MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-213J16
Chromosome	X (Build37)
Map Location	9,521,957 - 9,657,855
singlet/doublet	doublet
Overlap gene	Sytl5, LOC436194, Srpx
Upstream gene	LOC673817, LOC331380, EG434726, LOC100043940, EG434727, LOC436190, LOC100042782, EG668980, Fthl17, LOC100043942, EG434728, LOC100043943, LOC385316, EG434729, LOC100043944, LOC628008, 4930402K13Rik, EG436193, Lancl3, Xk, 1700012L04Rik, EG628040, LOC100042834, LOC100042839, Rp23-423l11.5, Cybb, EG333452, LOC100042867, Dynlt3, 1700054O13Rik, 4930557A04Rik
Downstream gene	Rpgr, Otc, 4933416E14Rik, Tspan7, EG546265, LOC633354, LOC633361, LOC100042912, Mid1ip1, LOC668982, Ppia-psx_105.1
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC673817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC331380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:331380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG434726 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434726 MGI:3642940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins

name	LOC100043940 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	EG434727 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434727 MGI:3704135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 13 Proteins

name	LOC436190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC100042782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins

name	EG668980 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668980 MGI:3648373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 4 Proteins pseudo : _no_value

name	Fthl17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83457 MGI:1933180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	EG434728 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434728 MGI:3704136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 15 Proteins

name	LOC100043943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC385316 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG434729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434729 MGI:3642941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC628008 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 16 Proteins pseudo : _no_value

name	4930402K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75775 MGI:1923025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	EG436193 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436193 MGI:3643671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins

name	Lancl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236285 MGI:2443335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22439 MGI:103569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76383 MGI:1923633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628040 MGI:3648590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 261 ESTs, 3 Proteins

name	LOC100042834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC100042839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Rp23-423l11.5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins

name	Cybb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13058 MGI:88574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG333452 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333452 MGI:3643069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC100042867 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Dynlt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67117 MGI:1914367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700054O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930557A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Sytl5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236643 MGI:2668451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436194 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436194
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	Srpx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:51795 MGI:1858306
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpgr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19893 MGI:1344037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otc (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18416 MGI:97448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4933416E14Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71180 MGI:1918430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Tspan7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21912 MGI:1298407
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG546265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins

name	LOC633354 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	LOC633361 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633361
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 59 Proteins pseudo : _no_value

name	LOC100042912 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Mid1ip1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68041 MGI:1915291
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668982 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins pseudo : _no_value

name	Ppia-psx_105.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547156
definition	note : peptidylprolyl isomerase A pseudogene x_105.1 pseudo : _no_value

name	EG434726 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270952 GeneID:434726 MGI:3642940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins product : predicted gene, EG434726 transcript_id : XM_486615.4

name	EG434727 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270953 GeneID:434727 MGI:3704135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 13 Proteins product : predicted gene, EG434727 transcript_id : XM_486616.4

name	LOC100042782 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270954 GeneID:100042782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins product : similar to ferritin, heavy polypeptide-like 17 transcript_id : XM_001476385.1

name	Fthl17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752592 GeneID:83457 MGI:1933180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin, heavy polypeptide-like 17 transcript_id : NM_031261.1

name	EG434728 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270956 GeneID:434728 MGI:3704136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 15 Proteins product : predicted gene, EG434728 transcript_id : XM_486618.4

name	EG434729 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662778 GeneID:434729 MGI:3642941
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434729 transcript_id : NM_001038697.1

name	4930402K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407002 GeneID:75775 MGI:1923025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4930402K13 gene transcript_id : XM_135594.5

name	EG436193 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51830682 GeneID:436193 MGI:3643671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins product : predicted gene, EG436193 transcript_id : XM_488319.1

name	Lancl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373066 GeneID:236285 MGI:2443335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LanC lantibiotic synthetase component C-like 3 (bacterial) transcript_id : NM_173414.2

name	Xk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053936 GeneID:22439 MGI:103569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kell blood group precursor (McLeod phenotype) homolog transcript_id : NM_023500.2

name	1700012L04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350916 GeneID:76383 MGI:1923633
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012L04 gene transcript_id : NM_029588.2

name	EG628040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407003 GeneID:628040 MGI:3648590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 261 ESTs, 3 Proteins product : predicted gene, EG628040 transcript_id : XM_892769.2

