MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-203M05
Chromosome	X (Build37)
Map Location	154,349,759 - 154,351,014
singlet/doublet	singlet
Overlap gene	Cnksr2
Upstream gene	LOC434885, Phex, Gm1947, Sms, LOC100041181, EG625253, Mbtps2, LOC100040239, LOC667460, LOC667465, Smpx, Klhl34
Downstream gene	EG667483, LOC671033, LOC667487, LOC436243
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC434885 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434885
definition	note : succinate-Coenzyme A ligase, GDP-forming, beta subunit pseudogene pseudo : _no_value

name	Phex (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18675 MGI:107489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm1947 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:384929 MGI:3037805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins

name	Sms (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20603 MGI:109490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041181 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG625253 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625253 MGI:3647518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins

name	Mbtps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270669 MGI:2444506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040239 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040239
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC667460 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667460
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC667465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Smpx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66106 MGI:1913356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245683 MGI:2685234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cnksr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245684 MGI:2661175
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG667483 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667483 MGI:3645697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 24 Proteins pseudo : _no_value

name	LOC671033 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671033
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667487 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 359 ESTs, 9 Proteins pseudo : _no_value

name	LOC436243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	Phex (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116686145 GeneID:18675 MGI:107489
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets) transcript_id : NM_011077.2

name	Gm1947 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272491 GeneID:384929 MGI:3037805
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins product : gene model 1947, (NCBI) transcript_id : XM_357943.5

name	Sms (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118600997 GeneID:20603 MGI:109490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spermine synthase transcript_id : NM_009214.3

name	LOC100041181 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272526 GeneID:100041181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100041181 transcript_id : XM_001475982.1

name	EG625253 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408398 GeneID:625253 MGI:3647518
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : predicted gene, EG625253 transcript_id : XM_890372.2

name	Mbtps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130033 GeneID:270669 MGI:2444506
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-bound transcription factor peptidase, site 2 transcript_id : NM_172307.2

name	Mbtps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383412 GeneID:270669 MGI:2444506
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane-bound transcription factor peptidase, site 2 transcript_id : NM_178266.3

name	Smpx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:14149751 GeneID:66106 MGI:1913356
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small muscle protein, X-linked transcript_id : NM_025357.1

name	Klhl34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157474 GeneID:245683 MGI:2685234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 34 (Drosophila) transcript_id : NM_001081667.1

name	Cnksr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343125 GeneID:245684 MGI:2661175
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : connector enhancer of kinase suppressor of Ras 2 transcript_id : NM_177751.2

name	Phex (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755050 CCDS:CCDS30497.1 GeneID:18675 MGI:107489
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0004245 - neprilysin activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0001503 - ossification [Evidence IEA]; GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 product : X-linked phosphate regulating endopeptidase protein_id : NP_035207.1

name	Gm1947 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272492 GeneID:384929 MGI:3037805
definition	codon_start : 1 product : similar to Nol5a protein protein_id : XP_357943.5

name	Sms (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118600998 GeneID:20603 MGI:109490
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016768 - spermine synthase activity [Evidence IEA] [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008215 - spermine metabolism [Evidence IMP] codon_start : 1 note : spermidine aminopropyltransferase product : spermine synthase protein_id : NP_033240.3

name	LOC100041181 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272527 GeneID:100041181
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476032.1

name	EG625253 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004532 GeneID:625253 MGI:3647518
definition	codon_start : 1 product : hypothetical protein protein_id : XP_895465.1

name	Mbtps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:26986629 CCDS:CCDS30498.1 GeneID:270669 MGI:2444506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; RIKEmembrane-bound transcription factor protease, site 2; membrane-bound transcription factor protease, site 2 product : membrane-bound transcription factor protease, site 2 isoform 1 protein_id : NP_758511.1

name	Mbtps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30142720 CCDS:CCDS30499.1 GeneID:270669 MGI:2444506
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0004222 - metalloendopeptidase activity [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2; RIKEmembrane-bound transcription factor protease, site 2; membrane-bound transcription factor protease, site 2 product : membrane-bound transcription factor protease, site 2 isoform 2 protein_id : NP_839997.1

