MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-202J03
Chromosome	X (Build37)
Map Location	65,614,761 - 65,615,716
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Gm1140, LOC666842, LOC619873, 4933436I01Rik, LOC100040194, EG236844, LOC385372
Downstream gene	LOC627888, LOC434788, Fmr1, Fmr1nb, LOC100040244, EG627927, LOC666882, LOC671950, LOC100040255, Aff2
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gm1140 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382217 MGI:2685986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC666842 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC619873 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619873
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 Proteins pseudo : _no_value

name	4933436I01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66780 MGI:1914030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG236844 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236844 MGI:3645886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	LOC385372 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	LOC627888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC434788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins pseudo : _no_value

name	Fmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14265 MGI:95564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmr1nb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207854 MGI:2672032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 139 ESTs, 6 Proteins

name	EG627927 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627927 MGI:3704138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC666882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC671950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100040255 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Aff2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14266 MGI:1202294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1140 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407518 GeneID:382217 MGI:2685986
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : gene model 1140, (NCBI) transcript_id : XM_356330.3

name	4933436I01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385231 GeneID:66780 MGI:1914030
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4933436I01 gene transcript_id : NM_025763.1

name	EG236844 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20984062 GeneID:236844 MGI:3645886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : predicted gene, EG236844 transcript_id : XM_141816.1

name	Fmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51036612 GeneID:14265 MGI:95564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation syndrome 1 homolog transcript_id : NM_008031.2

name	Fmr1nb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29135262 GeneID:207854 MGI:2672032
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation 1 neighbor transcript_id : NM_174993.1

name	LOC100040244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271669 GeneID:100040244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 139 ESTs, 6 Proteins product : similar to phosphoserine/threonine/tyrosine interaction protein transcript_id : XM_001473727.1

name	EG627927 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407523 GeneID:627927 MGI:3704138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627927 transcript_id : XM_110770.5

name	LOC671950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271673 GeneID:671950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical LOC671950 transcript_id : XM_001473776.1

name	LOC100040255 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271671 GeneID:100040255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040255 transcript_id : XM_001474363.1

name	Aff2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351744 GeneID:14266 MGI:1202294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AF4/FMR2 family, member 2 transcript_id : NM_008032.2

name	Gm1140 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407519 GeneID:382217 MGI:2685986
definition	codon_start : 1 product : hypothetical protein protein_id : XP_356330.3

name	4933436I01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385232 CCDS:CCDS30170.1 GeneID:66780 MGI:1914030
definition	codon_start : 1 product : hypothetical protein LOC66780 protein_id : NP_080039.1

name	EG236844 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984063 GeneID:236844 MGI:3645886
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141816.1

name	Fmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036613 CCDS:CCDS30171.1 GeneID:14265 MGI:95564
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007417 - central nervous system development [Evidence IMP]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fragile X mental retardation-1 protein product : fragile X mental retardation protein 1 protein_id : NP_032057.2

name	Fmr1nb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29135263 CCDS:CCDS30172.1 GeneID:207854 MGI:2672032
definition	codon_start : 1 exception : mismatches in translation product : fragile X mental retardation 1 neighbor protein_id : NP_778158.1

name	LOC100040244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271670 GeneID:100040244
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473777.1

name	EG627927 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086331 GeneID:627927 MGI:3704138
definition	codon_start : 1 product : hypothetical protein protein_id : XP_110770.2

name	LOC671950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271674 GeneID:671950
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473826.1

name	LOC100040255 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271672 GeneID:100040255
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474413.1

name	Aff2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679819 CCDS:CCDS30173.1 GeneID:14266 MGI:1202294
definition	GO_process : GO:0007611 - learning and/or memory [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Ox19 homolog; fragile X mental retardation 2 homolog; fragile X mental retardation protein 2 homolog product : AF4/FMR2 family, member 2 protein_id : NP_032058.1

name	LOC619873 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619873
definition	number : 4 pseudo : _no_value

name	LOC619873 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619873
definition	number : 3 pseudo : _no_value

name	LOC619873 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619873
definition	number : 2 pseudo : _no_value

name	LOC619873 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619873
definition	number : 1 pseudo : _no_value

