MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-208E18
Chromosome	X (Build37)
Map Location	99,619,696 - 99,734,162
singlet/doublet	doublet
Overlap gene	Hdac8, Phka1
Upstream gene	Nono, Itgb1bp2, LOC620837, Taf1, Ogt, LOC620865, LOC668291, Cxcr3, LOC632454, LOC668302, EG212753, 8030474K03Rik, LOC668308, LOC100042465, H3f3a-ps1, EG621083, Rgag4, LOC100042480, LOC331476, Pin4, LOC670921, Ercc6l, LOC668318, Rps4x, LOC100043080, Cited1
Downstream gene	LOC668331, LOC100042516, EG668339, Dmrtc1b, EG668343, LOC100043105, EG668349, EG382233, Dmrtc1c, EG668360, LOC668357, 1700031F05Rik, EG668369, Dmrtc1a, 1700011M02Rik, 1700018G05Rik, EG331480, EG668382, LOC668387, EG245545, LOC100042610, EG621205, Nap1l2, LOC668217, 4930519F16Rik, LOC100042615, Cdx4, LOC671052, Chic1, Tsx, Tsix, Xist, Rps12-ps1, LOC668406, LOC676246, ENSMUSG00000043661, LOC668412
Link	Open Mouse BAC browser

Click to get alignment info.

name	Nono (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53610 MGI:1855692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb1bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26549 MGI:1353420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Taf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270627 MGI:1336878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108155 MGI:1339639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620865
definition	note : RNA binding protein pseudogene pseudo : _no_value

name	LOC668291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cxcr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12766 MGI:1277207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1509 ESTs, 7 Proteins pseudo : _no_value

name	LOC668302 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins pseudo : _no_value

name	EG212753 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212753 MGI:3646776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	8030474K03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382231 MGI:2685988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC668308 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins pseudo : _no_value

name	LOC100042465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	H3f3a-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15079 MGI:1101782
definition	note : H3 histone, family 3A, pseudogene 1 pseudo : _no_value

name	EG621083 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621083 MGI:3645090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Rgag4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331474 MGI:3045324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC331476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:331476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	Pin4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69713 MGI:1916963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Ercc6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236930 MGI:2654144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins pseudo : _no_value

name	Rps4x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20102 MGI:98158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	Cited1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12705 MGI:108023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70315 MGI:1917565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phka1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18679 MGI:97576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins pseudo : _no_value

name	LOC100042516 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG668339 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668339 MGI:3645559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs

name	Dmrtc1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632708 MGI:3639121
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668343 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668343 MGI:3648181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 309 ESTs, 6 Proteins pseudo : _no_value

name	LOC100043105 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG668349 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668349 MGI:3648179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	EG382233 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382233 MGI:3648097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Dmrtc1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71083 MGI:1918333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	EG668360 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668360 MGI:3648387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	LOC668357 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins

name	1700031F05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73300 MGI:1920550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	EG668369 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668369 MGI:3648394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Dmrtc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70887 MGI:1918137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	1700011M02Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75443 MGI:1922693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs

name	1700018G05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69388 MGI:1916638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	EG331480 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331480 MGI:3649150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	EG668382 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668382 MGI:3644774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 16 Proteins pseudo : _no_value

name	LOC668387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 5 Proteins pseudo : _no_value

name	EG245545 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245545 MGI:3645788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 17 Proteins

name	LOC100042610 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG621205 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621205 MGI:3644890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 108 ESTs, 5 Proteins

name	Nap1l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17954 MGI:106654
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668217 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins pseudo : _no_value

name	4930519F16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75106 MGI:1922356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042615 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042615
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Cdx4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12592 MGI:88362
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC671052 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671052
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	Chic1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12212 MGI:1344694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22127 MGI:108118
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsix (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22097 MGI:1336196
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xist (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:213742 MGI:98974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Rps12-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30964 MGI:1353638
definition	gene_synonym : pS12X note : ribosomal protein S12, pseudogene 1 pseudo : _no_value

name	LOC668406 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 218 ESTs, 2 Proteins pseudo : _no_value

name	LOC676246 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	ENSMUSG00000043661 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621818 MGI:3641899
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Nono (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963530 GeneID:53610 MGI:1855692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-POU-domain-containing, octamer binding protein transcript_id : NM_023144.1

name	Itgb1bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842407 GeneID:26549 MGI:1353420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 1 binding protein 2 transcript_id : NM_013712.2

name	Taf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486595 GeneID:270627 MGI:1336878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_001081008.1

name	Ogt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909606 GeneID:108155 MGI:1339639
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) transcript_id : NM_139144.2

name	Cxcr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129823 GeneID:12766 MGI:1277207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) receptor 3 transcript_id : NM_009910.2

name	EG212753 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407689 GeneID:212753 MGI:3646776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG212753 transcript_id : XM_136015.7

name	8030474K03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271836 GeneID:382231 MGI:2685988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 8030474K03 gene transcript_id : XM_001000772.2

name	LOC100042465 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271805 GeneID:100042465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042465 transcript_id : XM_001478268.1

name	EG621083 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407693 GeneID:621083 MGI:3645090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG621083 transcript_id : XM_896183.2

name	Rgag4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387815 GeneID:331474 MGI:3045324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retrotransposon gag domain containing 4 transcript_id : NM_183318.2