name	Smpx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:14149752 GeneID:66106 MGI:1913356
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] codon_start : 1 note : chisel; cardiac and skeletal muscle protein product : small muscle protein, X-linked protein_id : NP_079633.1

name	Klhl34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157475 GeneID:245683 MGI:2685234
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : kelch-like 34 protein_id : NP_001075136.1

name	Cnksr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244248 CCDS:CCDS30501.1 GeneID:245684 MGI:2661175
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS] [Evidence IEA]; GO:0019901 - protein kinase binding [Evidence ISS] GO_process : GO:0007243 - protein kinase cascade [Evidence ISS]; GO:0009966 - regulation of signal transduction [Evidence IEA] codon_start : 1 note : connector enhancer of KSR2 product : connector enhancer of kinase suppressor of Ras 2 protein_id : NP_808419.1

name	LOC100040239 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040239
definition	number : 2 pseudo : _no_value

name	LOC100040239 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040239
definition	number : 1 pseudo : _no_value

name	LOC667460 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667460
definition	number : 1 pseudo : _no_value

name	LOC667465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667465
definition	number : 2 pseudo : _no_value

name	LOC667465 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667465
definition	number : 1 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 1 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 2 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 3 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 4 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 5 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 6 pseudo : _no_value

name	LOC671033 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671033
definition	number : 7 pseudo : _no_value

name	EG667483 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272498 GeneID:667483 MGI:3645697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 24 Proteins product : predicted gene, EG667483 pseudo : _no_value transcript_id : XR_002032.2

name	LOC667487 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272499 GeneID:667487
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 359 ESTs, 9 Proteins product : similar to 60S ribosomal protein L9 pseudo : _no_value transcript_id : XR_031772.1

name	LOC436243 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272500 GeneID:436243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to protein 40kD pseudo : _no_value transcript_id : XR_031791.1