name	LOC100042834 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270958 GeneID:100042834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100042834 transcript_id : XM_001476540.1

name	LOC100042839 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270960 GeneID:100042839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100042839 transcript_id : XM_001476550.1

name	Rp23-423l11.5 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407004 GeneID:547154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins product : Novel protein similar to histone H2a (1700012L04Rik) transcript_id : XM_622011.3

name	Cybb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227198 GeneID:13058 MGI:88574
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-245, beta polypeptide transcript_id : NM_007807.3

name	EG333452 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270962 GeneID:333452 MGI:3643069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG333452 transcript_id : XM_285588.6

name	LOC100042867 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270963 GeneID:100042867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100042867 transcript_id : XM_001476632.1

name	Dynlt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364447 GeneID:67117 MGI:1914367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain Tctex-type 3 transcript_id : NM_025975.4

name	1700054O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385599 GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700054O13 gene transcript_id : NM_026096.1

name	4930557A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271037 GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4930557A04 gene transcript_id : XM_001481251.1

name	Sytl5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343248 GeneID:236643 MGI:2668451
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synaptotagmin-like 5 transcript_id : NM_177704.2

name	Srpx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367987 GeneID:51795 MGI:1858306
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sushi-repeat-containing protein transcript_id : NM_016911.3

name	Rpgr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755347 GeneID:19893 MGI:1344037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retinitis pigmentosa GTPase regulator transcript_id : NM_011285.1

name	Otc (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803523 GeneID:18416 MGI:97448
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ornithine transcarbamylase transcript_id : NM_008769.3

name	Tspan7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662760 GeneID:21912 MGI:1298407
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : tetraspanin 7 transcript_id : NM_019634.2

name	EG546265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407006 GeneID:546265 MGI:3647036
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 mRNAs, 779 ESTs, 6 Proteins product : predicted gene, EG546265 transcript_id : XM_620954.3

name	LOC633354 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271039 GeneID:633354
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : similar to lactate dehydrogenase 1, A chain transcript_id : XM_001481252.1

name	LOC100042912 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270966 GeneID:100042912
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : hypothetical protein LOC100042912 transcript_id : XM_001476973.1

name	Mid1ip1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801493 GeneID:68041 MGI:1915291
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Mid1 interacting protein 1 (gastrulation specific G12-like (zebrafish)) transcript_id : NM_026524.3

name	EG434726 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830623 GeneID:434726 MGI:3642940
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486615.1

name	EG434727 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830625 GeneID:434727 MGI:3704135
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486616.1

name	LOC100042782 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270955 GeneID:100042782
definition	codon_start : 1 product : similar to ferritin, heavy polypeptide-like 17 protein_id : XP_001476435.1

name	Fthl17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752593 CCDS:CCDS30003.1 GeneID:83457 MGI:1933180
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ferritin, heavy polypeptide-like 17 protein_id : NP_112551.1

name	EG434728 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830627 GeneID:434728 MGI:3704136
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486618.1

name	EG434729 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662779 GeneID:434729 MGI:3642941
definition	codon_start : 1 note : Novel protein similar to ferritin, heavy polypeptide-like 17, Fthl17 product : ferritin, heavy polypeptide-like protein_id : NP_001033786.1

name	4930402K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830631 GeneID:75775 MGI:1923025
definition	codon_start : 1 product : hypothetical protein LOC75775 protein_id : XP_135594.3

name	EG436193 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830683 GeneID:436193 MGI:3643671
definition	codon_start : 1 product : similar to ferritin heavy chain protein_id : XP_488319.1

name	Lancl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734148 CCDS:CCDS30007.1 GeneID:236285 MGI:2443335
definition	codon_start : 1 exception : mismatches in translation product : LanC lantibiotic synthetase component C-like 3 protein_id : NP_775590.1

name	Xk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963703 CCDS:CCDS30008.1 GeneID:22439 MGI:103569
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : McLeod syndrome gene homolog product : Kell blood group precursor (McLeod phenotype) homolog protein_id : NP_075989.1

name	1700012L04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386420 GeneID:76383 MGI:1923633
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] codon_start : 1 note : Novel protein similar to histone H2a (1700012L04Rik) product : histone variant H2al1 protein_id : NP_083864.1