name	LOC100042480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271807 GeneID:100042480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : similar to novel similar to human Nance-Horan syndrome protein (RP11-262D11.5) transcript_id : XM_001478287.1

name	LOC331476 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271809 GeneID:331476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to SUMO-1-specific protease transcript_id : XM_001478302.1

name	Pin4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931155 GeneID:69713 MGI:1916963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) transcript_id : NM_027181.1

name	Ercc6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414500 GeneID:236930 MGI:2654144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency complementation group 6 - like transcript_id : NM_146235.2

name	Rps4x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677804 GeneID:20102 MGI:98158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S4, X-linked transcript_id : NM_009094.1

name	Cited1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476051 GeneID:12705 MGI:108023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 transcript_id : NM_007709.3

name	Hdac8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801693 GeneID:70315 MGI:1917565
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 8 transcript_id : NM_027382.2

name	Phka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355008 GeneID:18679 MGI:97576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 1 transcript_id : NM_173021.2

name	Phka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679300 GeneID:18679 MGI:97576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 1 transcript_id : NM_008832.1

name	LOC100042516 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271813 GeneID:100042516
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042516 transcript_id : XM_001478363.1

name	EG668339 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407698 GeneID:668339 MGI:3645559
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs product : predicted gene, EG668339 transcript_id : XM_001001002.1

name	Dmrtc1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84993762 GeneID:632708 MGI:3639121
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1b transcript_id : NM_001039116.1

name	LOC100043105 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271839 GeneID:100043105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : similar to novel member of the doublesex and mab-3 related transcription factor (Dmrt) family transcript_id : XM_001479377.1

name	EG668349 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407703 GeneID:668349 MGI:3648179
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668349 transcript_id : XM_001001046.1

name	EG382233 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407705 GeneID:382233 MGI:3648097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG382233, transcript variant 1 transcript_id : XM_356344.5

name	Dmrtc1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407710 GeneID:71083 MGI:1918333
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : DMRT-like family C1c transcript_id : XM_001001109.1

name	EG668360 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271815 GeneID:668360 MGI:3648387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668360 transcript_id : XM_001001097.2

name	LOC668357 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407706 GeneID:668357
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 2 Proteins product : similar to Dmrtc1c protein transcript_id : XM_135517.4

name	1700031F05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407712 GeneID:73300 MGI:1920550
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 1700031F05 gene, transcript variant 1 transcript_id : XM_356346.4

name	EG668369 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407713 GeneID:668369 MGI:3648394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG668369 transcript_id : XM_001001135.1

name	Dmrtc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801315 GeneID:70887 MGI:1918137
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1a transcript_id : NM_027591.2

name	Dmrtc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490370 GeneID:70887 MGI:1918137
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1a transcript_id : NM_001038616.1

name	Dmrtc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84490366 GeneID:70887 MGI:1918137
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DMRT-like family C1a transcript_id : NM_029378.1

name	1700011M02Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271817 GeneID:75443 MGI:1922693
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 ESTs product : RIKEN cDNA 1700011M02 gene transcript_id : XM_001001147.2

name	1700018G05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407717 GeneID:69388 MGI:1916638
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : RIKEN cDNA 1700018G05 gene transcript_id : XM_920174.2

name	EG245545 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271820 GeneID:245545 MGI:3645788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 17 Proteins product : predicted gene, EG245545 transcript_id : XM_141989.6

name	EG621205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407675 GeneID:621205 MGI:3644890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 108 ESTs, 4 Proteins product : predicted gene, EG621205, transcript variant 4 transcript_id : XM_897204.2

name	EG621205 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271844 GeneID:621205 MGI:3644890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 106 ESTs, 2 Proteins product : predicted gene, EG621205 transcript_id : XM_001479423.1

name	Nap1l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679009 GeneID:17954 MGI:106654
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nucleosome assembly protein 1-like 2 transcript_id : NM_008671.1

name	4930519F16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110626033 GeneID:75106 MGI:1922356
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930519F16 gene transcript_id : NM_029170.1

name	Cdx4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802151 GeneID:12592 MGI:88362
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : caudal type homeo box 4 transcript_id : NM_007674.2

name	Chic1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:55742748 GeneID:12212 MGI:1344694
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich hydrophobic domain 1 transcript_id : NM_009767.1

name	Tsx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678450 GeneID:22127 MGI:108118
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis specific X-linked gene transcript_id : NM_009440.1

name	ENSMUSG00000043661 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113865930 GeneID:621818 MGI:3641899
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, ENSMUSG00000043661 transcript_id : NM_001045541.1

name	Nono (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963531 CCDS:CCDS30316.1 GeneID:53610 MGI:1855692
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : non-POU-domain-containing, octamer-binding protein product : non-POU-domain-containing, octamer binding protein protein_id : NP_075633.1

name	Itgb1bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305191 GeneID:26549 MGI:1353420
definition	GO_component : GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IDA] codon_start : 1 note : melusin product : integrin beta 1 binding protein 2 protein_id : NP_038740.1

name	Taf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486596 GeneID:270627 MGI:1336878
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 note : cell cycle, G1 phase defect product : TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_001074477.1

