MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-194C21
Chromosome	X (Build37)
Map Location	70,808,877 - 70,809,976
singlet/doublet	singlet
Overlap gene	Atp2b3
Upstream gene	Gabra3, Gabrq, Magea9, Cetn2, Nsdhl, Zfp185, Pnma5, LOC628237, Pnma3, Xlr4a, Xlr3a, Xlr5d, MGC106740, DXBay18, LOC627081, 4930408F14Rik, EG574437, Xlr4b, F8a, Xlr4c, Xlr3b, Xlr5c, EG434795, EG667187, LOC630169, Zfp275, Gm369, Zfp92, Trex2, Uchl5ip, Bgn
Downstream gene	LOC732481, Dusp9, Pnck, Slc6a8, Bcap31, Abcd1, Plxnb3, Srpk3, Idh3g, Ssr4, Pdzd4, L1cam, Avpr2, Arhgap4, Ard1, Renbp, Hcfc1, LOC100041206, LOC667264, Irak1, Mecp2, Opn1mw, LOC627455, Gm1538, LOC628388, Tktl1, Flna, Emd, LOC100041344, Rpl10, Snora70, Dnase1l1, Taz, B230340J04Rik, Atp6ap1, Gdi1, D0HXS9928E, Plxna3, Lage3, Ubl4, Slc10a3, 1810037C20Rik, G6pdx, Ikbkg, EG628456, LOC628465, LOC100041484, LOC674920
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gabra3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14396 MGI:95615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gabrq (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57249 MGI:1888498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:195772 MGI:1350986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cetn2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26370 MGI:1347085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nsdhl (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18194 MGI:1099438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zfp185 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22673 MGI:108095
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnma5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385377 MGI:2180566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 6 Proteins

name	LOC628237 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628237
definition	note : paraneoplastic antigen MA3 pseudogene pseudo : _no_value

name	Pnma3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245468 MGI:2180565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434794 MGI:3574098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr3a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22445 MGI:109506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr5d (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574438 MGI:3574110
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	MGC106740 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:574404
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	DXBay18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574405 MGI:99870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627081 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein

name	4930408F14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74851 MGI:1922101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins

name	EG574437 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:574437 MGI:3646893
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27083 MGI:1350975
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	F8a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14070 MGI:95474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr4c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72891 MGI:3574099
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr3b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22446 MGI:109505
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xlr5c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27084 MGI:1350981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434795 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434795 MGI:3645127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 11 Proteins

name	EG667187 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667187 MGI:3646445
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC630169 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:630169
definition	note : paraneoplastic antigen MA3 pseudogene pseudo : _no_value

name	Zfp275 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27081 MGI:1350985
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm369 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236856 MGI:2685215
definition	gene_synonym : Gm1810 note : gene model 369, (NCBI) pseudo : _no_value

name	Zfp92 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22754 MGI:108094
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Trex2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24102 MGI:1346343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Uchl5ip (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73738 MGI:1920988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Bgn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12111 MGI:88158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp2b3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320707 MGI:1347353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC732481 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:732481
definition	note : Fam58a pseudogene pseudo : _no_value

name	Dusp9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75590 MGI:2387107
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pnck (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93843 MGI:1347357
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc6a8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102857 MGI:2147834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bcap31 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27061 MGI:1350933
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Abcd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11666 MGI:1349215
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plxnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:140571 MGI:2154240
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Srpk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56504 MGI:1891338
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Idh3g (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15929 MGI:1099463
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssr4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20832 MGI:1099464
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzd4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245469 MGI:2443483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	L1cam (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16728 MGI:96721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Avpr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12000 MGI:88123
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171207 MGI:2159577
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ard1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56292 MGI:1915255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Renbp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19703 MGI:105940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hcfc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15161 MGI:105942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041206 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs

name	LOC667264 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 7 Proteins pseudo : _no_value

name	Irak1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16179 MGI:107420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mecp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17257 MGI:99918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Opn1mw (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14539 MGI:1097692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627455 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 7 Proteins pseudo : _no_value

name	Gm1538 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385380 MGI:2686384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	LOC628388 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628388
definition	note : 60S ribosomal protein L3 pseudogene pseudo : _no_value

name	Tktl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83553 MGI:1933244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Flna (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:192176 MGI:95556
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Emd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13726 MGI:108117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 333 ESTs, 6 Proteins pseudo : _no_value

name	Rpl10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110954 MGI:105943
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snora70 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104368 MGI:2148178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dnase1l1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69537 MGI:109628
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taz (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66826 MGI:109626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230340J04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320703 MGI:2444570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atp6ap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54411 MGI:109629
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdi1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14567 MGI:99846
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	D0HXS9928E (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108160 MGI:1351626
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Plxna3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18846 MGI:107683
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lage3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66192 MGI:1913442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ubl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:27643 MGI:95049
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc10a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214601 MGI:95048
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1810037C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66294 MGI:1913544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	G6pdx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14381 MGI:105979
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ikbkg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16151 MGI:1338074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	EG628456 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628456 MGI:3644285
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC628465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041484 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 11 Proteins

name	LOC674920 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674920
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gabra3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382325 GeneID:14396 MGI:95615
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-A) receptor, subunit alpha 3 transcript_id : NM_008067.3

name	Gabrq (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10048421 GeneID:57249 MGI:1888498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gamma-aminobutyric acid (GABA-A) receptor, subunit theta transcript_id : NM_020488.1

name	Magea9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32469504 GeneID:195772 MGI:1350986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family A, 9 transcript_id : NM_181855.1

name	Cetn2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368991 GeneID:26370 MGI:1347085
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centrin 2 transcript_id : NM_019405.6

name	Nsdhl (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982436 GeneID:18194 MGI:1099438
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : NAD(P) dependent steroid dehydrogenase-like transcript_id : NM_010941.3

name	Zfp185 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31544060 GeneID:22673 MGI:108095
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 185 transcript_id : NM_009549.2

name	Pnma5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271693 GeneID:385377 MGI:2180566
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 6 ESTs, 6 Proteins product : paraneoplastic antigen family 5 transcript_id : XM_001474772.1

name	Pnma3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346627 GeneID:245468 MGI:2180565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : paraneoplastic antigen MA3 transcript_id : NM_153169.1

name	Xlr4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032322 GeneID:434794 MGI:3574098
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 4A transcript_id : NM_001081642.1

name	Xlr3a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756016 GeneID:22445 MGI:109506
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 3A transcript_id : NM_011726.1

name	Xlr5d (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865916 GeneID:574438 MGI:3574110
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 5D transcript_id : NM_001045539.1

