MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-199K22
Chromosome	X (Build37)
Map Location	119,967,776 - 119,968,908
singlet/doublet	singlet
Overlap gene	none
Upstream gene	EG245575, LOC100039544, Nap1l3
Downstream gene	3110007F17Rik, LOC100039751, LOC100039763, LOC665281, EG625591, LOC665325, EG382265
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG245575 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245575 MGI:3647043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 13 Proteins

name	LOC100039544 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins pseudo : _no_value

name	Nap1l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54561 MGI:1859565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	3110007F17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73061 MGI:1920311
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039751 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 160 ESTs, 5 Proteins pseudo : _no_value

name	LOC100039763 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	LOC665281 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 145 ESTs, 5 Proteins pseudo : _no_value

name	EG625591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625591 MGI:3644765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	LOC665325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 107 ESTs, 5 Proteins pseudo : _no_value

name	EG382265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382265 MGI:3645501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	EG245575 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272153 GeneID:245575 MGI:3647043
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 13 Proteins product : predicted gene, EG245575 transcript_id : XM_142100.7

name	Nap1l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20270268 GeneID:54561 MGI:1859565
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome assembly protein 1-like 3 transcript_id : NM_138742.1

name	3110007F17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110625949 GeneID:73061 MGI:1920311
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3110007F17 gene transcript_id : NM_028426.1

name	LOC100039763 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272163 GeneID:100039763
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : similar to RIKEN cDNA 3110007F17 gene transcript_id : XM_001473145.1

name	EG625591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408138 GeneID:625591 MGI:3644765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : predicted gene, EG625591 transcript_id : XM_621081.3

name	EG382265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408141 GeneID:382265 MGI:3645501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : predicted gene, EG382265 transcript_id : XM_356374.4

name	EG245575 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272154 GeneID:245575 MGI:3647043
definition	codon_start : 1 product : similar to RIKEN cDNA 9230105E10 gene protein_id : XP_142100.7

name	Nap1l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270269 CCDS:CCDS30372.1 GeneID:54561 MGI:1859565
definition	codon_start : 1 product : nucleosome assembly protein 1-like 3 protein_id : NP_620081.1

name	3110007F17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110625950 GeneID:73061 MGI:1920311
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA] codon_start : 1 product : hypothetical protein LOC73061 protein_id : NP_082702.1

name	LOC100039763 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272164 GeneID:100039763
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_001473195.1

name	EG625591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63748758 GeneID:625591 MGI:3644765
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_621081.1

name	EG382265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38087252 GeneID:382265 MGI:3645501
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_356374.1

name	LOC100039544 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272157 GeneID:100039544
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 8 Proteins product : similar to SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 3 pseudo : _no_value transcript_id : XR_031017.1

name	LOC100039751 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272162 GeneID:100039751
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 160 ESTs, 5 Proteins product : similar to 40S ribosomal protein S12 pseudo : _no_value transcript_id : XR_031048.1

name	LOC665281 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272165 GeneID:665281
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 145 ESTs, 5 Proteins product : similar to 40S ribosomal protein S12 pseudo : _no_value transcript_id : XR_031065.1

name	LOC665325 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272166 GeneID:665325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 107 ESTs, 5 Proteins product : similar to 40S ribosomal protein S12 pseudo : _no_value transcript_id : XR_031083.1