name	EG628040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999846 GeneID:628040 MGI:3648590
definition	codon_start : 1 product : similar to Golgi autoantigen, golgin subfamily a, 7 protein_id : XP_897862.1

name	LOC100042834 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270959 GeneID:100042834
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476590.1

name	LOC100042839 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270961 GeneID:100042839
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476600.1

name	Rp23-423l11.5 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63743381 GeneID:547154
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622011.1

name	Cybb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542440 CCDS:CCDS30010.1 GeneID:13058 MGI:88574
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytochrome b-245, beta polypeptide protein_id : NP_031833.2

name	EG333452 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086068 GeneID:333452 MGI:3643069
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285588.2

name	LOC100042867 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270964 GeneID:100042867
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476682.1

name	Dynlt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543851 CCDS:CCDS30011.1 GeneID:67117 MGI:1914367
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : T-complex associated-testis-expressed 1-like; vt-complex-associated-testis-expressed 1-like product : t-complex-associated-testis-expressed 1-like protein_id : NP_080251.3

name	1700054O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385600 CCDS:CCDS30012.1 GeneID:67334 MGI:1914584
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : Huntingtin interacting protein M protein_id : NP_080372.1

name	4930557A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271038 GeneID:385317 MGI:1922521
definition	codon_start : 1 product : hypothetical protein LOC385317 protein_id : XP_001481301.1

name	Sytl5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244488 GeneID:236643 MGI:2668451
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0017137 - Rab GTPase binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006887 - exocytosis [Evidence IDA]; GO:0006886 - intracellular protein transport [Evidence IEA] codon_start : 1 product : synaptotagmin-like 5 protein_id : NP_808372.1

name	Srpx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8394362 CCDS:CCDS30013.1 GeneID:51795 MGI:1858306
definition	GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : sushi-repeat-containing protein, X chromosome product : sushi-repeat-containing protein, X-chromosome protein_id : NP_058607.1

name	Rpgr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755348 CCDS:CCDS30014.1 GeneID:19893 MGI:1344037
definition	GO_component : GO:0005929 - cilium [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IDA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0005507 - copper ion binding [Evidence IEA]; GO:0004129 - cytochrome-c oxidase activity [Evidence IEA]; GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0042462 - eye photoreceptor cell development [Evidence IMP]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007601 - visual perception [Evidence ISS] [Evidence IMP] codon_start : 1 product : retinitis pigmentosa GTpase regulator protein_id : NP_035415.1

name	Otc (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679184 CCDS:CCDS30015.1 GeneID:18416 MGI:97448
definition	GO_component : GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA]; GO:0009348 - ornithine carbamoyltransferase complex [Evidence IEA] GO_function : GO:0016597 - amino acid binding [Evidence IEA]; GO:0016743 - carboxyl- and carbamoyltransferase activity [Evidence IEA]; GO:0004585 - ornithine carbamoyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008652 - amino acid biosynthesis [Evidence IEA]; GO:0006520 - amino acid metabolism [Evidence IEA]; GO:0006526 - arginine biosynthesis [Evidence IEA]; GO:0000050 - urea cycle [Evidence IEA] codon_start : 1 note : sparse fur product : ornithine transcarbamylase protein_id : NP_032795.1

name	Tspan7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662761 CCDS:CCDS30016.1 GeneID:21912 MGI:1298407
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : transmembrane 4 superfamily member 2 product : tetraspanin 7 protein_id : NP_062608.2

name	EG546265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999865 GeneID:546265 MGI:3647036
definition	codon_start : 1 product : similar to Chain A, Crystal Structure Of Human Rangap1-Ubc9 protein_id : XP_620954.2

name	LOC633354 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271040 GeneID:633354
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481302.1

name	LOC100042912 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270967 GeneID:100042912
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477023.1

name	Mid1ip1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386020 CCDS:CCDS30018.1 GeneID:68041 MGI:1915291
definition	GO_component : GO:0005874 - microtubule [Evidence IEA]; GO:0015630 - microtubule cytoskeleton [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0007026 - negative regulation of microtubule depolymerization [Evidence IGI] codon_start : 1 product : Mid1 interacting protein protein_id : NP_080800.1

name	LOC673817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673817
definition	number : 1 pseudo : _no_value

name	LOC673817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673817
definition	number : 2 pseudo : _no_value

name	LOC331380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:331380
definition	number : 1 pseudo : _no_value