name	MGC106740 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:85701573 GeneID:574404
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC574404 transcript_id : NM_001025383.1

name	DXBay18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373043 GeneID:574405 MGI:99870
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, Chr X, Baylor 18 transcript_id : NM_001025384.2

name	LOC627081 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271695 GeneID:627081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 ESTs, 1 Protein product : X-linked lymphocyte-regulated 5-like, transcript variant 1 transcript_id : XM_890434.3

name	LOC627081 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407513 GeneID:627081
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 1 Protein product : X-linked lymphocyte-regulated 5-like, transcript variant 2 transcript_id : XM_899015.2

name	4930408F14Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407538 GeneID:74851 MGI:1922101
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : RIKEN cDNA 4930408F14 gene transcript_id : XM_356334.3

name	EG574437 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126032308 GeneID:574437 MGI:3646893
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG574437 transcript_id : NM_001081643.1

name	Xlr4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226210 GeneID:27083 MGI:1350975
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 4B transcript_id : NM_021365.2

name	F8a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801707 GeneID:14070 MGI:95474
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : factor 8-associated gene A transcript_id : NM_007978.3

name	Xlr4c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144226239 GeneID:72891 MGI:3574099
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 4C transcript_id : NM_183094.3

name	Xlr3b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6756018 GeneID:22446 MGI:109505
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 3B transcript_id : NM_011727.1

name	Xlr5c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13994145 GeneID:27084 MGI:1350981
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X-linked lymphocyte-regulated 5C transcript_id : NM_031493.1

name	EG434795 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407540 GeneID:434795 MGI:3645127
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 11 Proteins product : predicted gene, EG434795 transcript_id : XM_486706.3

name	Zfp275 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13928679 GeneID:27081 MGI:1350985
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 275 transcript_id : NM_031494.1

name	Zfp92 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144446020 GeneID:22754 MGI:108094
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 92 transcript_id : NM_009566.3

name	Trex2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47458830 GeneID:24102 MGI:1346343
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : three prime repair exonuclease 2 transcript_id : NM_011907.3

name	Uchl5ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47458822 GeneID:73738 MGI:1920988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UCHL5 interacting protein transcript_id : NM_207104.1

name	Uchl5ip (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47458821 GeneID:73738 MGI:1920988
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : UCHL5 interacting protein transcript_id : NM_028633.2

name	Bgn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475819 GeneID:12111 MGI:88158
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : biglycan transcript_id : NM_007542.3

name	Atp2b3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56699477 GeneID:320707 MGI:1347353
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, Ca++ transporting, plasma membrane 3 transcript_id : NM_177236.3

name	Dusp9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:32567764 GeneID:75590 MGI:2387107
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dual specificity phosphatase 9 transcript_id : NM_029352.3

name	Pnck (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31340562 GeneID:93843 MGI:1347357
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pregnancy upregulated non-ubiquitously expressed CaM kinase transcript_id : NM_012040.2

name	Slc6a8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19527207 GeneID:102857 MGI:2147834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 6 (neurotransmitter transporter, creatine), member 8 transcript_id : NM_133987.1

name	Bcap31 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802464 GeneID:27061 MGI:1350933
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : B-cell receptor-associated protein 31 transcript_id : NM_012060.3

name	Abcd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6671496 GeneID:11666 MGI:1349215
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATP-binding cassette, sub-family D (ALD), member 1 transcript_id : NM_007435.1

name	Plxnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347784 GeneID:140571 MGI:2154240
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin B3 transcript_id : NM_019587.2

name	Srpk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790110 GeneID:56504 MGI:1891338
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : serine/arginine-rich protein specific kinase 3 transcript_id : NM_019684.1

name	Idh3g (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680344 GeneID:15929 MGI:1099463
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : isocitrate dehydrogenase 3 (NAD+), gamma transcript_id : NM_008323.1

name	Ssr4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802821 GeneID:20832 MGI:1099464
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : signal sequence receptor, delta transcript_id : NM_009279.2

name	Pdzd4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71274175 GeneID:245469 MGI:2443483
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 4 transcript_id : NM_001029868.1

name	L1cam (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:112293278 GeneID:16728 MGI:96721
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : L1 cell adhesion molecule transcript_id : NM_008478.3

name	Avpr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506412 GeneID:12000 MGI:88123
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arginine vasopressin receptor 2 transcript_id : NM_019404.1

name	Arhgap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20137011 GeneID:171207 MGI:2159577
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rho GTPase activating protein 4 transcript_id : NM_138630.1

name	Ard1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:57528431 GeneID:56292 MGI:1915255
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : N-acetyltransferase ARD1 homolog (S. cerevisiae) transcript_id : NM_019870.2

name	Renbp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51871122 GeneID:19703 MGI:105940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : renin binding protein transcript_id : NM_023132.2

name	Hcfc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130908 GeneID:15161 MGI:105942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : host cell factor C1 transcript_id : NM_008224.3

name	LOC100041206 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271709 GeneID:100041206
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 12 ESTs product : hypothetical protein LOC100041206 transcript_id : XM_001476066.1

name	Irak1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:117606336 GeneID:16179 MGI:107420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin-1 receptor-associated kinase 1 transcript_id : NM_008363.2

name	Mecp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517468 GeneID:17257 MGI:99918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl CpG binding protein 2 transcript_id : NM_001081979.1

name	Mecp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126517481 GeneID:17257 MGI:99918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : methyl CpG binding protein 2 transcript_id : NM_010788.3

name	Opn1mw (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87299640 GeneID:14539 MGI:1097692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) transcript_id : NM_008106.2

name	Gm1538 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:38086417 GeneID:385380 MGI:2686384
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : gene model 1538, (NCBI) transcript_id : XM_358216.1

name	Tktl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347420 GeneID:83553 MGI:1933244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transketolase-like 1 transcript_id : NM_031379.2

name	Flna (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347375 GeneID:192176 MGI:95556
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : filamin, alpha transcript_id : NM_010227.2

name	Emd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131088 GeneID:13726 MGI:108117
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : emerin transcript_id : NM_007927.2

name	Rpl10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372532 GeneID:110954 MGI:105943
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein 10 transcript_id : NM_052835.2

name	Dnase1l1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21312311 GeneID:69537 MGI:109628
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : deoxyribonuclease 1-like 1 transcript_id : NM_027109.1

name	Taz (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802002 GeneID:66826 MGI:109626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tafazzin transcript_id : NM_181516.3

name	B230340J04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343133 GeneID:320703 MGI:2444570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230340J04 gene transcript_id : NM_177234.2