clone name	MSMg01-445P06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-260H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-534E18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439K20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479K19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375D10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-474A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147B19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-506G03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118D21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-063E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481G20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-437I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183N12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183P02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-272L17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-178I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-520C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-472A01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-356C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-115M20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-299J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050O12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-436B17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-171N08
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-116B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-079M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-134I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278E23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-165A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295D09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056C10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257D13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196M02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-305N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-310I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-202M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253A12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-195B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-026C08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285K13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-202O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291F21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-094N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-321P24
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-203M05.b	B6Ng01-203M05.g
ACC	GA023888	GA023889
length	1,236	1,220
definition	B6Ng01-203M05.b	B6Ng01-203M05.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctaagtgcgtttcctgcctctatgatgtttgaatgaaagattcag agatacatacacatgcacacacactcacaccagtatgtattgcaatatga cagcttacagttctttcattctttggtgttatattttggctcaaaataca acaaccctaatagaaatgcaataaaataagaacttaatatccagtatatt aatttccgatactctaaaatcaatttactatgaaggaagaacaaataatt ggtatgtttttcaatatactttaattttaaaatatcctaacagtagaaat gaacttcaaaacactttcaaataatacaagtttttaataaaaagtaatct taaattttattgtttttcttctactttaaggttactaattatactttaac tttggtaatctatatagattttgtttgtttgtttattatttactttcttt ccccaacacctgaaaacaaggaaaaaaggaattgcagtcaactttttaca agaatatttaaatatgccttaagtacgaggtaaagactaatagaattttt atttttcatgaacaatcgcccaaaactgtgaatttcttttctagtagatt taagattagctatgccaacttccttcaaatttctattacctctatattcc tattttcaagaaggagttgctattaatatcatcatttaatgtgagttact atattggaaaattaatataagaaaaaaagtgtatctttttatttctattt tcaacaaggagttgctattaataagagttaatgtgagccatcatgctaca aaactaatataagaaaaaggcttaaaatgttcaaatagatatcaggctag gttatgttaccctggtccaattaactgaactgctataaaatagatacaac ttgttcttacagagcaaggaagaatgtttccattacgttgctaaattcaa ctgtttattttattgataaataaactagaggaagtcttcaaggggtttat tgtgtggatgctatctggcttatacaaattaaagctcatagtacatattc atatatattgtaatatattctgtactgttttctgcattattgtccagcta ggcagagtagaaagaattagattatttgagattctatttgaaaatcactt tggtaaacgggagggttataaatctggagtgtcacaaaagctaataacta caaatttctgtccagatgcatagcccataaaattaa	gaattccaactcaattcttcaaccaattagaaagagcaatctgcaaattc atctggaataacaaaaaacctaggatagcaaaaagtcttctcaaggataa aagaacctctggtggaatcaccatgcctgacctaaagctgtactacagag caattgtgattaaaaaaaaaaaaactgcatggtactggtatattgacaga cagttagagcaatagaatagaatctaagacccggaaaagaatccacacac ctatgatcacttgatctttgacaagggagctaaaaccatccagtggaaaa aggacagcattttcaacaaatggtgctggcacaactggtggttatcatgc agaagaatgcgaattgatccattcctatctccttttactgagatcaaatc taagtggattaagaaactccacataaaaccagagacactgaaatttatag aggagaaagtagggaaaaacctcaaagatatgggtacaggggaaaagttc ctgaatggcttttactgtaagatggagaatcgataaatgggacctcataa agttgcaaaggttctgcaaggcaaaagacacagtcaacaagtcaaaaaga ccaccatcagattggaaaaggatctttacctatcttaaatcaaatagggg gctaatatccaatatatataaagaactcaagaaggtggactccagaaaat caaataaccccattaaaaaatggggctcagatctgaacaaagaattctca actgaggaatacagattggcagagaagcacctgaaaaaatgttcaacatc attaatcatcagggaaatgcaaatcaaaacaaccctgagattccacctca caccagtcagaatggctaagatcaaaaattcagtgacagcagatgctggc gaggttggtggagaaagaggacactcctccattgttggtggattgcagct tgtacaccactctggaaatcagtctggccggttcctcagaaattggaaat agtactacccggaggatccagcatacctctcctgggcataatattcagaa gagtcccactggtaagagactcatgcctcccactatgtcatagcagctat ttataatagccagaagctgaattccagatgtcacccctcaacagagatgg atacagaaatgtgtacactcttcaccacaatggggaagtcactatctatt agctaattttagaggacatg