name	LOC385316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385316
definition	number : 2 pseudo : _no_value

name	LOC385316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385316
definition	number : 1 pseudo : _no_value

name	LOC100043944 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043944
definition	number : 2 pseudo : _no_value

name	LOC100043944 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043944
definition	number : 1 pseudo : _no_value

name	LOC436194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436194
definition	number : 1 pseudo : _no_value

name	LOC436194 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436194
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 2 pseudo : _no_value

name	LOC633361 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:633361
definition	number : 1 pseudo : _no_value

name	LOC100043940 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271032 GeneID:100043940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to zinc finger protein 161 pseudo : _no_value transcript_id : XR_035061.1

name	LOC436190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271033 GeneID:436190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to zinc finger 5 protein pseudo : _no_value transcript_id : XR_035711.1

name	EG668980 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271034 GeneID:668980 MGI:3648373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 4 Proteins product : predicted gene, EG668980 pseudo : _no_value transcript_id : XR_002278.2

name	LOC100043942 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271035 GeneID:100043942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to zinc finger 5 protein pseudo : _no_value transcript_id : XR_035064.1

name	LOC100043943 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271036 GeneID:100043943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to zinc finger protein 161 pseudo : _no_value transcript_id : XR_035065.1

name	LOC628008 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270957 GeneID:628008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 16 Proteins product : similar to ferritin, heavy polypeptide-like 17 pseudo : _no_value transcript_id : XR_032749.1

name	4933416E14Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270965 GeneID:71180 MGI:1918430
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : RIKEN cDNA 4933416E14 gene transcript_id : XR_032962.1

name	LOC668982 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:94407008 GeneID:668982
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 7 Proteins product : similar to High mobility group box 1 pseudo : _no_value transcript_id : XR_002281.1