name	Atp6ap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378425 GeneID:54411 MGI:109629
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, H+ transporting, lysosomal accessory protein 1 transcript_id : NM_018794.3

name	Gdi1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803051 GeneID:14567 MGI:99846
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanosine diphosphate (GDP) dissociation inhibitor 1 transcript_id : NM_010273.2

name	D0HXS9928E (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801249 GeneID:108160 MGI:1351626
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DNA segment, human DXS9928E transcript_id : NM_138607.2

name	Plxna3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286838 GeneID:18846 MGI:107683
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plexin A3 transcript_id : NM_008883.2

name	Lage3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349821 GeneID:66192 MGI:1913442
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : L antigen family, member 3 transcript_id : NM_025410.2

name	Ubl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703809 GeneID:27643 MGI:95049
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin-like 4 transcript_id : NM_145405.1

name	Slc10a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21703811 GeneID:214601 MGI:95048
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 10 (sodium/bile acid cotransporter family), member 3 transcript_id : NM_145406.1

name	1810037C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:48976070 GeneID:66294 MGI:1913544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1810037C20 gene transcript_id : NM_025473.2

name	G6pdx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50053914 GeneID:14381 MGI:105979
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glucose-6-phosphate dehydrogenase X-linked transcript_id : NM_008062.2

name	Ikbkg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351396 GeneID:16151 MGI:1338074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of kappaB kinase gamma transcript_id : NM_178590.3

name	Ikbkg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754315 GeneID:16151 MGI:1338074
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inhibitor of kappaB kinase gamma transcript_id : NM_010547.1

name	EG628456 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271696 GeneID:628456 MGI:3644285
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628456 transcript_id : XM_893204.3

name	LOC100041484 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271726 GeneID:100041484
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 70 ESTs, 11 Proteins product : similar to UBE2D3 transcript_id : XM_001476705.1

name	Gabrq (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10048422 CCDS:CCDS30188.1 GeneID:57249 MGI:1888498
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0004890 - GABA-A receptor activity [Evidence ISS] [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence ISS]; GO:0007214 - gamma-aminobutyric acid signaling pathway [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : gamma-aminobutyric acid (GABA) A receptor, theta; gamma-aminobutyric acid (GABA-A) receptor, theta product : gamma-aminobutyric acid (GABA-A) receptor, subunit theta protein_id : NP_065234.1

name	Magea9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32469505 CCDS:CCDS30189.1 GeneID:195772 MGI:1350986
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : melanoma antigen family A, 9 protein_id : NP_862903.1

name	Cetn2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10257421 GeneID:26370 MGI:1347085
definition	GO_component : GO:0005814 - centriole [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007067 - mitosis [Evidence IEA] codon_start : 1 note : caltractin, 20 kDa calcium binding protein product : centrin 2 protein_id : NP_062278.2

name	Nsdhl (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982437 CCDS:CCDS30190.1 GeneID:18194 MGI:1099438
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003854 - 3-beta-hydroxy-delta5-steroid dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0004769 - steroid delta-isomerase activity [Evidence IEA]; GO:0047012 - sterol-4-alpha-carboxylate 3-dehydrogenase (decarboxylating) activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0008203 - cholesterol metabolism [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence IEA] codon_start : 1 note : striated; bare patches product : NAD(P) dependent steroid dehydrogenase-like protein_id : NP_035071.3

name	Zfp185 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31544061 CCDS:CCDS30191.1 GeneID:22673 MGI:108095
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : zinc finger protein 185 protein_id : NP_033575.2

name	Pnma5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271694 GeneID:385377 MGI:2180566
definition	codon_start : 1 product : similar to paraneoplastic antigen family 5 protein_id : XP_001474822.1

name	Pnma3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346628 CCDS:CCDS30192.1 GeneID:245468 MGI:2180565
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : paraneoplastic antigen MA3 protein_id : NP_694809.1

name	Xlr4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032323 GeneID:434794 MGI:3574098
definition	codon_start : 1 product : X-linked lymphocyte-regulated 4A protein_id : NP_001075111.1

name	Xlr3a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756017 GeneID:22445 MGI:109506
definition	codon_start : 1 note : X-linked B-cell surface antigen 3a; X-linked lymphocyte regulated 3 product : X-linked lymphocyte-regulated 3a protein_id : NP_035856.1

name	Xlr5d (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865917 CCDS:CCDS30194.1 GeneID:574438 MGI:3574110
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : X-linked lymphocyte-regulated 5D protein_id : NP_001039004.1

name	MGC106740 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:85701574 GeneID:574404
definition	codon_start : 1 product : hypothetical protein LOC574404 protein_id : NP_001020554.1

name	DXBay18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701580 GeneID:574405 MGI:99870
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC574405 protein_id : NP_001020555.1

name	LOC627081 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83001386 GeneID:627081
definition	codon_start : 1 product : hypothetical protein LOC627081 isoform 1 protein_id : XP_895527.1

name	LOC627081 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:83001388 GeneID:627081
definition	codon_start : 1 product : hypothetical protein LOC627081 isoform 2 protein_id : XP_904108.1

name	4930408F14Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086399 GeneID:74851 MGI:1922101
definition	codon_start : 1 product : hypothetical protein LOC74851 protein_id : XP_356334.1

name	EG574437 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126032309 GeneID:574437 MGI:3646893
definition	codon_start : 1 note : X-linked lymphocyte regulated product : hypothetical protein LOC574437 protein_id : NP_001075112.1

name	Xlr4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226211 GeneID:27083 MGI:1350975
definition	codon_start : 1 note : X-linked lymphocyte regulated gene 4 product : X-linked lymphocyte-regulated 4B protein_id : NP_067340.2

name	F8a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83921576 GeneID:14070 MGI:95474
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 note : Factor VIII associated protein product : factor 8-associated gene A protein_id : NP_032004.2

name	Xlr4c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144226240 GeneID:72891 MGI:3574099
definition	codon_start : 1 product : X-linked lymphocyte-regulated 4C protein_id : NP_898917.2

name	Xlr3b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6756019 CCDS:CCDS30197.1 GeneID:22446 MGI:109505
definition	codon_start : 1 exception : mismatches in translation note : X-linked B-cell surface antigen 3b product : X-linked lymphocyte-regulated 3b protein_id : NP_035857.1

name	Xlr5c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13994146 CCDS:CCDS30198.1 GeneID:27084 MGI:1350981
definition	codon_start : 1 product : X-linked lymphocyte-regulated 5C protein_id : NP_113681.1