name	Ogt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909607 CCDS:CCDS30318.1 GeneID:108155 MGI:1339639
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence TAS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0008375 - acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008080 - N-acetyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence TAS] [Evidence ISS]; GO:0007584 - response to nutrient [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 note : UDP-N-acetylglucosaminyltransferase; O-linked GlcNAc transferase product : O-linked N-acetylglucosamine transferase protein_id : NP_631883.2

name	Cxcr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753458 CCDS:CCDS30319.1 GeneID:12766 MGI:1277207
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IEA]; GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004950 - chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-X-C) receptor 3 product : chemokine (C-X-C motif) receptor 3 protein_id : NP_034040.1

name	EG212753 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407690 GeneID:212753 MGI:3646776
definition	codon_start : 1 product : hypothetical protein protein_id : XP_136015.7

name	8030474K03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407692 GeneID:382231 MGI:2685988
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000772.1

name	LOC100042465 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271806 GeneID:100042465
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478318.1

name	EG621083 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83003083 GeneID:621083 MGI:3645090
definition	codon_start : 1 product : similar to novel similar to human Nance-Horan syndrome protein (RP11-262D11.5) protein_id : XP_901276.1

name	Rgag4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304005 CCDS:CCDS30320.1 GeneID:331474 MGI:3045324
definition	codon_start : 1 note : gag-like protein product : retrotransposon gag domain containing 4 protein_id : NP_899141.1

name	LOC100042480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271808 GeneID:100042480
definition	codon_start : 1 product : similar to novel similar to human Nance-Horan syndrome protein (RP11-262D11.5) protein_id : XP_001478337.1

name	LOC331476 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271810 GeneID:331476
definition	codon_start : 1 product : similar to SUMO-1-specific protease protein_id : XP_001478352.1

name	Pin4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931156 GeneID:69713 MGI:1916963
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) protein_id : NP_081457.1

name	Ercc6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414501 CCDS:CCDS30321.1 GeneID:236930 MGI:2654144
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA] codon_start : 1 note : SNF2/RAD54 family protein; excision repair cross-complementing rodent repair deficiency complementation group 6-like product : excision repair cross-complementing rodent repair deficiency complementation group 6 - like protein_id : NP_666347.2

name	Rps4x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677805 GeneID:20102 MGI:98158
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence ISS] GO_function : GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : ribosomal protein S4 X-linked product : ribosomal protein S4, X-linked protein_id : NP_033120.1

name	Cited1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671760 CCDS:CCDS30322.1 GeneID:12705 MGI:108023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence NAS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0030318 - melanocyte differentiation [Evidence IMP]; GO:0043473 - pigmentation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 product : Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 protein_id : NP_031735.1

name	Hdac8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037203 GeneID:70315 MGI:1917565
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0004407 - histone deacetylase activity [Evidence IEA] [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 8 protein_id : NP_081658.1

name	Phka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819665 CCDS:CCDS30324.1 GeneID:18679 MGI:97576
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : phosphorylase kinase alpha 1 isoform 2 protein_id : NP_766609.1

name	Phka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679301 CCDS:CCDS30323.1 GeneID:18679 MGI:97576
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : phosphorylase kinase alpha 1 isoform 1 protein_id : NP_032858.1

name	LOC100042516 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271814 GeneID:100042516
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478413.1

name	EG668339 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407699 GeneID:668339 MGI:3645559
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001001002.1

name	Dmrtc1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84993763 CCDS:CCDS30325.1 GeneID:632708 MGI:3639121
definition	codon_start : 1 exception : mismatches in translation note : doublesex and mab-3 related transcription factor 8.2 product : DMRT-like family C1b protein_id : NP_001034205.1

name	LOC100043105 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271840 GeneID:100043105
definition	codon_start : 1 product : similar to novel member of the doublesex and mab-3 related transcription factor (Dmrt) family protein_id : XP_001479427.1

name	EG668349 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407704 GeneID:668349 MGI:3648179
definition	codon_start : 1 product : similar to doublesex and mab-3 related transcription factor 8.2 protein_id : XP_001001046.1

name	EG382233 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63747891 GeneID:382233 MGI:3648097
definition	codon_start : 1 product : similar to novel member of the doublesex and mab-3 related transcription factor (Dmrt) family isoform 1 protein_id : XP_356344.2

name	Dmrtc1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271841 GeneID:71083 MGI:1918333
definition	codon_start : 1 product : DMRT-like family C1c protein_id : XP_001001109.2

name	EG668360 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271816 GeneID:668360 MGI:3648387
definition	codon_start : 1 product : similar to doublesex and mab-3 related transcription factor 8.2 protein_id : XP_001001097.2

name	LOC668357 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271842 GeneID:668357
definition	codon_start : 1 product : similar to Dmrtc1c protein protein_id : XP_135517.4

name	1700031F05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086482 GeneID:73300 MGI:1920550
definition	codon_start : 1 product : hypothetical protein LOC73300 isoform 1 protein_id : XP_356346.1

name	EG668369 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407714 GeneID:668369 MGI:3648394
definition	codon_start : 1 product : similar to doublesex and mab-3 related transcription factor 8.2 protein_id : XP_001001135.1