clone name	MSMg01-459K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-335A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-064M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-478O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-397G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217B02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-395B24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-194B09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-136O20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-375B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-387J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326L14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414K17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415H22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-170A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334H06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187O09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-225B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-213J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223J04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-166L13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272P16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196I10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304P09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-265L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-285F06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-300K09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-213J16.b	B6Ng01-213J16.g
ACC	GA031078	GA031079
length	1,150	815
definition	B6Ng01-213J16.b	B6Ng01-213J16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(9,656,700 - 9,657,855)	(9,521,957 - 9,522,875)
sequence	gaattcagaactaagtacaaagtcactaaaaatcaaaacaaaagcaacaa acaaagccaacctgatccttgtggctggtggtgtatcacagaagcaatac atctggttcccattatgtatcatgttgaatgaatagttcatttaggcaac tggctagggtttttcattggtctcaaatctctctctactccccgccggat gctaaggaaagttatggcatgaggaaaggaacactatagttctcttccaa attctagatccttaatgaaatctcaatagaaataatgcacagtactttga ggcctcggtgattttatcaatgtagggattccaagtgaaagggagagagc ccaggaaaacccttctttgagcagtggtgaagttgtgagtggctacttta aaaacatcttttgaattagagtttcctgcaaggggagcagaattacaaat ggaattggctttaggtttagctaagggactgagtcatccatgccttagaa ttcccaatttctgagccaatgtagcattagcctttgtgtggaagaagcat tcttttcaaagaggggtaatccaaaccatatgcaggctgaggggattatg tcacatttaccctcaagtaagagatttctaaagggatcaccttttataga gagaccttataagaaaagccccctttttctttgccccctgcctgcttttt ccaccgcttcttattctgtggaaaacttttagctaatatgtatgattctt ctttgcttcacaaagcccagcatcctgagcacattgagtcttgtcgttta ctttattgtctcccttgggatgtctatttttgtaaacaagttatcaggtg ttttataggggttgatctatatattcaggttgaatataaatagaaaatgt tcttagagtagcaactaatacccattttattttctttgagccagtttttg aaattataactgaataggatgccctccattcacgtttatatcagcttgga tgtattcaacttcaagcaacagcactactctgcacagtagcttaaactga aaggacatttattgttgataaggagcacagagtagttggatctaaaggtt attttagttgctaatgagatcatcgagacccaagggtaattttaattcat	gaattctatatgtatttataccaagctctcagcaagtggattttgtttag cagtcagaaaagtgcatagattgttgatgactagatttccttctttggtc acctaacaaggaatgatatttaatgtatttatgagctggtagtgaggaga ccctgagaagatacttgtacaaggctcagggaccttgcatgccttgtaaa gaaacctgtggctgagagaaagtatgaggaaggggggctggaaataatga taatgttttccaactactatgctattaaagtgttcaaacaagttatcaac tactgcacctgtgcagtgagtagcagccaacactcagtccagttgtcata agttaatccagattggtccatctcaaagcaagggcgatctatcttcccac gtatgatttgaggagaaagaacaattttgtccagatgcatctcctacaat gaagtcgggaaggtttactctgagtagacagtgatggtgtggagcttgct tgcttttctagtctagctggtctaagcaggtgctttcaaaacagaaagaa gaaaatatttccttgttgtaagaccgaaacacaattcataaatcacactg ttttcctgatgagagtcatagatgcatgggtgcaagtatgtgtgtgtgtg tgtgtgtgtgtgtgtgcatgtgtgtgcatgtgggtgcaagtgtgtgtgtg tacttgtgggtgcaagtgtgtgtgtacatgtgcatgtggatacaattggt gtgtgtgtgtgtgtgcatatgggtgaaagtttgtgcttggcgtgtgtgtg tacatgttcctgtgt
quality values	Open. Hide. 46 15 25 38 62 24 14 47 62 62 56 62 47 62 62 62 62 54 32 62 62 62 62 48 42 54 54 62 62 62 62 13 12 28 9 10 13 18 17 19 23 23 18 18 18 50 48 59 59 62 62 59 62 62 62 62 62 59 59 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 50 46 23 32 28 25 48 38 48 40 28 28 45 43 28 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 62 62 62 62 62 49 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 49 62 62 62 54 49 54 62 62 62 62 62 62 62 54 62 62 62 54 62 62 62 62 62 62 62 59 54 62 62 62 62 54 54 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 46 38 49 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 47 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 58 58 58 58 54 35 58 58 58 58 58 58 58 58 58 58 58 54 58 45 41 58 58 58 58 54 58 58 58 58 58 54 58 58 48 58 58 49 31 58 58 58 58 42 58 54 45 58 58 58 48 54 54 54 54 54 52 52 54 54 58 58 52 58 58 41 45 58 49 58 52 54 39 58 58 51 58 47 49 48 49 58 58 46 48 58 51 44 49 54 58 58 54 52 52 50 52 58 50 58 47 45 41 54 58 51 49 50 40 58 49 49 41 49 51 50 53 58 58 58 58 58 58 58 58 52 53 52 58 41 42 42 58 39 49 58 33 58 40 58 39 51 51 58 58 58 58 50 46 50 32 46 44 49 51 54 53 53 51 41 53 50 50 52 58 58 50 51 43 58 58 58 58 40 51 58 58 38 42 41 51 51 50 58 50 50 35 58 40 38 42 49 51 29 49 51 54 32 51 36 49 51 49 45 39 50 37 26 45 38 54 38 38 40 54 39 39 39 52 37 40 39 42 45 49 30 32 39 38 42 34 53 53 53 41 31 38 53 42 37 51 29 49 42 40 54 35 32 39 53 54 37 37 39 37 53 31 46 33 32 54 52 35 32 31 52 34 39 22 34 31 35 31 32 32 52 53 53 53 41 26 32 52 32 45 31 52 32 36 32 31 34 34 29 25 32 17 51 29 51 51 31 31 31 23 14 46 46 32 22 30 30 43 24 42 31 34 43 32 36 36 42 31 30 25 28 38 18 32 26 25 33 26 24 22 33 46 31 24 32 31 31 46 37 31 18 25 8 31 28 25 22 30 22 41 28 31 27 14 30 9 25 31 18 24 29 27 30 28 31 28 21 22 48 46 18 31 32 48 48 31 36 22 28 20 17 30 18 31 32 24 27 37 46 46 46 37 24 21 48 30 19 15 15 5 5 38 27 31 31 11 5 6 25 6 25 23 24 29 11 48 16 30 24 31 16 36 22 34 22 32 11 31 48 33 33 31 19 29 22 11 9 31 13 14 25 9 11 19 30 21 22 10 33 29 12 23 31 17 25 29 13 23 28 33 10 24 7 9 5 13 12 27 32 27 24 21 23 27 32 21 10 6 6 21 24 34 21 21 15 20 15 38 15 8 16 19 11 40 8 19 9 8 6 10 23 47 14 15 17 12 28 9 26 17 28 24 20 24 11 11 3 6 27 10 13 6 5 6 6 6 14 9 13 8 11 8 9 4 10 18 8 18 19 3 12 10 14 11 8 23 28 9 16 5 20 16 13 7 6 20 16 11 15 14 4 6 18 13 16 20 4 2 5 7 11 7 4 12 3 4 11 22 11 3 3 8 9 17 17 3 3 9 7 6 9 6 18	Open. Hide. 62 44 56 44 62 62 62 56 51 19 20 22 17 13 19 28 28 34 38 28 32 21 21 28 48 48 62 62 62 59 59 62 62 62 62 54 54 62 62 54 59 62 62 62 62 62 62 59 59 62 62 62 62 62 51 34 23 56 36 36 50 35 35 49 56 56 54 59 56 54 62 62 62 62 62 62 62 59 62 54 59 59 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 59 59 59 62 62 62 59 59 59 54 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 44 49 49 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 46 62 62 62 62 62 52 58 58 58 54 58 58 54 58 58 49 58 54 42 42 54 52 52 46 47 52 58 54 58 58 54 48 58 54 58 31 58 54 58 58 58 54 54 58 58 58 58 58 58 52 54 58 58 58 58 54 54 54 54 58 58 58 52 58 58 48 49 54 58 58 58 52 58 58 46 58 51 52 51 50 51 58 52 47 51 58 58 46 51 58 58 58 52 58 53 58 58 54 39 53 58 53 53 58 54 58 48 51 54 51 58 58 58 58 49 58 48 48 51 58 49 58 58 58 40 44 39 49 41 18 32 54 51 46 39 54 50 51 53 52 54 50 39 50 43 50 52 53 39 25 32 32 28 32 24 58 51 54 32 51 46 26 20 19 35 51 50 41 29 44 31 27 32 29 15 38 20 17 47 53 35 51 37 51 49 54 24 28 44 39 47 46 41 44 35 26 26 33 9 14 12 33 32 27 24 9 21 20 23 28 25 28 46 30 42 27 40 23 20 12 33 30 31 18 23 8 14 14 12 26 32 32 32 32 9 9 23 28 21 15 15 22 21 22 13 17 15 13 9 10 10 15 6 18 13 21 23 15 7 11 9 18 6 9 8 5 9 9 5 9 10 5 9 12 10 17 6