name	EG434795 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772110 GeneID:434795 MGI:3645127
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486706.1

name	Zfp275 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13928680 CCDS:CCDS30199.1 GeneID:27081 MGI:1350985
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : Zinc finger protein 275 protein_id : NP_113682.1

name	Zfp92 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370221 CCDS:CCDS30200.1 GeneID:22754 MGI:108094
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger protein 92 protein_id : NP_033592.2

name	Trex2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755877 CCDS:CCDS30201.1 GeneID:24102 MGI:1346343
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0008853 - exodeoxyribonuclease III activity [Evidence IEA]; GO:0004527 - exonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : three prime repair exonuclease 2 protein_id : NP_036037.1

name	Uchl5ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47458823 CCDS:CCDS30203.1 GeneID:73738 MGI:1920988
definition	GO_function : GO:0031996 - thioesterase binding [Evidence ISS] GO_process : GO:0042177 - negative regulation of protein catabolism [Evidence ISS]; GO:0043161 - proteasomal ubiquitin-dependent protein catabolism [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; UCH37-interacting protein 1 product : UCH37-interacting protein 1 isoform 2 protein_id : NP_996987.1

name	Uchl5ip (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094997 CCDS:CCDS30202.1 GeneID:73738 MGI:1920988
definition	GO_function : GO:0031996 - thioesterase binding [Evidence ISS] GO_process : GO:0042177 - negative regulation of protein catabolism [Evidence ISS]; GO:0043161 - proteasomal ubiquitin-dependent protein catabolism [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; UCH37-interacting protein 1 product : UCH37-interacting protein 1 isoform 1 protein_id : NP_082909.1

name	Bgn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20137008 CCDS:CCDS30204.1 GeneID:12111 MGI:88158
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA] GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : biglycan protein_id : NP_031568.2

name	Atp2b3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56699478 CCDS:CCDS30205.1 GeneID:320707 MGI:1347353
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005388 - calcium-transporting ATPase activity [Evidence IEA]; GO:0003824 - catalytic activity [Evidence IEA]; GO:0016820 - hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006816 - calcium ion transport [Evidence IEA]; GO:0006812 - cation transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : plasma membrane calcium ATPase 3 protein_id : NP_796210.2

name	Dusp9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:32567765 CCDS:CCDS30206.1 GeneID:75590 MGI:2387107
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0017017 - MAP kinase phosphatase activity [Evidence IDA] GO_process : GO:0000188 - inactivation of MAPK activity [Evidence IDA]; GO:0006470 - protein amino acid dephosphorylation [Evidence IEA] codon_start : 1 note : dual-specificity MAP kinase phosphatase 4 product : dual specificity phosphatase 9 protein_id : NP_083628.3

name	Pnck (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753248 CCDS:CCDS30207.1 GeneID:93843 MGI:1347357
definition	GO_component : GO:0005954 - calcium- and calmodulin-dependent protein kinase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 note : calcium/calmodulin-dependent protein kinase 1, beta product : pregnancy upregulated non-ubiquitously expressed CaM kinase protein_id : NP_036170.1

name	Slc6a8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527208 CCDS:CCDS30208.1 GeneID:102857 MGI:2147834
definition	GO_function : GO:0005308 - creatine transporter activity [Evidence ISS]; GO:0031402 - sodium ion binding [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015881 - creatine transport [Evidence ISS]; GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA] codon_start : 1 note : creatine transporter; creatine transporter, solute carrier family 6, member 8 product : solute carrier family 6 (neurotransmitter transporter, creatine), member 8 protein_id : NP_598748.1

name	Bcap31 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981310 CCDS:CCDS30209.1 GeneID:27061 MGI:1350933
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IPI] GO_function : GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006888 - ER to Golgi vesicle-mediated transport [Evidence IEA]; GO:0006955 - immune response [Evidence IPI]; GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : accessory protein BAP31 product : B-cell receptor-associated protein 31 protein_id : NP_036190.2

name	Abcd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671497 CCDS:CCDS30210.1 GeneID:11666 MGI:1349215
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016887 - ATPase activity [Evidence IEA]; GO:0042626 - ATPase activity, coupled to transmembrane movement of substances [Evidence IEA]; GO:0017111 - nucleoside-triphosphatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : adrenoleukodystrophy protein; X-linked adrenoleukodystrophy (ALD) gene homolog product : ATP-binding cassette, sub-family D, member 1 protein_id : NP_031461.1

name	Plxnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347785 GeneID:140571 MGI:2154240
definition	codon_start : 1 note : plexin 6 product : plexin B3 protein_id : NP_062533.2

name	Srpk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790111 CCDS:CCDS30211.1 GeneID:56504 MGI:1891338
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007519 - striated muscle development [Evidence IMP] codon_start : 1 note : muscle-specific serine kinase 1; serine/threonine kinase 23, muscle-specific serine kinase 1 70 product : serine/threonine kinase 23 protein_id : NP_062658.1

name	Idh3g (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680345 CCDS:CCDS30212.1 GeneID:15929 MGI:1099463
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004449 - isocitrate dehydrogenase (NAD+) activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0016652 - oxidoreductase activity, acting on NADH or NADPH, NAD or NADP as acceptor [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0006099 - tricarboxylic acid cycle [Evidence IEA] codon_start : 1 note : isocitrate dehydrogenase 3 NAD+, gamma product : isocitrate dehydrogenase 3 (NAD+), gamma protein_id : NP_032349.1

name	Ssr4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678145 CCDS:CCDS30213.1 GeneID:20832 MGI:1099464
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : signal sequence receptor, delta protein_id : NP_033305.1

name	Pdzd4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274176 CCDS:CCDS30214.1 GeneID:245469 MGI:2443483
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : PDZ domain containing 4 protein_id : NP_001025039.1

name	L1cam (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:112293279 CCDS:CCDS30215.1 GeneID:16728 MGI:96721
definition	GO_component : GO:0009986 - cell surface [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA]; GO:0042734 - presynaptic membrane [Evidence IDA]; GO:0043195 - terminal button [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007411 - axon guidance [Evidence IMP]; GO:0007155 - cell adhesion [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0007399 - nervous system development [Evidence IEA] codon_start : 1 product : L1 cell adhesion molecule protein_id : NP_032504.3

name	Avpr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506413 CCDS:CCDS30216.1 GeneID:12000 MGI:88123
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : nephrogenic diabetes insipidus product : arginine vasopressin receptor 2 protein_id : NP_062277.1

name	Arhgap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20137012 GeneID:171207 MGI:2159577
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005096 - GTPase activator activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0003743 - translation initiation factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0051301 - cell division [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : GTPase-activating protein p115 product : Rho GTPase activating protein 4 protein_id : NP_619536.1