name	Dmrtc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490371 GeneID:70887 MGI:1918137
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform c is encoded by transcript variant 3; doublesex and mab-3 related transcription factor 8.1; likely ortologue to human doublesex-and mab-3-related transcription factor C1 (Dmrtc1) product : doublesex and mab-3 related transcription factor 8.1 isoform c protein_id : NP_001033705.1

name	Dmrtc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21735457 CCDS:CCDS30327.1 GeneID:70887 MGI:1918137
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; doublesex and mab-3 related transcription factor 8.1; likely ortologue to human doublesex-and mab-3-related transcription factor C1 (Dmrtc1) product : doublesex and mab-3 related transcription factor 8.1 isoform a protein_id : NP_081867.1

name	Dmrtc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84490367 GeneID:70887 MGI:1918137
definition	GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; doublesex and mab-3 related transcription factor 8.1; likely ortologue to human doublesex-and mab-3-related transcription factor C1 (Dmrtc1) product : doublesex and mab-3 related transcription factor 8.1 isoform b protein_id : NP_083654.1

name	1700011M02Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407716 GeneID:75443 MGI:1922693
definition	codon_start : 1 product : hypothetical protein LOC75443 protein_id : XP_001001147.1

name	1700018G05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407718 GeneID:69388 MGI:1916638
definition	codon_start : 1 product : hypothetical protein LOC69388 protein_id : XP_925267.2

name	EG245545 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271821 GeneID:245545 MGI:3645788
definition	codon_start : 1 product : similar to LOC645974 protein protein_id : XP_141989.4

name	EG621205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407676 GeneID:621205 MGI:3644890
definition	codon_start : 1 product : similar to constitutive photomorphogenic protein isoform 4 protein_id : XP_902297.2

name	EG621205 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271845 GeneID:621205 MGI:3644890
definition	codon_start : 1 product : similar to constitutive photomorphogenic protein protein_id : XP_001479473.1

name	Nap1l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679010 GeneID:17954 MGI:106654
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nucleosome assembly protein 1-like 2 protein_id : NP_032697.1

name	4930519F16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626034 GeneID:75106 MGI:1922356
definition	GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004252 - serine-type endopeptidase activity [Evidence IEA] GO_process : GO:0006508 - proteolysis [Evidence IEA] codon_start : 1 note : alternative splicing B; alternative splicing D; alternative splicing A; novel gene likely coding for a serine proteases, trypsin family/Chymotrypsin serine protease family (S1) containing protein; putative serine protease product : hypothetical protein LOC75106 protein_id : NP_083446.1

name	Cdx4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680914 CCDS:CCDS30328.1 GeneID:12592 MGI:88362
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0001568 - blood vessel development [Evidence IGI]; GO:0007275 - development [Evidence IEA]; GO:0001890 - placenta development [Evidence IGI]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 function : cdx 4 gene encoding DNA binding domain product : caudal type homeo box 4 protein_id : NP_031700.1

name	Chic1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:55742749 GeneID:12212 MGI:1344694
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : cystein-rich hydrophobic domain 1; brain X-linked product : cysteine-rich hydrophobic domain 1 protein_id : NP_033897.1

name	Tsx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678451 GeneID:22127 MGI:108118
definition	codon_start : 1 product : testis specific X-linked protein_id : NP_033466.1

name	ENSMUSG00000043661 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113865931 GeneID:621818 MGI:3641899
definition	codon_start : 1 note : BMI1-like; polycomb group ring finger 6-like product : hypothetical protein LOC621818 protein_id : NP_001039006.1

name	LOC668291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668291
definition	number : 2 pseudo : _no_value

name	LOC668291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668291
definition	number : 1 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 1 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 2 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 3 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 4 pseudo : _no_value

name	LOC100042610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042610
definition	number : 5 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 1 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 2 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 3 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 4 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 5 pseudo : _no_value

name	LOC100042615 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042615
definition	number : 6 pseudo : _no_value

name	LOC671052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671052
definition	number : 1 pseudo : _no_value

name	LOC671052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671052
definition	number : 2 pseudo : _no_value

name	LOC671052 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:671052
definition	number : 3 pseudo : _no_value

name	LOC676246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676246
definition	number : 1 pseudo : _no_value

name	LOC676246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676246
definition	number : 2 pseudo : _no_value

name	LOC668412 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668412
definition	number : 1 pseudo : _no_value

name	Rps12-ps1 (CDS detail)
type	misc_feature
link	vega ensembl
xref
definition	gene_synonym : pS12X note : S19 pseudogene pseudo : _no_value

name	LOC620837 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271835 GeneID:620837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Rnf26 protein pseudo : _no_value transcript_id : XR_034095.1

name	LOC632454 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271802 GeneID:632454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1509 ESTs, 7 Proteins product : similar to tumor protein, translationally-controlled 1 pseudo : _no_value transcript_id : XR_033588.1

name	LOC668302 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271803 GeneID:668302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : similar to hCG1984468 pseudo : _no_value transcript_id : XR_033602.1

name	LOC668308 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271804 GeneID:668308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : similar to hCG1984468 pseudo : _no_value transcript_id : XR_033611.1

name	LOC670921 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271837 GeneID:670921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Hmgb1 protein pseudo : _no_value transcript_id : XR_034127.1

name	LOC668318 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271811 GeneID:668318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins product : similar to PNG protein pseudo : _no_value transcript_id : XR_033639.1