name	LOC100040194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040194
definition	number : 2 pseudo : _no_value

name	LOC100040194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040194
definition	number : 1 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 1 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 2 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 3 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 4 pseudo : _no_value

name	LOC627888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627888
definition	number : 5 pseudo : _no_value

name	LOC666882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666882
definition	number : 1 pseudo : _no_value

name	LOC666842 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271666 GeneID:666842
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Ribosomal protein L7a pseudo : _no_value transcript_id : XR_001927.2

name	LOC385372 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271667 GeneID:385372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to Ranbp1 protein pseudo : _no_value transcript_id : XR_031303.1

name	LOC434788 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271668 GeneID:434788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 8 Proteins product : similar to S-adenosylhomocysteine hydrolase pseudo : _no_value transcript_id : XR_031704.1

clone name	MSMg01-525D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-216K17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-294B15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434D08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-069A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-236G11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-479F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236G11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-540B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336A22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469I23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537I24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-502B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-214F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-112C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-092J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-426G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-055J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-417B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157A03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-039E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-287A11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298G10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283H02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316D21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-053I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023M10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-028M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-339G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300J05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-057M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324E09
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-202J03.b	B6Ng01-202J03.g
ACC	GA023028	GA023029
length	1,001	1,009
definition	B6Ng01-202J03.b	B6Ng01-202J03.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctcctcatatagcttcatgtgtgaaccgtgttctgatacttagat acaggagttgttttgtagatgtatccactggaactaggcttcacagctct gcattttcattggttgtgtttttctgtagtggtctctatctactgaaaaa agaagtttccctgactatattcatctgtgggtatgaaaaacagatttagc tcataaactttacctcaagaaacaattggttgtaaatgtattttgatcaa cttataccttttatatgaaatataaaacattcaggaacatgaaaaatcaa gaagacttataaacatgggtgtaaccagaaatcaagtgaataaatcataa gcattgagaatcttcctaaaaatactgtgttaccgtgtgcctccttcaca ggtacttaacatgttaacttcttcataaggggcttctttatatacttggc ccatttttcctacttacttttggattattcattccttgctgaatatatgt attgaaaatatcttctaacatttgttagcttttctatgtgctttgttgaa ttggcattttaaattttacggttgctttatataaaagttgtatgctaaac ctgaaagaaaatatcatccattgatttatatttcatgccatttgtttctc atttgaaaaatttccacatgagaatctttccattgggatacttttaagct tttctctttgcttgggcctagtactcaactgcatgtcagtagatagagtg agttagcaatttaatttcatctttttatatctttgctcagttgttttcaa tacaatttactgaataatattttcttttcccaatttttgtgaataatgct gatgtgcattcatgtatacatatgaattatatttttctgtatttattttt tgttttatgtgcactaattttacattatttttagtgcctttattatattt tactgcaccattgtattcaagtagagggatgatttttccacctttgtttt t	gaattctcacctgaggaataccaaatggctgagaagcacctgaaaaaatg ttcagcatcattaatcagcagggaaatgcaaatcaaaataaccctgaaat tccacctcacaccagtcagaatggctaagatcaaaaactcgggtgacagc agatgctggcaaggatgtggagaaagaggaacactcctacattgttggtg ggattaaaagcttgtacaaccactctggaaatcagtctggtggttcctca gaaaattggacatagtactaccagaggatcccacaatacctctcctgggc atatgtccagaagatgttccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaagctggaaagaacacagat gcccctcaacagaggaatggatacagaaaatgtgatacatttacacaatg gattactactcagctattaaaaagagtgaatttttgtaattcctaggcaa atggatggacctggagggcaacatcctgagtgagttaaccctatcacaag agaactcacatgatatgtactcactgataagtgtatattagcccagatac ttagaatacccaagatataagatacaatttgtgaaactcatgaaactaaa gaaaaacaaagaccaatgtgtctacacttttgccccttcttagaactggg aacaaaacacccattggaaggagttacagagacaaagtttggaactgaga agaaaggatggaccatctagagacttgccatatctggggatctatcccat aatcagcctccaaacgctgaacaccattgcatatactagcaagatttttg cttgaaagggaccctgatatagctgtctctagtgagactatgtggggaac ttgcaaacacagaagtgtatgctcacagtcatgtattggtatggatcccg agccccctaatgaaggagctaggagaatgtacctcaaggacctaaaaaga tctgcaacc
quality values	Open. Hide. 58 41 43 22 62 62 54 62 46 62 47 42 62 56 62 47 51 62 62 56 47 24 44 62 62 62 62 62 59 62 62 62 62 43 56 33 48 56 46 43 54 51 51 59 62 62 62 56 54 62 62 62 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 54 59 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 59 62 62 62 62 59 59 62 62 56 62 62 62 62 62 62 62 54 54 59 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 48 42 62 62 62 62 59 56 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 50 59 62 59 59 59 62 59 59 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 47 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 54 54 62 62 62 62 62 52 58 58 58 58 58 45 58 58 58 58 58 58 58 58 58 58 58 52 54 54 58 58 58 58 58 54 54 58 58 54 54 58 58 58 58 52 58 58 49 58 58 58 58 58 58 54 58 58 58 58 52 54 42 58 54 42 54 54 52 58 58 58 52 52 58 54 54 54 54 54 58 58 46 42 58 58 52 41 34 54 54 52 58 52 58 51 58 54 47 41 52 58 58 48 49 58 58 58 58 46 58 58 58 43 37 51 51 58 54 58 34 51 50 30 52 52 58 51 52 38 25 42 35 58 47 54 52 32 49 52 45 58 58 50 41 38 46 54 53 58 58 50 52 53 58 36 39 50 49 40 51 29 32 25 23 29 54 39 40 40 41 46 46 50 51 50 24 39 41 49 41 37 50 54 42 42 50 41 26 37 40 53 52 39 50 39 24 50 51 58 39 41 41 51 39 42 42 50 42 58 50 32 32 33 49 41 41 31 49 36 30 54 54 54 22 33 41 32 35 53 54 29 35 53 39 49 52 39 34 31 53 42 17 54 54 18 45 29 52 33 26 40 32 21 9 54 38 45 37 42 47 31 35 32 21 31 40 42 45 