clone name	MSMg01-455F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-052P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-463L02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-105F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395C19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-461B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471N06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-390E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-365I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097P01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-074L03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-343O10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-442H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-371G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-361N19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368K24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366H16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-472B08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-177J21
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-086O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244J18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102P07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-020K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193H07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047I18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348A24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-199K22.b	B6Ng01-199K22.g
ACC	GA020953	GA020954
length	1,086	1,138
definition	B6Ng01-199K22.b	B6Ng01-199K22.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctttgttcagctctgagccccaatttttaatggggttatttaatt tttctggagtccaccttcttgagttctttatatatattggatattagtcc cctatctgatttaggataagtatagatcctttcccaatctgttgatggcc tttttgtcttattgacggtgtcttttgccttatagaagctttgcagtttc atgaggtcccatttgtcaattctcgatcttacagcacaagccattgctgt tctattcaggaatttttcccctgtgcccatattatcgaggcttttcccca ctttctccactataagtttcagtgtgtctggttttatgtggagttccttg atccacttagatttgaccttagtacaacgagttaggaatggatcaattcc cattcttctacatgataaacaccacttgtgtcagcaccatttgttgaaaa tgctgtctttcttccactggatggttttatctccctttgaagatcaagta accataggtgtgtgggttcatttctgggtcttcaattctattccattggt ctacttgtctttcaatatacaagtaccatgcagttttttatcacaattgt tctgtagtaaagcttttggtcaggcatggtgattccaccagaggttcttt tatccttgagaagagtttttgctatcttaggtttttttttttttattcca tatgaatttgcagattgatcttgctaatttcttgaacaactgagttggaa ttttgatggggattgcattgaatgtgaagcattgctattggcaagatagc caatttcacagtcttgatccctggcaatccatgagcccggagattcttac atcttctggagactttcattcctgttctccgagacgtgaagttcttataa ctacagatctttcatttccttactcagaggttacaccaaggatatttttg tattatttgtggagtcatggaacaaggctggttgctttcgcctaattctg tccacgactggtctcatgtctaggggacgaaagggacgattgacttggat tgcccgttattttatattcccagattgccttcatct	gaattccactggtcatatcaggagactaatggagaaaacaaagaggaagg agcagtcaagactatgtgacatcctgtctatgagaataaaaatgttttca gttctaccatttctaaaatattataggagaaaacaatgacagctttctag aacacaaataactttaaatccaggctagggataactatgtacaaacgtac tgcattgatcttgatcccaggagtcagaaatcccaagatactctgactat aattttataagccaaggctttctagatattacacaaaagcctcaaaatct agatctggcagtccagggtcatttccccactttattagacatggccttca aggtttttaatgactagtatgagacctcaaaaacataagggcaaagtgaa caggaaataggaaacacataagagaaagggcagtcagtacacagctgcat caatggccatttcttacttatctcagaaaatcctagagcaccatctagtg accacaggcttcattctcagaaaactatttcagcctcagtttgaatgagt