MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233E19
Chromosome	X (Build37)
Map Location	66,892,615 - 67,025,334
singlet/doublet	doublet
Overlap gene	Aff2
Upstream gene	Fmr1, Fmr1nb, LOC100040244, EG627927, LOC666882, LOC671950, LOC100040255, EG666577
Downstream gene	1700020N15Rik, Ids, 1110012L19Rik, 4930567H17Rik, LOC100040304, LOC628002, LOC628012, BC023829, EG547447, LOC666981, LOC100040409, LOC628053, LOC100040432, EG280121, LOC666993
Link	Open Mouse BAC browser

Click to get alignment info.

name	Fmr1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14265 MGI:95564
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fmr1nb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207854 MGI:2672032
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 139 ESTs, 6 Proteins

name	EG627927 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627927 MGI:3704138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC666882 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666882
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC671950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:671950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	LOC100040255 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Aff2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14266 MGI:1202294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666577 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666577 MGI:3644930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1891 ESTs, 7 Proteins

name	1700020N15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Ids (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15931 MGI:96417
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	1110012L19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930567H17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040304 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	LOC628002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins pseudo : _no_value

name	LOC628012 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins

name	BC023829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547447 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	LOC666981 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins pseudo : _no_value

name	LOC100040409 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC628053 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040432 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040432
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG280121 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	LOC666993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Fmr1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51036612 GeneID:14265 MGI:95564
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation syndrome 1 homolog transcript_id : NM_008031.2

name	Fmr1nb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:29135262 GeneID:207854 MGI:2672032
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : fragile X mental retardation 1 neighbor transcript_id : NM_174993.1

name	LOC100040244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271669 GeneID:100040244
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 139 ESTs, 6 Proteins product : similar to phosphoserine/threonine/tyrosine interaction protein transcript_id : XM_001473727.1

name	EG627927 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407523 GeneID:627927 MGI:3704138
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : predicted gene, EG627927 transcript_id : XM_110770.5

name	LOC671950 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271673 GeneID:671950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical LOC671950 transcript_id : XM_001473776.1

name	LOC100040255 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271671 GeneID:100040255
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100040255 transcript_id : XM_001474363.1

name	Aff2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142351744 GeneID:14266 MGI:1202294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : AF4/FMR2 family, member 2 transcript_id : NM_008032.2

name	EG666577 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271677 GeneID:666577 MGI:3644930
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 mRNAs, 1891 ESTs, 7 Proteins product : predicted gene, EG666577 transcript_id : XM_984280.2

name	1700020N15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271679 GeneID:75509 MGI:1922759
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700020N15 gene transcript_id : XM_001473869.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781803 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038990.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781805 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_001038991.1

name	Ids (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84781811 GeneID:15931 MGI:96417
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : iduronate 2-sulfatase transcript_id : NM_010498.2

name	1110012L19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803513 GeneID:68618 MGI:1915868
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1110012L19 gene transcript_id : NM_026787.2

name	4930567H17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368528 GeneID:619303 MGI:3588249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930567H17 gene transcript_id : NM_001033807.2

name	LOC100040304 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271675 GeneID:100040304
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to syndecan-1 transcript_id : XM_001474469.1

name	LOC628012 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271681 GeneID:628012
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 Proteins product : hypothetical LOC628012 transcript_id : XM_001474528.1

name	BC023829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131123 GeneID:236848 MGI:2448555
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC023829 transcript_id : NM_001033328.2

name	EG547447 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001530 GeneID:547447 MGI:3643766
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : predicted gene, EG547447 transcript_id : XM_892770.1

name	LOC100040409 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271684 GeneID:100040409
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to syndecan-1 transcript_id : XM_001474636.1

name	LOC628053 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:125490330 GeneID:628053
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC628053 transcript_id : NM_001081476.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001321 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG280121, transcript variant 3 transcript_id : XM_898689.1

name	EG280121 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407488 GeneID:280121 MGI:3646640
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG280121, transcript variant 1 transcript_id : XM_207492.5

name	Fmr1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51036613 CCDS:CCDS30171.1 GeneID:14265 MGI:95564
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0007417 - central nervous system development [Evidence IMP]; GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : fragile X mental retardation-1 protein product : fragile X mental retardation protein 1 protein_id : NP_032057.2