name	Ard1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845236 CCDS:CCDS30217.1 GeneID:56292 MGI:1915255
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0008080 - N-acetyltransferase activity [Evidence IDA]; GO:0004596 - peptide alpha-N-acetyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : N-terminal acetyltransferase complex ARD1 subunit homolog product : N-acetyltransferase ARD1 protein_id : NP_063923.1

name	Renbp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51871123 GeneID:19703 MGI:105940
definition	EC_number : 5.1.3.8 GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0004476 - mannose-6-phosphate isomerase activity [Evidence IEA]; GO:0050121 - N-acylglucosamine 2-epimerase activity [Evidence IMP]; GO:0005515 - protein binding [Evidence TAS] GO_process : GO:0006013 - mannose metabolism [Evidence IEA]; GO:0006044 - N-acetylglucosamine metabolism [Evidence IMP] codon_start : 1 note : N-acylglucosamine 2-epimerase; N-acetyl-D-glucosamine 2-epimerase; renin-binding protein product : renin binding protein protein_id : NP_075621.2

name	Hcfc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328130 CCDS:CCDS30218.1 GeneID:15161 MGI:105942
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003713 - transcription coactivator activity [Evidence TAS] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0019046 - reactivation of latent virus [Evidence IDA]; GO:0000074 - regulation of progression through cell cycle [Evidence TAS] codon_start : 1 note : VP16-accessory protein product : host cell factor C1 protein_id : NP_032250.2

name	LOC100041206 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271710 GeneID:100041206
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476116.1

name	Irak1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:117606337 CCDS:CCDS30219.1 GeneID:16179 MGI:107420
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0005149 - interleukin-1 receptor binding [Evidence IPI]; GO:0016301 - kinase activity [Evidence IDA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence ISS]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0019221 - cytokine and chemokine mediated signaling pathway [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] codon_start : 1 note : pelle-like product : interleukin-1 receptor-associated kinase 1 protein_id : NP_032389.2

name	Mecp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126517469 GeneID:17257 MGI:99918
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008327 - methyl-CpG binding [Evidence IDA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0035197 - siRNA binding [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence TAS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0042551 - neuron maturation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0050884 - regulation of posture [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : methyl CpG binding protein 2 isoform 1 protein_id : NP_001075448.1

name	Mecp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149645 GeneID:17257 MGI:99918
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0000792 - heterochromatin [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0008327 - methyl-CpG binding [Evidence IDA]; GO:0003729 - mRNA binding [Evidence IDA]; GO:0035197 - siRNA binding [Evidence IDA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0008344 - adult locomotory behavior [Evidence IMP]; GO:0016358 - dendrite development [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence TAS]; GO:0045892 - negative regulation of transcription, DNA-dependent [Evidence IDA]; GO:0042551 - neuron maturation [Evidence IMP]; GO:0008284 - positive regulation of cell proliferation [Evidence IMP]; GO:0050884 - regulation of posture [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0007585 - respiratory gaseous exchange [Evidence IMP]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : methyl CpG binding protein 2 isoform 2 protein_id : NP_034918.1

name	Opn1mw (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679975 CCDS:CCDS30220.1 GeneID:14539 MGI:1097692
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0001750 - photoreceptor outer segment [Evidence IDA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007602 - phototransduction [Evidence IEA]; GO:0018298 - protein-chromophore linkage [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : green cone pigment; green LWS cone opsin; green LWS photopigment; green long wavelength sensitive cone opsin; M opsin; MWS opsin; Green opsin; Midwavelength sensitive opsin; opsin 1, medium-wave-sensitive product : opsin 1 (cone pigments), medium-wave-sensitive (color blindness, deutan) protein_id : NP_032132.1

name	Gm1538 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086418 GeneID:385380 MGI:2686384
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358216.1

name	Tktl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347421 CCDS:CCDS30221.1 GeneID:83553 MGI:1933244
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : transketolase-like 1 protein_id : NP_113556.2

name	Flna (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347376 GeneID:192176 MGI:95556
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0005080 - protein kinase C binding [Evidence IDA] GO_process : GO:0045022 - early endosome to late endosome transport [Evidence IDA] codon_start : 1 note : filamin A; actin-binding protein 280; GENA 379; dilated pupils 2 product : filamin, alpha protein_id : NP_034357.2

name	Emd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679641 CCDS:CCDS30222.1 GeneID:13726 MGI:108117
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IEA]; GO:0005637 - nuclear inner membrane [Evidence TAS]; GO:0005652 - nuclear lamina [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : emerin protein_id : NP_031953.1

name	Rpl10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16418339 GeneID:110954 MGI:105943
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] codon_start : 1 note : 24.6 kDa protein; 24.6kDa protein product : ribosomal protein 10 protein_id : NP_443067.1

name	Dnase1l1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312312 CCDS:CCDS30223.1 GeneID:69537 MGI:109628
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA] GO_function : GO:0004536 - deoxyribonuclease activity [Evidence IEA]; GO:0004519 - endonuclease activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004518 - nuclease activity [Evidence IEA] GO_process : GO:0006308 - DNA catabolism [Evidence IEA] codon_start : 1 note : DNase X product : deoxyribonuclease 1-like 1 protein_id : NP_081385.1

name	Taz (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31442416 CCDS:CCDS30224.1 GeneID:66826 MGI:109626
definition	GO_component : GO:0005739 - mitochondrion [Evidence ISS] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008152 - metabolism [Evidence IEA]; GO:0046471 - phosphatidylglycerol metabolism [Evidence ISS] codon_start : 1 product : tafazzin protein_id : NP_852657.1

name	B230340J04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893279 GeneID:320703 MGI:2444570
definition	codon_start : 1 product : hypothetical protein LOC320703 protein_id : NP_796208.1

name	Atp6ap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055172 CCDS:CCDS30226.1 GeneID:54411 MGI:109629
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0016469 - proton-transporting two-sector ATPase complex [Evidence IEA]; GO:0005773 - vacuole [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0046933 - hydrogen-transporting ATP synthase activity, rotational mechanism [Evidence IEA]; GO:0046961 - hydrogen-transporting ATPase activity, rotational mechanism [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006754 - ATP biosynthesis [Evidence IEA]; GO:0015986 - ATP synthesis coupled proton transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1; ATPase, H+ transporting, lysosomal interacting protein 1; V-ATPase subunit Ac45; vacuolar H+ ATPase accessory subunit 1 product : ATPase, H+ transporting, lysosomal accessory protein 1 protein_id : NP_061264.1