name	LOC100043080 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271838 GeneID:100043080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to 60S ribosomal protein L34 pseudo : _no_value transcript_id : XR_034133.1

name	LOC668331 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271812 GeneID:668331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : similar to transcriptional adaptor 3-like pseudo : _no_value transcript_id : XR_033649.1

name	EG668343 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407700 GeneID:668343 MGI:3648181
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 309 ESTs, 6 Proteins product : predicted gene, EG668343 pseudo : _no_value transcript_id : XR_002167.1

name	EG331480 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407719 GeneID:331480 MGI:3649150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : predicted gene, EG331480 transcript_id : XR_002365.1

name	EG668382 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271819 GeneID:668382 MGI:3644774
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 16 Proteins product : predicted gene, EG668382 pseudo : _no_value transcript_id : XR_033707.1

name	LOC668387 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271843 GeneID:668387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 ESTs, 5 Proteins product : similar to ribosomal protein S6 pseudo : _no_value transcript_id : XR_034189.1

name	LOC668217 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271846 GeneID:668217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 5 Proteins product : similar to RIKEN cDNA 1700029P11 gene pseudo : _no_value transcript_id : XR_034207.1

name	Tsix (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:84872141 GeneID:22097 MGI:1336196
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : X (inactive)-specific transcript, antisense transcript_id : NR_002844.1

name	Xist (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:37704376 GeneID:213742 MGI:98974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inactive X specific transcripts transcript_id : NR_001570.1

name	Xist (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:37704378 GeneID:213742 MGI:98974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : inactive X specific transcripts transcript_id : NR_001463.2

name	LOC668406 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271847 GeneID:668406
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 218 ESTs, 2 Proteins product : similar to ribosomal protein S12 pseudo : _no_value transcript_id : XR_034219.1

