||
seq2  AAATATTGGAAACATAAAACGGTTTCATTATCCATGGGACATTGATTACA  1149

seq1  T--ACTGTAAGATAA---CAGTTGAACAA  1155
      |   |||||||||||    |  |||||||
seq2  TTACCTGTAAGATAATACGATGTGAACAA  1178

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information