name	Gdi1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859560 CCDS:CCDS30227.1 GeneID:14567 MGI:99846
definition	GO_function : GO:0005096 - GTPase activator activity [Evidence IEA] GO_process : GO:0043087 - regulation of GTPase activity [Evidence IEA] codon_start : 1 note : Rab GDIalpha product : guanosine diphosphate (GDP) dissociation inhibitor 1 protein_id : NP_034403.1

name	D0HXS9928E (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070432 GeneID:108160 MGI:1351626
definition	codon_start : 1 exception : mismatches in translation product : DNA segment, human DXS9928E protein_id : NP_613073.1

name	Plxna3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286839 CCDS:CCDS30228.1 GeneID:18846 MGI:107683
definition	codon_start : 1 note : plexin 3 product : plexin A3 protein_id : NP_032909.2

name	Lage3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13384798 CCDS:CCDS30229.1 GeneID:66192 MGI:1913442
definition	codon_start : 1 product : Eso3 protein protein_id : NP_079686.1

name	Ubl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703810 CCDS:CCDS30230.1 GeneID:27643 MGI:95049
definition	GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : ubiquitin-like protein GDX; housekeeping protein DXS254E product : ubiquitin-like 4 protein_id : NP_663380.1

name	Slc10a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21703812 CCDS:CCDS30231.1 GeneID:214601 MGI:95048
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008508 - bile acid:sodium symporter activity [Evidence IEA]; GO:0015293 - symporter activity [Evidence IEA] GO_process : GO:0015711 - organic anion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : solute carrier family 10, member 3 product : protein P3 protein_id : NP_663381.1

name	1810037C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313538 GeneID:66294 MGI:1913544
definition	codon_start : 1 product : family 3, member A protein protein_id : NP_079749.1

name	G6pdx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996917 CCDS:CCDS30232.1 GeneID:14381 MGI:105979
definition	GO_function : GO:0004345 - glucose-6-phosphate 1-dehydrogenase activity [Evidence IDA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006006 - glucose metabolism [Evidence IEA]; GO:0006749 - glutathione metabolism [Evidence IMP] codon_start : 1 product : glucose-6-phosphate dehydrogenase X-linked protein_id : NP_032088.1

name	Ikbkg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754316 GeneID:16151 MGI:1338074
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence IDA]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1; inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma product : inhibitor of kappaB kinase gamma isoform 1 protein_id : NP_034677.1

name	Ikbkg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30519887 CCDS:CCDS30233.1 GeneID:16151 MGI:1338074
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0007250 - activation of NF-kappaB-inducing kinase [Evidence IDA]; GO:0001782 - B cell homeostasis [Evidence IMP]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase gamma product : inhibitor of kappaB kinase gamma isoform 2 protein_id : NP_848705.1

name	EG628456 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271697 GeneID:628456 MGI:3644285
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898297.3

name	LOC100041484 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271727 GeneID:100041484
definition	codon_start : 1 product : similar to UBE2D3 protein_id : XP_001476755.1

name	EG667187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667187
definition	number : 1 pseudo : _no_value

name	EG667187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667187
definition	number : 2 pseudo : _no_value

name	LOC628465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628465
definition	number : 1 pseudo : _no_value

name	LOC628465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628465
definition	number : 2 pseudo : _no_value

name	LOC628465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:628465
definition	number : 3 pseudo : _no_value

name	LOC674920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674920
definition	number : 1 pseudo : _no_value

name	LOC674920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674920
definition	number : 2 pseudo : _no_value

name	LOC674920 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674920
definition	number : 3 pseudo : _no_value

name	LOC667264 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271692 GeneID:667264
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 49 ESTs, 7 Proteins product : similar to Mapre1 protein pseudo : _no_value transcript_id : XR_032127.1

name	LOC627455 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271712 GeneID:627455
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 22 ESTs, 7 Proteins product : similar to heterogeneous nuclear ribonucleoprotein A3 pseudo : _no_value transcript_id : XR_032643.1

name	LOC100041344 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271716 GeneID:100041344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 333 ESTs, 6 Proteins product : similar to suppressor of initiator codon mutations, related sequence 1 pseudo : _no_value transcript_id : XR_032790.1

name	Snora70 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604685 GeneID:104368 MGI:2148178
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, H/ACA box 70 transcript_id : NR_002899.1