name	Fmr1nb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29135263 CCDS:CCDS30172.1 GeneID:207854 MGI:2672032
definition	codon_start : 1 exception : mismatches in translation product : fragile X mental retardation 1 neighbor protein_id : NP_778158.1

name	LOC100040244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271670 GeneID:100040244
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473777.1

name	EG627927 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086331 GeneID:627927 MGI:3704138
definition	codon_start : 1 product : hypothetical protein protein_id : XP_110770.2

name	LOC671950 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271674 GeneID:671950
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473826.1

name	LOC100040255 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271672 GeneID:100040255
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474413.1

name	Aff2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679819 CCDS:CCDS30173.1 GeneID:14266 MGI:1202294
definition	GO_process : GO:0007611 - learning and/or memory [Evidence IMP] codon_start : 1 exception : mismatches in translation note : Ox19 homolog; fragile X mental retardation 2 homolog; fragile X mental retardation protein 2 homolog product : AF4/FMR2 family, member 2 protein_id : NP_032058.1

name	EG666577 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271678 GeneID:666577 MGI:3644930
definition	codon_start : 1 product : hypothetical protein protein_id : XP_989374.2

name	1700020N15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271680 GeneID:75509 MGI:1922759
definition	codon_start : 1 product : hypothetical protein LOC75509 protein_id : XP_001473919.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781812 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform a protein_id : NP_034628.2

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781804 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034079.1

name	Ids (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84781806 GeneID:15931 MGI:96417
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0016787 - hydrolase activity [Evidence IEA]; GO:0004423 - iduronate-2-sulfatase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008484 - sulfuric ester hydrolase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 3; iduronate sulfatase; iduronate-2-sulfatase product : iduronate 2-sulfatase isoform b protein_id : NP_001034080.1

name	1110012L19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312070 CCDS:CCDS30174.1 GeneID:68618 MGI:1915868
definition	codon_start : 1 product : hypothetical protein LOC68618 protein_id : NP_081063.1

name	4930567H17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702147 GeneID:619303 MGI:3588249
definition	codon_start : 1 product : hypothetical protein LOC619303 protein_id : NP_001028979.1

name	LOC100040304 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271676 GeneID:100040304
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474519.1

name	LOC628012 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271682 GeneID:628012
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474578.1

name	BC023829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701820 CCDS:CCDS30176.1 GeneID:236848 MGI:2448555
definition	codon_start : 1 note : ee3 product : cDNA sequence BC023829 protein_id : NP_001028500.1

name	EG547447 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001531 GeneID:547447 MGI:3643766
definition	codon_start : 1 product : hypothetical protein protein_id : XP_897863.1

name	LOC100040409 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271685 GeneID:100040409
definition	codon_start : 1 product : similar to syndecan-1 protein_id : XP_001474686.1

name	LOC628053 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:125490331 GeneID:628053
definition	codon_start : 1 product : hypothetical LOC628053 protein_id : NP_001074945.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001322 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 3 protein_id : XP_903782.1

name	EG280121 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086394 GeneID:280121 MGI:3646640
definition	codon_start : 1 product : similar to acidic ribosomal phosphoprotein P1 isoform 1 protein_id : XP_207492.3

name	LOC666882 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666882
definition	number : 1 pseudo : _no_value

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 2 pseudo : _no_value

name	LOC100040432 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040432
definition	number : 1 pseudo : _no_value

name	LOC666993 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666993
definition	number : 1 pseudo : _no_value

name	LOC628002 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271683 GeneID:628002
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 126 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035666.1

name	LOC666981 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271686 GeneID:666981
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 56 ESTs, 3 Proteins product : similar to YTH domain family, member 2 pseudo : _no_value transcript_id : XR_035667.1