clone name	MSMg01-209E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161C14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052A19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-123E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-263L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529C20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-197I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-146I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273D03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221I15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-180H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-111J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006L23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-081H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-331K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112I11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230G12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334P11
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-208E18.b	B6Ng01-208E18.g
ACC	GA027216	GA027217
length	719	1,203
definition	B6Ng01-208E18.b	B6Ng01-208E18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(99,619,696 - 99,620,412)	(99,732,958 - 99,734,162)
sequence	gaattcattggtgcataagtcagcatatgttatgtcagttcccaccaggc aagcagctggctcattctgctagtactagttatcaaaaccgcccttgacc caacagcagacaagtacttgtttttgtccttcttccgtacagctctcgac tgtgactgctcccaaagtcatcatcatacacagcattttaggcaataggc aaaacattattaagacagttttaaatcatattcacatatagctacacgag tttcacgtatgcttggtaaatgccctatcaggaagtcacacctccagctc tattcatgcttttagatgacaatgcttaatatttctttcctccaaacttt gtgagtatggtatgggtatggtattctgggttgggagtgactttggtgaa attgttattgtcttggtttatataaagtctctatactggaggcacaaggt tccatttgagggaagtgacatgccgaagacaggaatgctactattccttt atattggttgataaagggccaacttacaatgccaattctactagctccca taaaacgtacaggaagcttatataaaatcatggacctctgtctttaatat caaatgacccagggacatctaacatgaaaattgtcatttcaaaaaaaaaa aaaaacccttcagctctttttgatggtattagaaaacattcacataatat ttccatatcccagtctatt	gaattcagaaacacctgcccagggatgacaccacccacagtgacctaggc cctcccattatcaatcattaatcaaaaagtgcccccacaggacttgccag agccactccctccattgagggtcccttttcccagatgcttctagctctta ctgggttgaccaaaaaactaagcaacacaatataattattcagtaataaa cctcagcaatgataaaactctcagtcattctttactgttccttgcctgta atagtcttcctgttggcatcatcaaaatcgtttgcaggaggtgcttctga gtagctactaactcagtagtgccgcctgcaaactagtttatcaatctcta ctcttgaagactgatgtcccctctgatttccaaacagtcactgattatat tgctcacttaagcagtgctatacaccatattttgttgtttttatttttta attttattttatttctcctgtttacatgttctatctctctaaaattaatg gtaaacctttcaatgtcaggtgctgtgtgtcatacttgcttgtactaata tggcttaaaatgatgacctatatgcagttcccttcaaaaaatgactactg ttgatgaacacattcaagttctccttagtattcttaataaattcacagac tcatctctgtgaataccatatacactgaaagcttttgagtttaactgtga gcatgtacattcattgctattttctgaatgccttccatttctcttgttaa ctttcattcttttcaccttcaaataaagactgtagggagttatgcaacag tgtggaaacagaatgaagaagaaagtaacgagacagctaatctacaatct aggtagtctgttgtagccgtccagcagccatggacgaatgggtacctgaa ggggagctggaaataaaaaggacaggatgcgagaagaaggatgaagccga gaacaaaggttctgatcaaggctccaagttatattcatcacttgttgttt aatataggggagatctcacagaccatttctttgtttcagctgggtttatg tgcgaagcaggtcatggggcaagtctatttctttctaagtctataggagt tgcattgtgcatcacgtagatcataagcccattgtgcaaggcacttcagg cttgtccagctgcttccttgccaagctggaggccaacagtctgtttctta aat
quality values	Open. Hide. 49 31 32 35 58 25 24 47 62 62 47 62 62 54 62 62 62 54 62 62 47 47 62 62 62 62 62 54 62 62 34 34 30 26 22 21 15 25 36 38 34 28 28 28 41 49 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 59 62 59 59 59 46 48 43 54 59 59 59 54 54 62 62 62 62 62 62 62 62 62 59 59 62 54 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 59 62 62 59 59 51 49 50 56 43 46 48 46 59 59 59 62 62 62 62 62 62 59 59 62 59 51 56 44 59 51 51 59 51 56 50 56 50 56 38 56 45 45 50 43 50 50 62 56 59 59 59 56 44 56 43 43 36 24 50 43 59 56 51 56 56 56 54 47 47 62 51 56 50 56 56 22 45 38 24 31 50 56 44 47 62 44 37 42 39 37 14 22 13 16 13 14 56 56 56 56 51 47 56 62 47 47 45 62 47 31 56 62 47 43 62 56 39 47 42 50 43 46 39 21 32 14 20 24 42 56 38 22 56 62 56 56 43 50 56 43 52 20 46 38 38 50 31 35 42 39 43 38 52 47 52 39 52 49 35 32 43 38 15 22 38 47 38 62 39 54 52 41 54 52 42 52 27 21 21 39 32 31 32 28 34 27 26 42 52 52 33 33 26 23 33 37 31 32 18 24 24 33 43 37 42 27 25 27 27 13 33 42 25 28 35 42 41 42 37 40 34 50 49 41 42 25 34 33 43 22 34 22 37 43 50 52 32 15 22 45 49 49 27 22 34 37 37 33 42 42 33 27 34 40 30 35 37 23 27 22 9 17 22 30 50 16 27 27 14 21 35 32 26 13 6 7 11 7 14 30 43 43 24 15 7 11 11 28 31 23 26 27 23 31 19 22 28 28 16 11 19 16 9 16 21 15 13 23 13 15 20 19 21 18 10 10 9	Open. Hide. 46 35 56 41 62 47 37 51 62 62 62 62 16 35 38 21 21 19 21 19 24 45 32 29 18 44 62 59 59 62 59 59 59 62 62 59 59 62 62 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 43 46 40 45 32 28 34 28 48 43 54 54 42 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 59 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 56 44 59 46 28 56 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 54 54 54 54 58 58 58 58 58 58 49 58 52 58 58 58 54 54 58 58 54 58 58 48 58 58 58 54 54 58 58 58 54 54 58 54 54 58 58 45 58 54 54 58 58 58 58 54 42 58 58 52 54 54 58 50 58 54 58 58 51 35 54 58 58 50 51 51 50 54 58 49 32 58 58 58 51 58 42 42 58 58 47 51 50 53 52 53 50 46 54 47 53 49 42 58 51 51 54 52 47 32 44 47 52 58 50 58 46 50 58 58 58 53 53 58 49 58 58 49 42 46 51 41 46 53 47 51 49 50 52 53 54 51 58 49 51 50 50 51 51 58 51 50 58 41 51 51 53 47 49 50 51 58 52 50 58 41 52 42 45 58 34 30 50 41 39 53 50 31 49 51 47 49 35 47 52 58 54 51 53 49 52 49 26 35 34 22 53 31 21 19 28 35 53 54 42 50 29 53 32 50 54 32 35 39 39 40 54 54 52 39 29 53 52 45 39 54 54 45 45 33 33 28 39 49 41 33 54 32 45 22 54 54 33 42 32 32 53 31 37 17 54 51 47 21 37 38 29 40 37 37 21 40 52 38 27 42 32 31 42 35 41 36 36 40 29 28 36 28 40 33 49 14 9 27 33 15 49 47 25 27 39 34 16 26 30 30 22 32 31 32 29 32 36 31 26 26 42 25 32 42 28 35 30 35 35 31 15 26 31 34 36 31 31 31 51 24 34 31 23 29 16 30 32 22 25 29 43 29 32 35 31 16 24 26 18 29 31 28 13 19 13 22 8 23 38 46 42 26 21 9 18 12 21 23 19 15 46 46 30 33 19 29 36 23 29 18 32 25 11 19 29 41 44 14 21 23 31 22 22 31 31 20 11 26 31 10 20 7 6 12 6 31 25 12 17 32 22 13 14 27 19 10 15 8 36 6 6 13 21 22 32 19 12 8 21 8 10 26 24 31 24 21 16 11 27 32 16 11 8 31 12 20 29 31 13 12 14 13 19 37 11 13 37 25 27 16 19 7 12 5 7 19 6 43 20 7 5 7 5 6 10 21 40 48 9 20 15 15 17 21 13 19 5 4 5 5 13 13 29 7 23 34 19 8 24 36 6 7 8 34 31 18 24 11 27 10 15 20 17 21 47 24 15 10 7 14 4 7 11 16 23 13 16 10 7 7 6 10 4 10 7 28 28 17 6 8 6 5 4 10 26 20 27 17 4 5 5 28 7 6 11 12 12 11 27 14 9 8 6 4 22 8 21 7 11 15 14 24 5 5 5 8 5 6 18 21 9 12 6 23 10 11 13 9 18 17 9 7 11 5 12 4 17 23 15 4 7 6 4 4 3 3 7 15 9 5 11 16 8 5 10 6 17 5 7 1 2 4 4 15 4 7 17 4 5 3 6 7 5 5 14 16 10 5 4 10 8 5 8 11 2 3 5 3 2 2 11 5 6 9 8 4 6 6 6 9 12 8 5 11 11 7 7 22 7 29 4 6