clone name	MSMg01-098P15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-520J24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152N12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-511I03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512B09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-154G23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-151H21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-333M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124I14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-483G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-421G15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-124L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-306N24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-195K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440E07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-144H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-055M21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-496K01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-184A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-360A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368M22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043J07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-195A03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049P10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116D08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297O09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-287E15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186P04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106I06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-021I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-096B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-121E03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-194C21.b	B6Ng01-194C21.g
ACC	GA016946	GA016947
length	991	1,090
definition	B6Ng01-194C21.b	B6Ng01-194C21.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcacccccaaagagcctgccatttgcaaccattgcacagcaggccc ccacgaggaaagtcagcttaattgttcatgtgtttgttgtgtggttggtg gtttttcaagaccgagacagggtttctctgtgagactgagacagggttaa gtagctcttcctgtctgggaactcattctgaagaccaggctggccttgaa ctcagagatctgcctgcctctgcctccagagtgctggaattaaacgtgtg caccaccacctggcatctatgtatatttttgtgtgtaatctcaggccctt atatctaagagagcaatcagaccattgaaagcacgtggagcccctaaaga tgaatggataagggaaacaaatgatattggttctcaggactataactcca atatcatagggcaaattgtagctagaaatatcaggaagcaaaatgctcaa tgttttcattgtggtaaatttgggatttccaaaagaattataagactaaa agattcagagctcaaaataacaggtacattgactctagtaattgtagaag agaacaagtaggttctggttactatgagccacaaagggttccaggctaat tgtagcttctgtggaaaggccaaacagtggtgatggattgctggtccaag agagacagatgaggtaaccgcttgccatcatgaaatgaacagagggacct gtcagctcaaggccccacagcaaaaaaatatgagccattttcctttggtc agtcaggaagtaccaaccaagcaagaaattatgttttgctggggcatata agtgaaaggatattttgctaaagtagacacgtgaaagaatgtttcgctga agcagacatagggaaaggatgttttgccataaccaacatgtgaaaggatg cgtgaaggagtataaatctgaccccacagacagtgggagttagagcattg atttgcttggcctgccttgatattcctttgtaacaacattc	gaattcttttgtgtctctttcccatgggagcacacagacaaacccttgcc cctctgtagccaagcaccaaaagctcactctggggaccctttcatttcaa gcagcagtgaagcccagcccatccttcaggcagctggagtgggcctctat actcgaatgtttactgtctcagtagttgaagataagatgccttctgactg acgcaggccagcaaagatttgagcaccatatcgccagaggggcttcttcc aggttctgatggagaatttggaaaccactggccacagcagttgcctcatt tgaaagggattttgcaacacagaaacctttcacccccattgaggggaggg agctagaccacaccaggtgaacccctgcagctttgccagagtccagcaag gcatgctcatcatgtttccacaccttgacaaggagctggcacacagtctt aagtttgatccattctcaagaagttaatcaatgctgagccacatcaccct acttgggtttctagggagagtatattggcaatctttttgttgttgctgtt tgacaagtgtgcacactggctccacactaggaaagacatcaattgtctag ttggggctctgccataccctttctagaactacaggctaaaacccagggaa acaagcttccaagaaatccctaaacaaaatgcaaccctggtctgaggccc tgcaggtaggtgcagtgagtactgccgtatgggcagcagctgagagcttg tggaatttattcaagccttccctaccctcaccactgctgcagctggcctt ggctgctaggagggcaaggcaataggtagttcccatggtcctgcttctcc tcacttcccacacttactgggccagaatgccaaggcacctgacagatccc ttttctcaagaagattttgaactagtggttgtaaagagagaaagaatccg atgagccttagtacaggagtatgggcagcccactagcttacagcctctgc aggcatgccagtaagttttttctctagcaagaatagaagagaagtgtcag gcattatctactgttgtttttggctattggtgatcaagac
quality values	Open. Hide. 49 31 27 33 62 31 20 62 62 62 62 36 39 62 62 62 62 62 62 62 62 62 62 44 42 62 62 62 62 59 62 62 62 59 46 62 49 49 54 54 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 59 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 49 54 54 62 59 59 59 59 59 59 62 62 59 59 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 49 43 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 54 42 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 42 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 54 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 42 58 46 58 58 58 58 54 58 58 52 58 52 58 54 53 52 58 58 58 58 58 58 48 58 58 58 58 58 54 49 50 42 54 54 58 58 58 52 58 54 52 54 39 54 58 53 58 36 39 54 46 38 39 53 58 54 46 46 45 42 58 58 52 51 50 58 58 58 54 58 58 46 58 58 50 49 47 49 58 26 45 39 58 58 49 47 53 53 46 46 52 58 45 36 58 58 28 24 58 58 50 50 58 46 50 51 51 50 50 51 58 32 58 46 39 32 46 45 44 31 43 38 17 58 37 50 50 50 58 53 53 58 50 51 37 50 38 51 39 50 50 51 51 58 49 50 47 42 58 40 39 39 36 26 54 54 38 25 43 50 58 40 50 52 30 49 49 39 27 46 52 58 14 51 50 50 18 31 49 37 52 37 51 54 54 54 54 53 42 39 35 50 52 37 40 40 41 53 54 54 37 40 47 34 49 47 49 50 26 39 32 51 25 45 22 9 35 19 27 35 42 33 42 32 38 23 31 51 38 44 32 33 12 32 44 51 54 39 31 44 32 32 53 32 54 54 40 45 27 39 34 54 54 42 35 32 32 23 23 21 16 9 19 31 31 53 35 12 35 31 23 30 24 47 40 28 32 35 32 28 52 40 33 23 31 25 32 26 22 45 31 30 31 34 52 25 22 22 23 21 45 26 51 31 26 29 31 41 30 30 33 29 31 30 7 30 19 18 42 28 18 51 29 19 46 32 32 32 31 18 45 25 51 51 30 32 22 41 15 32 11 37 16 13 46 46 23 24 36 34 31 31 35 46 24 6 18 25 31 31 31 23 36 42 36 26 8 8 44 7 16 26 30 31 44 30 31 36 36 31 31 19 25 29 30 24 30 24 30 31 14 8 15 36 42 47 29 25 14 18 11 21 25 19 13 31 11 8 29 31 32 27 44 25 29 19 30 24 8 17 31 14 25 26 32 20 25 23 37 30 19 31 24 24 7 14 33 48 9 10 29 8 22 23 22 37 32 27 16 33 26	Open. Hide. 62 47 62 47 62 62 62 62 62 62 43 59 59 62 62 62 43 54 62 62 62 62 59 49 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 54 54 62 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 39 58 58 54 58 58 58 58 54 58 58 49 58 58 58 58 54 58 58 58 58 58 54 54 54 58 54 58 58 58 47 58 52 54 54 54 58 54 58 58 58 58 54 58 58 58 58 58 58 58 58 58 53 58 58 54 58 58 49 58 58 58 58 58 58 58 37 50 58 58 53 58 58 58 52 49 51 49 46 58 58 58 58 50 51 49 37 51 51 51 51 58 52 58 38 49 58 52 53 32 52 47 42 37 58 54 58 58 52 53 53 51 52 53 54 58 58 58 51 36 54 41 53 53 51 46 27 53 46 46 41 38 48 58 52 53 50 53 53 58 58 39 52 32 50 39 35 58 40 58 32 58 58 51 50 58 58 52 50 58 49 46 58 39 52 35 46 50 50 58 39 49 41 30 54 41 58 58 50 52 43 54 34 22 37 54 54 44 39 54 54 50 40 51 31 38 51 44 42 54 52 49 49 34 42 49 51 51 23 32 10 42 54 37 53 42 45 25 54 33 39 26 51 37 53 37 42 45 26 46 42 37 40 32 33 42 47 31 54 41 28 45 33 37 54 51 35 34 42 45 43 39 53 43 32 51 20 38 26 42 31 31 34 32 47 33 48 45 24 53 40 39 25 35 32 30 33 34 30 51 45 34 29 49 37 34 34 29 51 46 37 31 39 31 34 31 32 26 33 31 42 31 31 29 29 32 30 31 51 29 30 25 29 30 43 28 31 31 29 29 25 17 30 46 13 47 31 26 33 21 32 31 18 33 46 35 32 23 25 20 30 20 33 33 32 46 31 29 25 31 31 12 41 42 31 38 35 31 27 31 31 29 30 27 31 29 27 30 31 31 48 31 29 28 31 36 38 30 20 22 30 41 48 33 27 21 31 26 31 25 19 37 15 24 10 12 25 32 23 22 26 31 36 37 34 23 31 22 37 32 21 48 25 10 47 44 27 28 15 31 21 30 23 32 25 21 29 18 48 44 26 10 21 25 33 32 32 21 27 21 25 25 6 17 4 17 47 26 20 48 9 25 4 33 48 26 13 33 27 34 14 31 16 31 24 22 43 22 33 16 15 16 33 17 16 34 6 5 5 5 29 7 26 14 16 19 40 21 14 18 15 15 34 22 18 19 18 6 7 8 18 15 9 18 24 11 19 8 14 11 7 16 5 11 11 6 27 8 13 18 15 16 24 7 13 4 9 6 18 30 47 29 32 6 5 5 9 7 25 6 5 3 5 14 6 15 7 4 5 24 23 7 24 10 23 14 18 5 14 16 23 16 10 24 10 23 23 13 15 6 18 9 14 17 5 16 9 16 6 3 17 30 30 25 5 7 21 9 6 4 5 6 3 3 5 2 3 7 9 6 7 14 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_70808877_70809976
seq2: B6Ng01-194C21.g_63_1152