clone name	MSMg01-351B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-366B11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439F10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-517K05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528O17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513O03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543E15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166F08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407K15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-353L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-290A22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061A16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-201L03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275N01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157A03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-389O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-191G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-280M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-128J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-322D04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-142K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-060L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377M04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532G22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-172L20
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-099F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-476N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316J15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069K09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286J02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113L16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066L18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089P14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161D22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150J24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337E24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-233E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-211O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334G21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099E21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147H22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016G22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236K19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325O08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-188N15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233E19.b	B6Ng01-233E19.g
ACC	GA045402	GA045403
length	992	1,155
definition	B6Ng01-233E19.b	B6Ng01-233E19.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(66,892,615 - 66,893,381)	(67,024,173 - 67,025,334)
sequence	gaattctctaataataaaactctaagcatcattgaagttatcacatatta agttatccagtatctacatgtccgtctatccatccctatgtttgactact aagttataatataggatgcttcctaacttctgcttgcaacatttaaatac attcctgaaagaaataatcagttgaatacctgaactacttagtcagttaa ggaaaatcagtgaggtcaaatagctaaggtgaagtactacttaggtttac tgtttacagttactggcctttttttttaaagatattttctttattcacat ttccaatgttatcccctttccttgttttccctctgaaaaccccaaatccc atcccccttcaccctgctcaccaacccacccactccccctactctgtcct ggcattcccctacactggggcattgagccttctcaggaccaagggcctat ccttccaatgatgtccaacaaggccattatcagctacatatgcagaaggt aggagccatgagtcccaccatgtgtactctttggttggtggtttagtccc tgagagctctgggggtactggttggtttatattgttgttcctactatgag actgtaagctccttcagctccttcagtcctttctttaacttgtccactgg tgaccttgtgttcagtccaatgcttggctgtgagcatccacctctgtatt tgtcaggcactgtcagagcctctcaggagacagctatatcaggctcctgt cagcaaacacttgttggcatccacaatactgtctgtgtttggtaactgta tatgggatggattcccaggtgaggcagtctctggatagtctttcgttcac tctctgaaccacactttttttctgtatctcctcccatgggtatttggttt cattatctccttgtataaactcaagtccagtggatcaggacctcacataa aaccagataccactgaaactaatagagaagaatggggagagc	gaattcaatatgtgtgattcaactgtccatctatatcagtttttggaaga aaaacttccagagatatgtaattttttggaggacttcatacagtgtcatt gatgaccttattcctggagacactgacttaaaagttgtcagggctcaggg gagttaaggtgatccatacttgacagatatctttaaatgtcagttaggac atttaatctagttcttagtaaagcctatgggcacctaagccaaaaggaag agtaatatctattctcttgtatatctaagagagaatttcagttaatgcta aatgagccacaaggaaggataactacatacttgtcatacttaacagtttt