ttcttctgttgtcatttcagttccagacatttttagctgggcatgtccag gaatcctagactatgaacatctttacagcaatgtcgaataaagtgaagat tcatggggaatgagaatgttccttttacctataagaggaaagttaagagc tatccaaggactgcatgttaagtacaaatgtgaaaatcatcaaataccct taatttttccctatactactacttgcccaagaaggaaaaagttctcttct aaagacttacataaccttaagctttatacaggcttgagtacttcctatat ctatgggatgagccaaagtaaacctagatatggaaatgagcaaattcaag gttttttttttatccacatattttacacatataatttaccaccctgagga gatataatgaataggctatctcttttctatagggaccacaacaaccaaaa atacgtgacataaaattgactagagggacccagtgactttatctgggttt acttaaaaagcataggtggggggtcatttattagaaaaggttctatcaat gccattagcctcttcctaagttaatagcctttgtccac
quality values	Open. Hide. 58 29 25 23 58 33 28 21 33 37 22 22 22 10 18 35 33 32 42 27 35 18 25 27 24 43 21 25 24 30 27 23 21 27 22 25 41 31 39 39 22 30 31 42 34 18 20 26 26 30 32 26 32 35 32 51 51 39 22 22 34 34 24 34 41 39 43 45 32 30 39 41 30 34 34 43 39 43 41 24 24 18 24 34 34 24 30 24 43 30 43 39 34 43 41 46 39 45 51 51 43 43 31 34 34 41 34 43 51 45 50 28 27 19 39 43 30 30 34 18 19 34 30 24 19 34 41 34 34 24 30 23 30 30 41 30 30 34 41 34 34 19 18 25 24 23 45 43 30 39 34 34 34 34 34 43 24 34 30 30 41 30 30 37 34 34 24 38 25 39 30 34 24 30 30 34 39 26 43 24 30 24 24 24 13 41 39 18 41 30 24 24 24 24 24 30 30 45 39 30 18 24 30 34 18 39 18 30 39 39 43 41 41 43 49 34 30 24 34 30 41 39 24 30 18 30 41 41 39 43 23 43 34 24 41 24 43 30 24 26 30 24 30 43 34 45 30 43 51 34 27 39 30 30 34 41 34 17 18 45 43 34 36 34 30 30 34 34 34 34 34 24 39 18 41 32 43 41 30 43 30 34 34 41 30 34 24 27 27 27 24 33 34 41 43 39 43 34 34 24 34 34 26 30 34 23 34 32 26 30 20 30 24 30 41 30 34 43 43 39 43 14 18 34 19 26 16 32 32 42 51 25 32 29 32 32 24 38 24 32 29 42 29 29 26 32 32 32 28 37 32 35 35 39 25 32 32 26 26 15 37 27 27 22 26 35 32 30 26 22 28 17 25 26 35 25 25 31 27 56 56 51 31 51 24 51 51 32 26 38 27 39 39 39 51 26 31 29 25 23 21 29 37 32 33 23 38 33 33 33 34 25 32 33 42 26 42 38 38 42 32 42 33 27 30 30 38 56 42 42 23 42 26 15 33 34 43 39 25 33 32 23 33 26 23 30 33 42 30 38 27 33 38 35 46 26 43 22 26 23 22 20 23 23 19 13 16 14 22 13 42 22 30 28 15 29 21 21 30 27 32 26 28 38 38 28 38 62 38 35 27 15 43 27 21 20 14 14 20 26 27 25 33 30 32 33 15 31 21 37 31 39 31 42 35 32 16 17 21 15 18 23 27 35 33 39 52 21 17 42 30 23 42 31 27 26 30 35 30 32 27 32 27 22 24 28 27 37 23 32 52 52 52 43 52 48 52 27 32 25 22 28 30 33 22 22 27 22 27 32 37 25 25 27 42 33 27 27 27 27 16 18 11 11 27 21 21 15 16 24 13 19 19 28 22 12 17 13 37 16 27 27 27 27 15 25 13 26 24 23 32 24 35 33 27 15 27 32 26 21 29 27 11 26 21 15 24 31 23 18 31 39 29 30 19 17 15 24 19 12 12 23 13 21 19 19 32 34 21 21 20 17 29 19 16 13 15 21 22 10 31 27 13 37 19 17 24 11 13 10 19 21 19 18 16 21 11 25 19 6 24 11 11 17 15 21 13 18 16 7 7 18 35 32 21 15 10 13 9 9 6 33 10 14 26 22 20 23 18 20 31 16 11 35 15 15 29 22 32 26 30 23 33 18 10 30 30 34 25 13 18 9 13 24 30 19 13 30 23 20 15 19 26 23 28 16 25 12 15 17 27 13 19 7 35 31 34 33 19 9 7 33 24 16 24 17 7 12 12 9 13 15 7 14 9 16 12 21 14 6 32 21 12 25 8 6 13 6 12 14 7 13 11 19 7 15 14 20 6 9 14 16 13 19 21 13 40 33 18 11 6 14 18 20 14 7 9 16 7 10 6 6 16 13 18 12 15 20 15 10 19 10 13 9 5 9 11 11 12 11 5 5 9 9 15 10 10 16 6 27 9 9 11 15 17 30 11 12 19 12 18 12 11 19 31 32 7 25 13 27 14 24 20 15 25 7 11 13 15 14 5 11 18 28 12 6 9 19 19 27 15 19 12 23 7 7 18 7 7 11 6 21 14 42 20 13 16 27 11 11 19 13 12 14 6 13 16 18 11 6 22 10 12 23 21 10 6 