54 54 54 53 22 54 54 29 23 53 28 16 28 13 53 54 54 33 51 37 42 33 33 37 31 35 31 31 20 31 24 25 18 53 33 41 31 14 9 46 35 31 34 52 29 34 32 31 40 31 31 33 26 26 32 49 32 12 20 19 10 17 53 53 52 30 51 21 51 23 31 21 51 33 31 31 51 46 51 51 18 38 7 51 51 10 19 31 42 24 30 31 29 31 31 27 38 27 51 51 46 23 33 28 32 46 29 27 43 46 46 23 43 26 28 31 23 20 9 46 20 30 9 11 12 26 20 13 48 46 30 17 31 21 37 31 29 21 48 11 7 31 36 9 9 24 28 14 10 27 26 31 36 31 41 11 41 10 35 17 25 38 31 32 23 16 17 8 5 8 10 18 10 30 9 18 9 44 44 44 41	Open. Hide. 62 49 39 47 62 62 62 47 51 62 62 62 51 44 29 34 24 29 39 41 43 43 41 43 59 59 62 62 41 56 56 59 19 46 62 59 62 62 59 62 62 62 54 48 59 59 59 59 59 59 51 51 49 49 43 50 59 59 59 51 59 59 59 59 59 59 59 43 46 59 50 62 59 59 56 56 51 59 49 43 46 51 56 46 38 43 51 59 59 59 59 62 59 59 59 54 54 48 59 59 59 59 59 51 59 56 56 59 59 59 59 59 59 59 51 59 59 51 49 62 59 59 62 62 59 59 59 54 40 59 59 59 50 56 48 56 62 62 62 62 59 59 62 59 54 59 62 59 59 59 56 49 59 59 62 59 59 62 62 62 51 51 50 42 32 46 59 62 62 62 62 56 62 59 59 59 62 59 62 62 62 62 59 59 62 62 62 62 59 62 56 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 51 59 59 59 62 62 49 62 62 56 62 62 62 59 59 51 40 62 56 50 59 59 59 62 50 62 56 50 59 50 43 51 62 62 62 59 62 56 50 38 59 40 50 46 46 49 62 62 43 51 40 46 50 51 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 56 56 62 62 50 59 59 62 62 62 62 62 59 59 62 62 62 62 59 59 62 59 62 59 59 62 62 59 59 62 51 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 51 56 59 49 59 56 51 50 50 51 56 62 62 62 51 59 59 59 43 51 59 51 50 62 59 51 56 59 56 56 50 51 49 43 62 59 59 51 59 48 46 59 59 59 59 56 59 62 62 62 56 51 59 56 46 62 51 62 62 62 59 62 62 62 62 51 59 43 45 59 56 56 59 47 62 46 59 59 56 56 59 51 59 59 62 62 62 59 62 46 59 51 62 56 59 59 43 62 62 62 59 59 56 59 51 39 51 59 62 62 62 62 62 62 62 59 51 62 51 56 59 59 56 47 62 62 62 56 56 51 51 56 56 56 56 56 56 56 36 56 51 51 56 56 38 56 37 50 37 56 49 44 51 56 51 56 50 43 39 50 38 30 31 30 39 39 51 56 62 62 62 62 62 56 54 62 43 38 39 56 56 45 56 62 62 54 54 62 62 62 39 41 56 62 56 62 62 56 62 62 56 56 50 56 47 62 47 43 62 62 47 39 47 62 62 22 47 62 62 47 50 56 62 56 56 62 43 42 56 52 62 52 52 35 39 52 52 52 27 45 43 52 62 62 48 46 42 41 24 43 42 50 62 42 19 28 27 52 33 42 42 33 43 35 43 52 42 46 39 38 39 52 52 42 32 42 46 29 28 37 39 42 39 47 52 44 42 47 50 50 41 41 42 31 52 52 42 49 46 42 28 47 47 42 31 25 40 40 52 20 41 52 53 20 21 16 11 19 12 22 12 28 22 8 25 30 52 22 47 22 58 54 35 34 39 22 38 37 32 52 40 40 25 47 30 39 25 19 25 21 27 19 35 42 54 19 13 11 23 27 22 27 13 47 30 10 22 17 24 31 12 17 38 31 43 37 17 37 35 25 30 37 25 36 34 48 21 25 31 39 50 32 40 37 29 30 21 25 32 50 32 21 34 36 42 24 40 22 38 26 31 21 14 23 23 13 10 14 9 21 28 34 17 28 17 12 46 16 16 33 22 24 19 13 25 28 20 27 13 17 23 15 16 15 22 39 35 31 26 14 43 31 21 15 22 23 32 19 14 19 15 9 9 21 22 13 15 16 11 25 28 40 25 12 19 14 36 20 22 21 31 13 18 11 11 10 22 21 15 42 33 25 25 23 26 15 26 32 10 16 7 14 32 19 19 26 22 22 29 18 9 5 19 23 26 29 26 35 12 33 22 27 22 6 28 17 26 31 19 23 11 25 8 19 11 9 5 9 19 18 22 12 18 8 6 5 6 13 13 18 11 7 11 32 16 13 20 12 23 15 17 42 20 13 9 21 31 13 13 9 13 30 29 6 6 11 9 12 31 32 40 15 6 40 10 9 18 20 10 10 6 10 17 22 6 23 32 30 32 23 6 24 8 5 24 10 13 42 21 28 17 22 20 9 9 6 27 6 32 31 7 10 17 14 23 31 9 31 21 16 19 27 7 13 8 9 6 18 8 7 6 11 11 6 12 34 25 17 28 7 18 21