seq1  GAATTCTTTTGTGTCTCTTTCCCATGGGAGCACACAGACAAACCCTTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTTGTGTCTCTTTCCCATGGGAGCACACAGACAAACCCTTGCC  50

seq1  CCTCTGTAGCCAAGCACCAAAAGCTCACTCTGGGGACCCTTTCATTTCAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTGTAGCCAAGCACCAAAAGCTCACTCTGGGGACCCTTTCATTTCAA  100

seq1  GCAGCAGTGAAGCCCAGCCCATCCTTCAGGCAGCTGGAGTGGGCCTCTAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCAGTGAAGCCCAGCCCATCCTTCAGGCAGCTGGAGTGGGCCTCTAT  150

seq1  ACTCGAATGTTTACTGTCTCAGTAGTTGAAGATAAGATGCCTTCTGACTG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCGAATGTTTACTGTCTCAGTAGTTGAAGATAAGATGCCTTCTGACTG  200

seq1  ACGCAGGCCAGCAAAGATTTGAGCACCATATCGCCAGAGGGGCTTCTTCC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCAGGCCAGCAAAGATTTGAGCACCATATCGCCAGAGGGGCTTCTTCC  250

seq1  AGGTTCTGATGGAGAATTTGGAAACCACTGGCCACAGCAGTTGCCTCATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTCTGATGGAGAATTTGGAAACCACTGGCCACAGCAGTTGCCTCATT  300

seq1  TGAAAGGGATTTTGCAACACAGAAACCTTTCACCCCCATTGAGGGGAGGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAGGGATTTTGCAACACAGAAACCTTTCACCCCCATTGAGGGGAGGG  350

seq1  AGCTAGACCACACCAGGTGAACCCCTGCAGCTTTGCCAGAGTCCAGCAAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTAGACCACACCAGGTGAACCCCTGCAGCTTTGCCAGAGTCCAGCAAG  400

seq1  GCATGCTCATCATGTTTCCACACCTTGACAAGGAGCTGGCACACAGTCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGCTCATCATGTTTCCACACCTTGACAAGGAGCTGGCACACAGTCTT  450

seq1  AAGTTTGATCCATTCTCAAGAAGTTAATCAATGCTGAGCCACATCACCCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTTGATCCATTCTCAAGAAGTTAATCAATGCTGAGCCACATCACCCT  500

seq1  ACTTGGGTTTCTAGGGAGAGTATATTGGCAATCTTTTTGTTGTTGCTGTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGGGTTTCTAGGGAGAGTATATTGGCAATCTTTTTGTTGTTGCTGTT  550

seq1  TGACAAGTGTGCACACTGGCTCCACACTAGGAAAGACATCAATTGTCTAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACAAGTGTGCACACTGGCTCCACACTAGGAAAGACATCAATTGTCTAG  600

seq1  TTGGGGCTCTGCCATACCCTTTCTAGAACTACAGGCTAAAACCCAGGGAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGGGCTCTGCCATACCCTTTCTAGAACTACAGGCTAAAACCCAGGGAA  650

seq1  ACAAGCTTCCAAGAAATCCCTAAACAAAATGCAACCCTGGTCTGAGGCCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGCTTCCAAGAAATCCCTAAACAAAATGCAACCCTGGTCTGAGGCCC  700

seq1  TGCAGGTAGGTGCAGTGAGTACTGCCGTATGGGCAGCAGCTGAGAGCTTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCAGGTAGGTGCAGTGAGTACTGCCGTATGGGCAGCAGCTGAGAGCTTG  750

seq1  TGGAATTTATTCAAGCCTTCCCTACCCTCACCACTGCTGCAGCTGGCCTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAATTTATTCAAGCCTTCCCTACCCTCACCACTGCTGCAGCTGGCCTT  800

seq1  GGCTGCTAGGAGGGCAAGGCAATAGGTAGTTCCCATGGTCCTGCTTCTCC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTGCTAGGAGGGCAAGGCAATAGGTAGTTCCCATGGTCCTGCTTCTCC  850

seq1  TCACTTCCCACACTTACTGGGCCAGAATGCCAAGGCACCTGACAGATCCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTTCCCACACTTACTGGGCCAGAATGCCAAGGCACCTGACAGATCCC  900

seq1  TTTTCTCAAGAAGATTTTGAACTAGTGGTTGGTAAAGAGAAGAAAGAATC  950
      |||||||||||||||||||||||||||||| |||||||| ||||||||||
seq2  TTTTCTCAAGAAGATTTTGAACTAGTGGTT-GTAAAGAG-AGAAAGAATC  948

seq1  CGATGAGCCTTAGTAACAGAGTATGGGCAAGCCCACTAGGCTTACAGCCT  1000
      |||||||||||||||   |||||||||| ||||||||| |||||||||||
seq2  CGATGAGCCTTAGTACAGGAGTATGGGC-AGCCCACTA-GCTTACAGCCT  996

seq1  CTGGCAGCCATGGCCAGTTAAGTTTTTCTCTAGCCAAAGAATTAGAAGAG  1050
      || |||| ||| |||||| |  ||||||||||||  ||||| ||||||||
seq2  CT-GCAGGCAT-GCCAGTAAGTTTTTTCTCTAGC--AAGAA-TAGAAGAG  1041

seq1  AAGGTGTCAGGCATTATCTACTGTTGTTTTTTGCTATTGTGGTTCAAGAC  1100
      || |||||||||||||||||||||||||||| |||||||  | |||||||
seq2  AA-GTGTCAGGCATTATCTACTGTTGTTTTTGGCTATTGGTGATCAAGAC  1090

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information