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_9656700_9657855
seq2: B6Ng01-213J16.b_43_1192 (reverse)

seq1  ATGAATTTAAAAATAACCCTGGGGTCTCTGATGATCTCATTTAGCAACT-  49
      |||||||  ||||| ||||| ||||||| |||||||||| ||||||||| 
seq2  ATGAATT--AAAATTACCCTTGGGTCTC-GATGATCTCA-TTAGCAACTA  46

seq1  AAATAACCTTTAGATTCCACTTACCTCTGTGCTTCCTTTATCAACAATAA  99
      ||||||||||||||| | |||   |||||||||  | |||||||||||||
seq2  AAATAACCTTTAGATCCAACT--ACTCTGTGCT--CCTTATCAACAATAA  92

seq1  ATGTCCTTTCAGTTTAAGCTACTGTGCAGAGTAGTGCTTGTTGCTTGAAG  149
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  ATGTCCTTTCAGTTTAAGCTACTGTGCAGAGTAGTGC-TGTTGCTTGAAG  141

seq1  TTGAATACATCCAAGCTGATATAAACGTGAATGGA-GGCATCCTA-TCAG  197
      ||||||||||||||||||||||||||||||||||| ||||||||| ||||
seq2  TTGAATACATCCAAGCTGATATAAACGTGAATGGAGGGCATCCTATTCAG  191

seq1  TTATTAATTTCAAAAACTGGCTCAAAGAAAAT-AAATGGGTATTAGTTGC  246
      ||| |||||||||||||||||||||||||||| |||||||||||||||||
seq2  TTA-TAATTTCAAAAACTGGCTCAAAGAAAATAAAATGGGTATTAGTTGC  240

seq1  TACTCTAAGAACATTTTCTATTTATATTCAACCTGAATATATAGATCAAC  296
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTCTAAGAACATTTTCTATTTATATTCAACCTGAATATATAGATCAAC  290