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_65614761_65615716
seq2: B6Ng01-202J03.b_44_1009 (reverse)

seq1  ATACAATGGTGCAGT-AAATATA--TAAGGCACT-AAAATAATGTAAAAT  46
      ||||||||||||||| |||||||   |||||||| |||||||||||||||
seq2  ATACAATGGTGCAGTAAAATATAATAAAGGCACTAAAAATAATGTAAAAT  50

seq1  TAGTGCACATAAA--CAAAAATAAATACAG-AAAATATAATTCATATGTA  93
      |||||||||||||   |||||||||||||| |||||||||||||||||||
seq2  TAGTGCACATAAAACAAAAAATAAATACAGAAAAATATAATTCATATGTA  100

seq1  TACATGAATGCACATCAGCATTATTCAC-AAAATTGGG-AAAGAAAATAT  141
      |||||||||||||||||||||||||||| ||||||||| |||||||||||
seq2  TACATGAATGCACATCAGCATTATTCACAAAAATTGGGAAAAGAAAATAT  150

seq1  TATTCAGTAAATTGTATTG-AAACAACTGAGCAAAGATATAAAAAGATGA  190
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TATTCAGTAAATTGTATTGAAAACAACTGAGCAAAGATATAAAAAGATGA  200

seq1  AATTAAATTGCTAACTCACTCTATCTACTGACATGCAGTTGAGTACTAGG  240
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTAAATTGCTAACTCACTCTATCTACTGACATGCAGTTGAGTACTAGG  250

seq1  CCCAAGCAAAGAGAAAAGCTTAAAAGTATCCCAATGGAAAGATTCTCATG  290
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCAAGCAAAGAGAAAAGCTTAAAAGTATCCCAATGGAAAGATTCTCATG  300

seq1  TGGAAATTTTTCAAATGAGAAACAAATGGCATGAAATATAAATCAATGGA  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAATTTTTCAAATGAGAAACAAATGGCATGAAATATAAATCAATGGA  350

seq1  TGATATTTTCTTTCAGGTTTAGCATACAACTTTTATATAAAGCAACCGTA  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATATTTTCTTTCAGGTTTAGCATACAACTTTTATATAAAGCAACCGTA  400

seq1  AAATTTAAAATGCCAATTCAACAAAGCACATAGAAAAGCTAACAAATGTT  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTTAAAATGCCAATTCAACAAAGCACATAGAAAAGCTAACAAATGTT  450

seq1  AGAAGATATTTTCAATACATATATTCAGCAAGGAATGAATAATCCAAAAG  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAGATATTTTCAATACATATATTCAGCAAGGAATGAATAATCCAAAAG  500

seq1  TAAGTAGGAAAAATGGGCCAAGTATATAAAGAAGCCCCTTATGAAGAAGT  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGTAGGAAAAATGGGCCAAGTATATAAAGAAGCCCCTTATGAAGAAGT  550

seq1  TAACATGTTAAGTACCTGTGAAGGAGGCACACGGTAACACAGTATTTTTA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAACATGTTAAGTACCTGTGAAGGAGGCACACGGTAACACAGTATTTTTA  600

seq1  GGAAGATTCTCAATGCTTATGATTTATTCACTTGATTTCTGGTTACACCC  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGATTCTCAATGCTTATGATTTATTCACTTGATTTCTGGTTACACCC  650

seq1  ATGTTTATAAGTCTTCTTGATTTTTCATGTTCCTGAATGTTTTATATTTC  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTTTATAAGTCTTCTTGATTTTTCATGTTCCTGAATGTTTTATATTTC  700

seq1  ATATAAAAGGTATAAGTTGATCAAAATACATTTACAACCAATTGTTTCTT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATAAAAGGTATAAGTTGATCAAAATACATTTACAACCAATTGTTTCTT  750

seq1  GAGGTAAAGTTTATGAGCTAAATCTGTTTTTCATACCCACAGATGAATAT  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTAAAGTTTATGAGCTAAATCTGTTTTTCATACCCACAGATGAATAT  800

seq1  AGTCAGGGAAACTTCTTTTTTCAGTAGATAGAGACCACTACAGAAAAACA  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCAGGGAAACTTCTTTTTTCAGTAGATAGAGACCACTACAGAAAAACA  850

seq1  CAACCAATGAAAATGCAGAGCTGTGAAGCCTAGTTCCAGTGGATACATCT  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACCAATGAAAATGCAGAGCTGTGAAGCCTAGTTCCAGTGGATACATCT  900

seq1  ACAAAACAACTCCTGTATCTAAGTATCAGAACACGGTTCACACATGAAGC  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAAACAACTCCTGTATCTAAGTATCAGAACACGGTTCACACATGAAGC  950

seq1  TATATGAGGAGAATTC  956
      ||||||||||||||||
seq2  TATATGAGGAGAATTC  966

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information