9 6 7 17 19 7 5 11 17 27 18 23 16 17 10 27 10 21 17 16 17 18 26 16 26 13 13 18 25 9 8 8 13 29 13 13 6 19 7 9 14 10 7 6 22 7 8 5 13 19 13 9 5 5 6 27 31 6 9 16 6 11 8 8 8 8 13 10 10 5 5 5 9 21 6 13 6 7 5 4 4 7 8 15 17 7 15 9 12 5 5 4 8 5 9 12 43 34 10 17 4 5 4 19 8 4 13 8 6 13 5 9 27 17 10 30 7 10 11 7 5 7 11 17 25 10 15 8 10 7 7 11 7 8 9 11 25 3 7 7 6 5 28 6 9 5 11 12 7 11 10 7 5 11 12 15 11 5 5	Open. Hide. 62 47 43 42 62 42 37 25 33 33 35 23 14 15 10 25 16 26 24 17 10 32 22 20 24 20 24 14 15 22 51 26 20 13 30 24 19 24 30 30 24 39 43 41 30 41 39 30 19 56 43 30 34 30 24 41 41 24 30 18 39 30 30 30 30 34 23 34 39 43 30 43 43 45 41 46 25 34 30 45 43 43 44 26 44 51 51 41 45 39 34 34 26 45 24 24 30 30 41 41 43 30 41 43 34 34 41 41 24 34 39 34 43 39 34 43 34 43 43 56 51 43 44 39 43 34 51 50 31 50 43 43 43 41 30 34 31 43 39 45 30 39 43 45 41 41 43 34 34 34 51 43 43 41 41 34 34 43 34 30 34 34 41 30 27 24 30 23 34 30 43 30 39 43 41 43 45 43 56 51 46 43 43 45 45 43 43 34 43 23 23 34 24 45 43 51 41 34 41 51 43 59 43 43 51 45 47 43 51 43 34 34 45 43 43 51 51 51 39 41 39 44 39 41 43 41 30 59 43 43 41 41 41 41 30 34 38 59 51 51 51 51 50 49 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 46 46 56 62 62 49 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 46 58 58 58 51 54 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 58 58 52 58 58 58 51 58 58 58 58 58 58 58 52 58 48 54 58 54 58 58 58 58 58 54 58 46 46 49 49 58 51 58 58 51 58 58 54 50 51 58 58 58 51 51 52 58 58 47 47 48 58 53 51 58 58 48 47 48 54 58 58 51 53 53 58 58 54 58 58 54 40 58 58 40 58 58 50 58 58 49 51 49 58 39 58 58 40 53 46 47 58 47 51 53 53 49 50 58 48 39 53 58 37 40 54 58 58 58 54 53 52 50 50 58 58 58 50 50 51 58 38 51 51 53 58 44 49 40 41 39 51 52 51 52 51 40 51 52 41 52 58 54 50 39 51 53 58 58 53 33 49 42 53 50 37 44 49 54 45 54 38 54 49 52 39 54 41 44 41 51 51 54 40 38 29 52 49 37 38 54 49 33 36 47 36 37 52 51 32 50 21 24 39 21 49 45 52 33 54 54 25 22 25 32 39 42 47 37 51 40 51 34 47 38 54 47 40 29 34 25 49 28 54 24 44 46 32 42 35 34 22 45 42 49 28 27 35 52 40 25 37 51 33 33 31 25 40 45 33 37 36 49 40 32 51 30 47 47 49 49 41 32 37 32 33 41 31 46 32 34 18 16 49 25 16 28 52 32 23 52 52 51 32 45 49 38 21 30 31 28 37 32 36 38 36 39 32 28 31 51 35 51 27 23 45 30 42 43 31 42 30 51 46 46 40 30 24 26 24 27 34 29 14 22 26 23 41 46 33 26 18 31 43 31 36 20 43 26 32 33 21 24 29 27 46 32 14 6 46 7 27 26 24 25 22 46 46 28 34 33 32 30 21 31 23 31 30 38 36 37 34 36 29 26 31 31 30 30 37 30 46 18 31 31 29 31 7 19 28 29 48 33 31 31 30 39 41 25 28 32 31 31 24 19 17 21 41 39 31 48 36 30 31 33 23 37 21 44 18 25 14 42 26 31 20 15 48 44 44 48 48 48 48 48 48 37 14 12 33 33 22 34 15 20 18 24 33 36 13 17 31 11 19 18 30 24 25 10 14 26 40 33 23 33 16 15 33 48 33 15 20 24 25 27 31 19 13 5 4 4 15 11 12 32 34 29 19 14 7 8 21 33 31 34 16 17 19 19 47 47 31 32 31 24 21 20 38 48 31 11 12 16 11 3 3 5 10 13 14 4 12 7 28 28 34 9 14 3 3 3 5 20 27 10 6 21 20 47 47 21 23 20 7 25 9 16 24 7 7 6 19 9 28 13 40 18 6 4 4 10 10 13 27 34 14 15 27 28 14 15 33 17 19 30 14 21 22 17 14 12 21 25 26 22 15 11 5 8 8 24 7 9 22 28 28 30 28 17 7 15 7 15 22 14 6 6 7 4 11 13 28 26 25 7 6 15 4 9 5 7 12 9 8 6 16 18 5 10 13 9 11 13 9 20 10 10 7 7 16 6 14 3 5 28 8 23 11 2 2 3 3 2 1 4 8 11 3 3 2 3 2 8 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_119967776_119968908
seq2: B6Ng01-199K22.g_65_1202