seq1  CCCTATAAAACACCTGATAACTTGTTTACAAAAATAGACATCCCAAGGGA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTATAAAACACCTGATAACTTGTTTACAAAAATAGACATCCCAAGGGA  340

seq1  GACAATAAAGTAAACGACAAGACTCAATGTGCTCAGGATGCTGGGCTTTG  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAATAAAGTAAACGACAAGACTCAATGTGCTCAGGATGCTGGGCTTTG  390

seq1  TGAAGCAAAGAAGAATCATACATATTAGCTAAAAGTTTTCCACAGAATAA  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGCAAAGAAGAATCATACATATTAGCTAAAAGTTTTCCACAGAATAA  440

seq1  GAAGCGGTGGAAAAAGCAGGCAGGGGGCAAAGAAAAAGGGGGCTTTTCTT  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCGGTGGAAAAAGCAGGCAGGGGGCAAAGAAAAAGGGGGCTTTTCTT  490

seq1  ATAAGGTCTCTCTATAAAAGGTGATCCCTTTAGAAATCTCTTACTTGAGG  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAGGTCTCTCTATAAAAGGTGATCCCTTTAGAAATCTCTTACTTGAGG  540

seq1  GTAAATGTGACATAATCCCCTCAGCCTGCATATGGTTTGGATTACCCCTC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAATGTGACATAATCCCCTCAGCCTGCATATGGTTTGGATTACCCCTC  590

seq1  TTTGAAAAGAATGCTTCTTCCACACAAAGGCTAATGCTACATTGGCTCAG  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGAAAAGAATGCTTCTTCCACACAAAGGCTAATGCTACATTGGCTCAG  640

seq1  AAATTGGGAATTCTAAGGCATGGATGACTCAGTCCCTTAGCTAAACCTAA  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATTGGGAATTCTAAGGCATGGATGACTCAGTCCCTTAGCTAAACCTAA  690

seq1  AGCCAATTCCATTTGTAATTCTGCTCCCCTTGCAGGAAACTCTAATTCAA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAATTCCATTTGTAATTCTGCTCCCCTTGCAGGAAACTCTAATTCAA  740

seq1  AAGATGTTTTTAAAGTAGCCACTCACAACTTCACCACTGCTCAAAGAAGG  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGATGTTTTTAAAGTAGCCACTCACAACTTCACCACTGCTCAAAGAAGG  790

seq1  GTTTTCCTGGGCTCTCTCCCTTTCACTTGGAATCCCTACATTGATAAAAT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTTCCTGGGCTCTCTCCCTTTCACTTGGAATCCCTACATTGATAAAAT  840

seq1  CACCGAGGCCTCAAAGTACTGTGCATTATTTCTATTGAGATTTCATTAAG  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCGAGGCCTCAAAGTACTGTGCATTATTTCTATTGAGATTTCATTAAG  890

seq1  GATCTAGAATTTGGAAGAGAACTATAGTGTTCCTTTCCTCATGCCATAAC  946
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTAGAATTTGGAAGAGAACTATAGTGTTCCTTTCCTCATGCCATAAC  940

seq1  TTTCCTTAGCATCCGGCGGGGAGTAGAGAGAGATTTGAGACCAATGAAAA  996
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCCTTAGCATCCGGCGGGGAGTAGAGAGAGATTTGAGACCAATGAAAA  990

seq1  ACCCTAGCCAGTTGCCTAAATGAACTATTCATTCAACATGATACATAATG  1046
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTAGCCAGTTGCCTAAATGAACTATTCATTCAACATGATACATAATG  1040

seq1  GGAACCAGATGTATTGCTTCTGTGATACACCACCAGCCACAAGGATCAGG  1096
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAACCAGATGTATTGCTTCTGTGATACACCACCAGCCACAAGGATCAGG  1090

seq1  TTGGCTTTGTTTGTTGCTTTTGTTTTGATTTTTAGTGACTTTGTACTTAG  1146
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGCTTTGTTTGTTGCTTTTGTTTTGATTTTTAGTGACTTTGTACTTAG  1140

seq1  TTCTGAATTC  1156
      ||||||||||
seq2  TTCTGAATTC  1150

seq1: chrX_9521957_9522875
seq2: B6Ng01-213J16.g_65_879

seq1  GAATTCTATATGTATTTATACCAAGCTCTCAGCAAGTGGATTTTGTTTAG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTATATGTATTTATACCAAGCTCTCAGCAAGTGGATTTTGTTTAG  50