quality values	Open. Hide. 41 31 26 32 58 52 62 42 47 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 47 56 62 62 47 47 59 62 62 62 43 62 62 59 62 62 62 62 62 59 59 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 36 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 54 58 54 58 58 58 58 58 52 58 58 58 54 58 47 58 58 58 58 58 58 54 42 58 58 58 58 58 58 58 58 58 58 53 58 58 58 58 58 58 58 58 54 54 58 54 58 52 54 33 58 46 49 58 54 58 39 51 58 52 58 58 52 58 58 58 45 35 53 58 58 58 54 58 48 58 53 32 58 58 52 58 58 58 50 51 42 58 51 49 58 58 58 52 51 53 53 46 51 49 58 50 52 51 58 58 54 53 27 58 49 58 50 28 58 54 42 53 58 46 41 54 51 41 38 37 53 52 52 51 53 50 54 54 50 49 58 52 51 58 50 58 42 58 54 50 48 50 50 41 47 51 53 52 51 51 58 36 49 58 58 51 39 51 52 58 52 52 53 42 58 50 58 36 36 38 24 49 49 42 45 54 37 51 50 58 53 58 58 58 39 45 47 54 53 53 40 49 42 51 54 32 32 16 42 42 21 47 39 54 39 30 46 39 41 37 42 40 53 42 33 34 45 31 52 31 54 31 31 46 37 40 35 54 32 45 52 31 53 45 29 40 45 32 40 53 34 41 31 45 25 54 54 37 37 42 31 39 40 32 40 29 53 34 53 52 49 52 53 35 41 23 45 40 32 49 52 32 32 53 29 52 32 35 53 42 32 40 33 28 29 31 41 36 28 5 25 24 43 36 33 43 24 30 31 31 31 25 31 18 12 47 45 31 34 36 26 31 31 31 31 31 31 29 31 29 33 31 29 34 33 35 43 23 31 31 32 37 48 48 31 25 42 16 31 26 23 37 27 30 30 33 27 41 23 30 35 30 34 25 38 18 28 43 28 34 31 31 32 37 29 36 21 36 36 32 41 25 48 28 26 33 24 33 31 32 34 31 33 31 25 31 31 22 47 23 27 32 37 25 31 31 32 32 16 48 33 22 20 47 48 30 17 17 22 23 27 20 18 47 16 27 31 47 23 34 32 32 16 33 25 24 26 30 18 29 15 16 24 33 21 14 25 43 39 19 11 43 12 21 10 19 14 9 34 14 14 20 9 15 34 32 28 28 26 25 27 22 23 28 29 19 19 24 17 21 14 37 30 12 17 11 39 30 20 31 24 25 16 17 28 18 9 11 7 9 11 12 9 22 28 16 4 5 5 3 6 10 6 9 21 10 26 11 4 4 7 24 28 12 22 8 23 11 24 15 12 21 7 21 29 12 15 20 17 20 8 20 6 14 5 13 9 9 20 10 28 10 24 11 11 7 7 22 17 8 21 4 13 5 6 7 22 20 7 16 7 6 7 8 9 7 5 5 7 22 23 17 6 2 2 3 5 5 8 4 12 7 7 3 1 3 8 3 4 9 12 12 11 6 18 8 14 16 10 5 4 5 16 8 27 8 6 19 23 18 5 4 3 6 22 25 14 6 8 9 20 5 8 5 5 18 4 1 5 2 3 22 18 7 3 2 8 4 3 3 3 7 6 9 2 5 12 14 11 10 6 9 5 5 9 3 6 8 6 4 9 2 3 2 5 5 5 8 6 10 15 4 4 8 22 11 16 16 3 4 15	Open. Hide. 62 44 44 59 62 62 44 30 62 62 62 59 46 46 62 62 62 62 62 59 51 62 62 59 59 62 62 59 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 49 54 54 49 54 62 62 54 54 62 62 62 62 62 62 54 62 51 62 62 62 62 54 48 54 43 49 59 59 62 62 59 59 50 54 56 50 56 62 62 62 59 62 62 62 62 62 62 62 56 62 62 62 62 56 62 62 62 62 62 59 62 59 62 62 62 62 62 62 54 62 62 62 56 62 62 62 62 62 59 62 62 62 59 62 59 56 59 62 62 59 62 62 59 62 62 62 62 59 62 56 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 56 62 59 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 56 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 56 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 50 62 62 44 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 54 47 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 54 58 58 58 58 54 58 54 54 54 52 54 58 58 58 58 58 54 54 58 58 46 52 58 58 58 58 54 54 58 58 58 58 58 58 58 54 58 58 52 58 58 58 58 54 54 58 58 54 58 58 52 54 46 58 58 58 46 58 58 51 58 54 58 52 54 58 58 49 58 58 58 47 42 58 58 58 49 51 51 58 54 51 47 58 58 58 52 58 58 49 48 41 53 54 58 53 53 49 49 58 58 51 51 58 58 58 52 58 32 53 54 51 58 54 58 52 49 50 51 58 54 58 53 53 58 58 58 58 52 49 39 54 46 51 58 40 58 51 51 52 51 29 41 58 49 51 58 49 43 52 51 33 39 53 53 58 51 37 39 50 53 40 58 50 52 50 42 58 54 50 53 32 58 58 50 47 51 54 54 49 44 32 50 40 54 53 49 49 54 40 37 51 50 51 53 53 53 53 53 40 54 40 42 53 49 30 50 49 37 42 42 49 39 27 54 27 54 52 37 26 52 52 46 34 26 54 33 36 41 28 53 40 54 49 42 45 41 47 54 54 53 32 51 33 30 54 54 54 54 38 32 54 54 54 49 32 53 41 34 25 52 29 32 52 32 52 32 36 35 53 53 31 40 29 31 40 43 43 34 26 32 37 34 42 47 17 45 42 32 31 33 32 31 31 35 23 32 33 34 31 32 29 51 22 51 42 21 31 31 34 46 30 45 41 51 51 51 51 31 31 42 18 30 31 26 29 31 32 42 42 23 31 26 24 31 31 43 33 36 39 19 31 48 27 42 48 29 21 33 29 32 48 32 37 33 31 46 46 36 32 23 26 36 46 31 31 31 36 18 30 15 35 31 32 25 38 36 36 31 28 33 33 38 31 37 31 31 37 33 13 38 31 20 31 31 21 30 35 38 21 27 21 38 31 47 47 48 33 30 25 32 11 17 9 18 31 25 32 32 31 24 14 25 19 25 22 31 25 25 18 14 31 11 22 20 20 16 6 6 10 21 26 12 24 48 33 22 35 21 10 43 17 21 32 36 36 33 33 27 38 24 28 13 23 13 15 36 31 18 22 15 25 6 13 32 17 33 19 25 22 22 28 13 12 9 34 24 15 18 34 27 20 16 15 18 28 47 16 28 32 31 18 15 23 23 23 33 10 10 28 12 16 14 34 27 32 21 18 6 24 43 25 15 14 12 10 15 6 5 5 11 14 18 21 24 20 24 13 33 11 29 12 27 12 22 11 16 15 25 20 19 21 30 11 20 28 20 18 20 18 9 25 14 28 47 26 16 4 4 5 4 5 3 9 22 14 9 12 26 15 7 16 4 4 3 34 10 3 5 13 19 18 5 17 27 6 3 3 2 4 12 17 13 16 23 10 9 13 9 25 5 4 12 12 13 16 8 20 9 8 17 16 15 21 21 11 18 13 4 4 17 15 5 7 11 11 9 21 16 23 25 8 8 20 25 6 18 12 9 2 5 3 6 7 20 9 10 25 9 6 4 13 5 6 23 16 9 13 7 7 16 15 4 2 6 2 3 1 8 4 2 1 3 5 4 9 5 16 24 5 5 3 9 4 4 8 4 7 7 5 8 5 8 4 9 5 3 4 6 4 4 9 17 10 6 6 9 9 16 8 9 12 10 8 9 6 3 4 4 4 5 6 5 2 1 5 17 16 13 1 2 8 16 2 3 3 2 6 4 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_154349759_154351014
seq2: B6Ng01-203M05.b_43_1278