seq1  GAATTCCACTGGTCATATCAGGAGACTAATGGAGAAAACAAAGAGGAAGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCACTGGTCATATCAGGAGACTAATGGAGAAAACAAAGAGGAAGG  50

seq1  AGCAGTCAAGACTATGTGACATCCTGTCTATGAGAATAAAAATGTTTTCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGTCAAGACTATGTGACATCCTGTCTATGAGAATAAAAATGTTTTCA  100

seq1  GTTCTACCATTTCTAAAATATTATAGGAGAAAACAATGACAGCTTTCTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCTACCATTTCTAAAATATTATAGGAGAAAACAATGACAGCTTTCTAG  150

seq1  AACACAAATAACTTTAAATCCAGGCTAGGGATAACTATGTACAAACGTAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACACAAATAACTTTAAATCCAGGCTAGGGATAACTATGTACAAACGTAC  200

seq1  TGCATTGATCTTGATCCCAGGAGTCAGAAATCCCAAGATACTCTGACTAT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCATTGATCTTGATCCCAGGAGTCAGAAATCCCAAGATACTCTGACTAT  250

seq1  AATTTTATAAGCCAAGGCTTTCTAGATATTACACAAAAGCCTCAAAATCT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTTATAAGCCAAGGCTTTCTAGATATTACACAAAAGCCTCAAAATCT  300

seq1  AGATCTGGCAGTCCAGGGTCATTTCCCCACTTTATTAGACATGGCCTTCA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATCTGGCAGTCCAGGGTCATTTCCCCACTTTATTAGACATGGCCTTCA  350

seq1  AGGTTTTTAATGACTAGTATGAGACCTCAAAAACATAAGGGCAAAGTGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTTTTAATGACTAGTATGAGACCTCAAAAACATAAGGGCAAAGTGAA  400

seq1  CAGGAAATAGGAAACACATAAGAGAAAGGGCAGTCAGTACACAGCTGCAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAAATAGGAAACACATAAGAGAAAGGGCAGTCAGTACACAGCTGCAT  450