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_99619696_99620412
seq2: B6Ng01-208E18.b_43_761

seq1  GAATTCATTGGTGCATAAGTCAGCATATGTTATGTCAGTTCCCACCAGGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATTGGTGCATAAGTCAGCATATGTTATGTCAGTTCCCACCAGGC  50

seq1  AAGCAGCTGGCTCATTCTGCTAGTACTAGTTATCAAAACCGCCCTTGACC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGCTGGCTCATTCTGCTAGTACTAGTTATCAAAACCGCCCTTGACC  100

seq1  CAACAGCAGACAAGTACTTGTTTTTGTCCTTCTTCCGTACAGCTCTCGAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAACAGCAGACAAGTACTTGTTTTTGTCCTTCTTCCGTACAGCTCTCGAC  150

seq1  TGTGACTGCTCCCAAAGTCATCATCATACACAGCATTTTAGGCAATAGGC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGACTGCTCCCAAAGTCATCATCATACACAGCATTTTAGGCAATAGGC  200

seq1  AAAACATTATTAAGACAGTTTTAAATCATATTCACATATAGCTACACGAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACATTATTAAGACAGTTTTAAATCATATTCACATATAGCTACACGAG  250

seq1  TTTCACGTATGCTTGGTAAATGCCCTATCAGGAAGTCACACCTCCAGCTC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCACGTATGCTTGGTAAATGCCCTATCAGGAAGTCACACCTCCAGCTC  300

seq1  TATTCATGCTTTTAGATGACAATGCTTAATATTTCTTTCCTCCAAACTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTCATGCTTTTAGATGACAATGCTTAATATTTCTTTCCTCCAAACTTT  350

seq1  GTGAGTATGGTATGGGTATGGTATTCTGGGTTGGGAGTGACTTTGGTGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGTATGGTATGGGTATGGTATTCTGGGTTGGGAGTGACTTTGGTGAA  400

seq1  ATTGTTATTGTCTTGGTTTATATAAAGTCTCTATACTGGAGGCACAAGGT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTTATTGTCTTGGTTTATATAAAGTCTCTATACTGGAGGCACAAGGT  450

seq1  TCCATTTGAGGGAAGTGACATGCCGAAGACAGGAATGCTACTATTCCTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATTTGAGGGAAGTGACATGCCGAAGACAGGAATGCTACTATTCCTTT  500

seq1  ATATTGGTTGATAAAGGGCCAACTTACAATGCCAATTCTACTAGCTCCCA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATTGGTTGATAAAGGGCCAACTTACAATGCCAATTCTACTAGCTCCCA  550

seq1  TAAAACGTACAGGAAGCTTATATAAAATCATGGACCTCTGTCTTTAATAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAACGTACAGGAAGCTTATATAAAATCATGGACCTCTGTCTTTAATAT  600

seq1  CAAATGACCCAGGGACATCTAACATG-AAATTGTCATTTCAAAAAAAAAA  649
      |||||||||||||||||||||||||| |||||||||||||||||||||||
seq2  CAAATGACCCAGGGACATCTAACATGAAAATTGTCATTTCAAAAAAAAAA  650

seq1  AAAAACCCTTCAGCTCTTTTTGATGGTATTAGAAAACATTCACATAATAT  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAACCCTTCAGCTCTTTTTGATGGTATTAGAAAACATTCACATAATAT  700

seq1  TTCCATAT-CCAGTCTATT  717
      |||||||| ||||||||||
seq2  TTCCATATCCCAGTCTATT  719

seq1: chrX_99732958_99734162
seq2: B6Ng01-208E18.g_65_1267 (reverse)

seq1  ATTTAAG-AACAGACTG-TGGCCTTCCCCAGCCTTGGCAGGGAAGCAGGC  48
      ||||||| ||||||||| ||||||   |||| ||||||| ||||||| ||
seq2  ATTTAAGAAACAGACTGTTGGCCT---CCAG-CTTGGCAAGGAAGCA-GC  45

seq1  TGAACAGACCTTGAGTGCTTGCCACAATGGGCTTAATGATCTACGTGATT  98
      || |||  |||  ||||| |  |||||||||||| ||||||||||||| |
seq2  TGGACAAGCCTGAAGTGCCTTGCACAATGGGCTT-ATGATCTACGTGA-T  93

seq1  GCAC-ATGCAACTCCTATAGGAACTTAGAA--GAATAGAC-TGCCCAATG  144
      |||| |||||||||||||||  ||||||||   ||||||| ||||| |||
seq2  GCACAATGCAACTCCTATAG--ACTTAGAAAGAAATAGACTTGCCCCATG  141

seq1  ACCTTGCTTCGCAACATAAA-CCAGCTGAAACAAAGAATGGGTCTGTGAG  193
      ||| |||||||| ||||||| |||||||||||||||||  ||||||||||
seq2  ACC-TGCTTCGC-ACATAAACCCAGCTGAAACAAAGAAATGGTCTGTGAG  189