seq1  GAATTCTAAGTGCGTTTCCTGCCTCTATGATGTTTGAATGAAAGATTCAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAAGTGCGTTTCCTGCCTCTATGATGTTTGAATGAAAGATTCAG  50

seq1  AGATACATACACATGCACACACACTCACACCAGTATGTATTGCAATATGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATACATACACATGCACACACACTCACACCAGTATGTATTGCAATATGA  100

seq1  CAGCTTACAGTTCTTTCATTCTTTGGTGTTATATTTTGGCTCAAAATACA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTTACAGTTCTTTCATTCTTTGGTGTTATATTTTGGCTCAAAATACA  150

seq1  ACAACCCTAATAGAAATGCAATAAAATAAGAACTTAATATCCAGTATATT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAACCCTAATAGAAATGCAATAAAATAAGAACTTAATATCCAGTATATT  200

seq1  AATTTCCGATACTCTAAAATCAATTTACTATGAAGGAAGAACAAATAATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTTCCGATACTCTAAAATCAATTTACTATGAAGGAAGAACAAATAATT  250

seq1  GGTATGTTTTTCAATATACTTTAATTTTAAAATATCCTAACAGTAGAAAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATGTTTTTCAATATACTTTAATTTTAAAATATCCTAACAGTAGAAAT  300

seq1  GAACTTCAAAACACTTTCAAATAATACAAGTTTTTAATAAAAAGTAATCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTTCAAAACACTTTCAAATAATACAAGTTTTTAATAAAAAGTAATCT  350

seq1  TAAATTTTATTGTTTTTCTTCTACTTTAAGGTTACTAATTATACTTTAAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATTTTATTGTTTTTCTTCTACTTTAAGGTTACTAATTATACTTTAAC  400

seq1  TTTGGTAATCTATATAGATTTTGTTTGTTTGTTTATTATTTACTTTCTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGGTAATCTATATAGATTTTGTTTGTTTGTTTATTATTTACTTTCTTT  450