seq1  CAGTCAGAAAAGTGCATAGATTGTTGATGACTAGATTTCCTTCTTTGGTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCAGAAAAGTGCATAGATTGTTGATGACTAGATTTCCTTCTTTGGTC  100

seq1  ACCTAACAAGGAATGATATTTAATGTATTTATGAGCTGGTAGTGAGGAGA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTAACAAGGAATGATATTTAATGTATTTATGAGCTGGTAGTGAGGAGA  150

seq1  CCCTGAGAAGATACTTGTACAAGGCTCAGGGACCTTGCATGCCTTGTAAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGAGAAGATACTTGTACAAGGCTCAGGGACCTTGCATGCCTTGTAAA  200

seq1  GAAACCTGTGGCTGAGAGAAAGTATGAGGAAGGGGGGCTGGAAATAATGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACCTGTGGCTGAGAGAAAGTATGAGGAAGGGGGGCTGGAAATAATGA  250

seq1  TAATGTTTTCCAACTACTATGCTATTAAAGTGTTCAAACAAGTTATCAAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATGTTTTCCAACTACTATGCTATTAAAGTGTTCAAACAAGTTATCAAC  300

seq1  TACTGCACCTGTGCAGTGAGTAGCAGCCAACACTCAGTCCAGTTGTCATA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTGCACCTGTGCAGTGAGTAGCAGCCAACACTCAGTCCAGTTGTCATA  350

seq1  AGTTAATCCAGATTGGTCCATCTCAAAGCAAGGGCGATCTATCTTCCCAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAATCCAGATTGGTCCATCTCAAAGCAAGGGCGATCTATCTTCCCAC  400

seq1  GTATGATTTGAGGAGAAAGAACAATTTTGTCCAGATGCATCTCCTACAAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGATTTGAGGAGAAAGAACAATTTTGTCCAGATGCATCTCCTACAAT  450

seq1  GAAGTCGGGAAGGTTTACTCTGAGTAGACAGTGATGGTGTGGAGCTTGCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGTCGGGAAGGTTTACTCTGAGTAGACAGTGATGGTGTGGAGCTTGCT  500

seq1  TGCTTTTCTAGTCTAGCTGGTCTAAGCAGGTGCTTTCAAAACAGAAAGAA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTTTCTAGTCTAGCTGGTCTAAGCAGGTGCTTTCAAAACAGAAAGAA  550

seq1  GAAAATATTTCCTTGTTGTAAGACCGAAACACAATTCATAAATCACACTG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATATTTCCTTGTTGTAAGACCGAAACACAATTCATAAATCACACTG  600

seq1  TTTTCCTGATGAGAGTCATAGATGCATGGGTGCAAGTATGTGTGTGTGTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTCCTGATGAGAGTCATAGATGCATGGGTGCAAGTATGTGTGTGTGTG  650

seq1  TGTGTGTGTGTGTGTGCATGTGTGTGCATGTGGGTGCAAGTGTGTGTGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTGTGTGTGTGTGCATGTGTGTGCATGTGGGTGCAAGTGTGTGTGTG  700

seq1  TACTTGTGGGTGCAAGTGTGTGTGTACATGTGCATGTGGATACAATTGGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTGTGGGTGCAAGTGTGTGTGTACATGTGCATGTGGATACAATTGGT  750

seq1  GTGTGTGTGTGTGTGCATATGGGTGAAAGTTTGTGCAT-GTGTGTGTGTG  799
      |||||||||||||||||||||||||||||||||||| | | |||||||||
seq2  GTGTGTGTGTGTGTGCATATGGGTGAAAGTTTGTGCTTGGCGTGTGTGTG  800

seq1  TACATGTTCATGTGGGTGCAAGTGTGTGTATGTCTGTACATGTGCACGTG  849
      ||||||||| ||||                                    
seq2  TACATGTTCCTGTGT-----------------------------------  815

seq1  GGTATAAGTATGTTGTTTGTGTGTGTGTGTGTATGGGTACAAGTGTGTGT  899
                                                        
seq2  --------------------------------------------------  815

seq1  GTTTATGTGTGTATCTGTGT  919
                          
seq2  --------------------  815

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information