seq1  CAATGGCCATTTCTTACTTATCTCAGAAAATCCTAGAGCACCATCTAGTG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATGGCCATTTCTTACTTATCTCAGAAAATCCTAGAGCACCATCTAGTG  500

seq1  ACCACAGGCTTCATTCTCAGAAAACTATTTCAGCCTCAGTTTGAATGAGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCACAGGCTTCATTCTCAGAAAACTATTTCAGCCTCAGTTTGAATGAGT  550

seq1  TTCTTCTGTTGTCATTTCAGTTCCAGACATTTTTAGCTGGGCATGTCCAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCTGTTGTCATTTCAGTTCCAGACATTTTTAGCTGGGCATGTCCAG  600

seq1  GAATCCTAGACTATGAACATCTTTACAGCAATGTCGAATAAAGTGAAGAT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCCTAGACTATGAACATCTTTACAGCAATGTCGAATAAAGTGAAGAT  650

seq1  TCATGGGGAATGAGAATGTTCCTTTTACCTATAAGAGGAAAGTTAAGAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATGGGGAATGAGAATGTTCCTTTTACCTATAAGAGGAAAGTTAAGAGC  700

seq1  TATCCAAGGACTGCATGTTAAGTACAAATGTGAAAATCATCAAATACCCT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCCAAGGACTGCATGTTAAGTACAAATGTGAAAATCATCAAATACCCT  750

seq1  TAATTTTTCCCTATACTACTACTTGCCCAAGAAGGAAAAAGTTCTCTTCT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTTTTCCCTATACTACTACTTGCCCAAGAAGGAAAAAGTTCTCTTCT  800

seq1  AAAGACTTACATAACCTTAAGC-TTATACAGGCTTGAGTACTTCCTATAT  849
      |||||||||||||||||||||| |||||||||||||||||||||||||||
seq2  AAAGACTTACATAACCTTAAGCTTTATACAGGCTTGAGTACTTCCTATAT  850

seq1  CTAT-GGATGAGCCAAAGTAAACCTAGATATGGAAATGAGCAAATTCAA-  897
      |||| |||||||||||||||||||||||||||||||||||||||||||| 
seq2  CTATGGGATGAGCCAAAGTAAACCTAGATATGGAAATGAGCAAATTCAAG  900

seq1  GTTTTTTTTTTATCCACATA-TTTACACATATAATTTACCACCCTGAGGA  946
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  GTTTTTTTTTTATCCACATATTTTACACATATAATTTACCACCCTGAGGA  950

seq1  GATATAAATGAATA-GCTATCTCTTTTCTATAGGGGACCACAAACAAACC  995
      ||||| |||||||| ||||||||||||||||| |||||||| ||||| | 
seq2  GATAT-AATGAATAGGCTATCTCTTTTCTATA-GGGACCAC-AACAACCA  997

seq1  AAAATAGGGTGACATAAAATTGAACTAGA-GGACCCAGTGACTTTATCT-  1043
      ||||||  |||||||||||||| |||||| ||||||||||||||||||| 
seq2  AAAATA-CGTGACATAAAATTG-ACTAGAGGGACCCAGTGACTTTATCTG  1045

seq1  GGTTTACTTAAAAAGCATAGGT-GGGGGTCATTTA-TAGAAAA-GTTCTA  1090
      |||||||||||||||||||||| |||||||||||| ||||||| ||||||
seq2  GGTTTACTTAAAAAGCATAGGTGGGGGGTCATTTATTAGAAAAGGTTCTA  1095

seq1  TC-ATG-CATTAG-CTCTTCCTAAATTTAATAAAGCTTTTGTCCAC  1133
      || ||| |||||| |||||||| || |||||  ||| |||||||||
seq2  TCAATGCCATTAGCCTCTTCCT-AAGTTAAT--AGCCTTTGTCCAC  1138

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information