seq1  CCCCAACACCTGAAAACAAGGAAAAAAGGAATTGCAGTCAACTTTTTACA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAACACCTGAAAACAAGGAAAAAAGGAATTGCAGTCAACTTTTTACA  500

seq1  AGAATATTTAAATATGCCTTAAGTACGAGGTAAAGACTAATAGAATTTTT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATATTTAAATATGCCTTAAGTACGAGGTAAAGACTAATAGAATTTTT  550

seq1  ATTTTTCATGAACAATCGCCCAAAACTGTGAATTTCTTTTCTAGTAGATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTCATGAACAATCGCCCAAAACTGTGAATTTCTTTTCTAGTAGATT  600

seq1  TAAGATTAGCTATGCCAACTTCCTTCAAATTTCTATTACCTCTATATTCC  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGATTAGCTATGCCAACTTCCTTCAAATTTCTATTACCTCTATATTCC  650

seq1  TATTTTCAAGAAGGAGTTGCTATTAATATCATCATTTAATGTGAGTTACT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTCAAGAAGGAGTTGCTATTAATATCATCATTTAATGTGAGTTACT  700

seq1  ATATTGGAAAATTAATATAAGAAAAAAAGTGTATCTTTTTATTTCTATTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGGAAAATTAATATAAGAAAAAAAGTGTATCTTTTTATTTCTATTT  750

seq1  TCAACAAGGAGTTGCTATTAATAAGAGTTAATGTGAGCCATCATGCTACA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAACAAGGAGTTGCTATTAATAAGAGTTAATGTGAGCCATCATGCTACA  800

seq1  AAACTAATATAAGAAAAAGGCTTAAAATGTTCAAATAGATATCAGGCTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTAATATAAGAAAAAGGCTTAAAATGTTCAAATAGATATCAGGCTAG  850

seq1  GTTATGTTACCCTGGTCCAATTAACTGAACTGCTATAAAATAGATACAAC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTATGTTACCCTGGTCCAATTAACTGAACTGCTATAAAATAGATACAAC  900

seq1  TTGTTCTTACAGAGCAAGGAAGAATGTTTCCATTACGTTGCTAAATTCAA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTCTTACAGAGCAAGGAAGAATGTTTCCATTACGTTGCTAAATTCAA  950

seq1  CTGTTTATTTTATTGATAAATAAACTAGAGGAAGTTCTTCAAGGGGTTTA  1000
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  CTGTTTATTTTATTGATAAATAAACTAGAGGAAG-TCTTCAAGGGGTTTA  999

seq1  TTGTGTGGATGCTATCTGGCTTATACAAATTAAAGCTCATAGTACATATT  1050
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGTGGATGCTATCTGGCTTATACAAATTAAAGCTCATAGTACATATT  1049

seq1  CAATATATA-TGTAATATATTCTGTACTG-TTTCTGCCATTATTGTCAAG  1098
      | ||||||| ||||||||||||||||||| |||||| |||||||||| ||
seq2  C-ATATATATTGTAATATATTCTGTACTGTTTTCTG-CATTATTGTCCAG  1097

seq1  CTAAGCAGAGTTAGAAAGAA-TAGATTTATTTTGAGAATCATATTAAAAT  1147
      ||| |||||| ||||||||| ||||||   ||||||| || ||||  || 
seq2  CTAGGCAGAG-TAGAAAGAATTAGATT--ATTTGAGATTC-TATTTGAAA  1143

seq1  ATCAACTTGGTAGACCGGGAGGGGTATAAAATCTGGAGTGTAAAAAAAAA  1197
      ||||  |||||| | |||||||| ||| ||||||||||||| | ||||  
seq2  ATCACTTTGGTA-AACGGGAGGGTTAT-AAATCTGGAGTGTCACAAAAGC  1191

seq1  AAAGATTAAATAAAATTTAACAAAATTTCTGGTCAAGAATTGAAATAG--  1245
       ||   ||| ||          |||||||| ||| |||  ||  ||||  
seq2  TAA---TAACTA---------CAAATTTCT-GTCCAGA--TG-CATAGCC  1225

seq1  CATAAAATTAA  1256
      |||||||||||
seq2  CATAAAATTAA  1236

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information