seq1  ATCT-CCCTATA-TAAACA--CAGTGATGAATATTAAACTTGGAGCCTTG  239
      |||| ||||||| ||||||   ||||||||||||  ||||||||||||||
seq2  ATCTCCCCTATATTAAACAACAAGTGATGAATAT--AACTTGGAGCCTTG  237

seq1  ATCAGAACCTTTG-TCTCGGCTTCATCCTTC-TCTCGCATCCTGTCCTTT  287
      ||||||||||||| ||||||||||||||||| ||||||||||||||||||
seq2  ATCAGAACCTTTGTTCTCGGCTTCATCCTTCTTCTCGCATCCTGTCCTTT  287

seq1  TTATTTCCAGCTCCCCTTTCAGGTACCCATTTCGTCCATGGCTGCTGGAC  337
      |||||||||||||||| |||||||||||| ||||||||||||||||||||
seq2  TTATTTCCAGCTCCCC-TTCAGGTACCCA-TTCGTCCATGGCTGCTGGAC  335

seq1  GGCTACAACAGACTACCTAGATTGTAGATTAGCTGTCTCGTTACTTTCTT  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCTACAACAGACTACCTAGATTGTAGATTAGCTGTCTCGTTACTTTCTT  385

seq1  CTTCATTCTGTTTCCACACTGTTGCATAACTCCCTACAGTCTTTATTTGA  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCATTCTGTTTCCACACTGTTGCATAACTCCCTACAGTCTTTATTTGA  435

seq1  AGGTGAAAAGAATGAAAGTTAACAAGAGAAATGGAAGGCATTCAGAAAAT  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGAAAAGAATGAAAGTTAACAAGAGAAATGGAAGGCATTCAGAAAAT  485

seq1  AGCAATGAATGTACATGCTCACAGTTAAACTCAAAAGCTTTCAGTGTATA  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAATGAATGTACATGCTCACAGTTAAACTCAAAAGCTTTCAGTGTATA  535

seq1  TGGTATTCACAGAGATGAGTCTGTGAATTTATTAAGAATACTAAGGAGAA  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTATTCACAGAGATGAGTCTGTGAATTTATTAAGAATACTAAGGAGAA  585

seq1  CTTGAATGTGTTCATCAACAGTAGTCATTTTTTGAAGGGAACTGCATATA  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAATGTGTTCATCAACAGTAGTCATTTTTTGAAGGGAACTGCATATA  635

seq1  GGTCATCATTTTAAGCCATATTAGTACAAGCAAGTATGACACACAGCACC  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCATCATTTTAAGCCATATTAGTACAAGCAAGTATGACACACAGCACC  685

seq1  TGACATTGAAAGGTTTACCATTAATTTTAGAGAGATAGAACATGTAAACA  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACATTGAAAGGTTTACCATTAATTTTAGAGAGATAGAACATGTAAACA  735

seq1  GGAGAAATAAAATAAAATTAAAAAATAAAAACAACAAAATATGGTGTATA  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAAATAAAATAAAATTAAAAAATAAAAACAACAAAATATGGTGTATA  785

seq1  GCACTGCTTAAGTGAGCAATATAATCAGTGACTGTTTGGAAATCAGAGGG  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGCTTAAGTGAGCAATATAATCAGTGACTGTTTGGAAATCAGAGGG  835

seq1  GACATCAGTCTTCAAGAGTAGAGATTGATAAACTAGTTTGCAGGCGGCAC  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACATCAGTCTTCAAGAGTAGAGATTGATAAACTAGTTTGCAGGCGGCAC  885

seq1  TACTGAGTTAGTAGCTACTCAGAAGCACCTCCTGCAAACGATTTTGATGA  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGAGTTAGTAGCTACTCAGAAGCACCTCCTGCAAACGATTTTGATGA  935

seq1  TGCCAACAGGAAGACTATTACAGGCAAGGAACAGTAAAGAATGACTGAGA  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCAACAGGAAGACTATTACAGGCAAGGAACAGTAAAGAATGACTGAGA  985

seq1  GTTTTATCATTGCTGAGGTTTATTACTGAATAATTATATTGTGTTGCTTA  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTATCATTGCTGAGGTTTATTACTGAATAATTATATTGTGTTGCTTA  1035

seq1  GTTTTTTGGTCAACCCAGTAAGAGCTAGAAGCATCTGGGAAAAGGGACCC  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTTTGGTCAACCCAGTAAGAGCTAGAAGCATCTGGGAAAAGGGACCC  1085

seq1  TCAATGGAGGGAGTGGCTCTGGCAAGTCCTGTGGGGGCACTTTTTGATTA  1137
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATGGAGGGAGTGGCTCTGGCAAGTCCTGTGGGGGCACTTTTTGATTA  1135

seq1  ATGATTGATAATGGGAGGGCCTAGGTCACTGTGGGTGGTGTCATCCCTGG  1187
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGATTGATAATGGGAGGGCCTAGGTCACTGTGGGTGGTGTCATCCCTGG  1185

seq1  GCAGGTGTTTCTGAATTC  1205
      ||||||||||||||||||
seq2  GCAGGTGTTTCTGAATTC  1203

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information