ccgcatactttctcataactaagctttgtctgatcctcacaacactacca taaattagacaagactattttatcctaatttacttgcaggagatcttaga cttcaggatgtttggcaatttccccaaatgtgatataattagtatgtatg aagtagaacttatcaggcttcttcattccagaaactacactcttaatgat tacacttttactttctcatggccaggcacacacagctaataaacattaag acaagacagatttttttcattcaagtttgccacatgttgggtatttttca tgtacctaatccagcagttctttttatcttctcattctttataagaaagg aaaactggagagacctagcatttcaaagcactatagacattttagataat cagatgtagccataacaatgttatcatctaaagtgatgagtacctgttat gccctaagctttagtgttaagttctgtgattatgaattggtccatttttt tttcattgaatatactatgactaggtagtattgttatctttattttatag aaactagatctttttgctagaattcattcagtttgaaagtgataaggact aaagaacccacatgggtatgcactcactaataagtggatattagccccaa agctctgaataccacatacattcacagaccacatgagctcagagagggtg ataaagtggtgaatgcttgttcttcttaaaagagaaaaatactcgcctga caatacagaaaatggatgctcaagccattccattggaactggaacaaagg tcccc
quality values	Open. Hide. 58 26 23 29 58 49 54 58 54 52 54 54 54 54 62 52 62 62 62 62 54 62 62 62 62 62 47 62 54 47 54 62 56 56 31 28 30 62 62 51 47 47 62 62 54 62 62 62 49 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 54 58 58 58 41 58 54 58 54 58 58 54 58 58 54 58 58 54 54 58 58 58 54 54 45 54 54 54 58 58 58 58 54 54 58 58 48 58 58 58 58 47 58 58 54 49 58 58 54 58 52 58 54 54 58 58 58 58 58 58 42 58 52 58 58 54 58 47 58 41 41 43 51 47 46 58 58 49 51 49 54 42 39 58 50 48 58 53 54 58 58 42 58 58 46 54 50 58 52 50 58 46 50 58 50 58 50 54 34 58 58 53 51 46 46 58 54 51 49 50 58 53 42 32 58 58 51 52 58 58 53 46 37 50 50 54 50 58 58 52 54 58 50 34 30 50 58 51 58 52 53 50 50 47 49 39 38 52 51 35 32 51 51 52 45 53 53 52 50 50 40 50 42 53 39 31 40 50 54 41 58 51 50 40 39 53 49 38 47 36 26 53 34 52 34 52 37 43 49 49 49 49 53 42 29 31 49 44 45 42 39 34 25 54 32 29 35 47 44 40 37 37 24 54 18 37 41 50 52 53 32 35 6 54 46 32 39 21 32 34 42 53 42 45 32 37 37 32 14 46 32 41 28 42 37 51 37 37 32 29 39 27 54 45 38 32 37 28 31 53 37 31 46 32 25 33 37 28 36 35 40 35 39 34 32 31 36 52 32 53 32 42 36 52 34 53 42 46 40 31 40 31 35 31 45 31 32 31 25 27 31 46 34 21 21 43 30 30 20 32 30 51 31 29 21 29 27 31 42 24 38 28 32 29 28 31 36 38 38 33 25 31 33 34 28 32 38 32 48 31 31 33 31 31 29 20 26 31 34 31 27 30 31 30 31 21 29 31 34 35 31 37 48 48 48 48 48 38 37 31 27 21 18 32 26 32 30 32 36 30 48 28 25 31 31 46 32 33 33 31 41 24 21 24 20 41 24 22 24 25 26 31 31 31 31 33 33 21 30 33 12 27 15 44 47 31 27 34 19 18 33 24 28 17 15 29 13 29 24 21 21 20 16 23 8 14 22 16 21 21 43 7 19 23 23 11 43 40 33 11 26 15 10 29 18 15 18 6 7 17 21 34 23 48 17 18 20 28 11 18 24 12 28 20 24 38 8 21 15 11 20 34 31 13 21 6 24 9 24	Open. Hide. 62 47 56 47 62 42 42 62 62 62 47 43 44 62 38 49 25 44 62 59 43 62 62 62 62 62 62 44 43 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 59 62 62 59 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 58 58 58 58 54 58 58 58 58 54 54 54 58 49 47 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 48 58 58 58 58 58 58 54 54 58 54 58 54 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 54 58 51 53 51 58 49 58 58 58 58 58 53 50 51 58 58 48 47 53 58 58 49 54 54 58 58 49 58 58 58 58 58 58 58 51 58 58 53 53 52 51 49 58 58 58 58 50 48 58 58 58 51 58 58 51 50 51 58 58 51 58 50 58 58 58 39 53 53 51 52 54 46 58 58 54 50 58 53 52 58 58 49 50 58 58 58 58 53 46 31 39 58 51 46 50 49 51 51 50 58 58 58 58 58 50 49 31 51 49 50 37 39 49 50 58 52 49 50 40 27 50 37 49 54 53 42 51 54 54 39 35 31 54 54 54 52 42 37 42 54 52 37 49 51 49 27 50 41 37 52 42 45 53 50 32 51 45 42 46 49 54 54 51 45 42 53 53 52 52 39 37 26 46 46 37 37 54 37 45 45 53 44 37 53 54 52 40 47 31 54 54 44 32 42 51 54 30 26 41 34 33 28 33 33 36 32 53 28 35 52 42 40 40 53 53 32 42 41 33 45 40 53 32 31 47 31 31 52 53 53 34 40 40 45 31 28 47 32 34 30 31 42 30 51 30 31 31 33 51 29 31 19 41 33 27 41 26 51 29 30 30 31 37 35 31 31 33 31 51 35 36 31 40 31 35 33 38 22 29 29 28 38 30 46 29 32 25 27 32 31 46 28 38 31 31 36 43 42 48 31 31 28 23 42 20 32 31 42 31 32 26 31 28 41 25 37 33 24 42 36 31 31 38 35 24 31 31 34 29 32 32 32 38 48 46 46 48 46 48 48 31 31 23 39 31 32 29 31 31 27 25 24 31 31 31 25 31 32 31 36 30 14 29 27 34 34 30 31 24 26 21 17 20 33 31 25 31 44 32 35 28 44 48 33 22 25 20 22 32 48 31 31 26 27 30 19 32 17 9 48 48 44 29 33 29 30 32 24 34 31 33 30 32 19 33 32 32 28 20 24 47 27 32 27 48 27 14 26 32 20 24 14 33 6 7 29 24 27 26 43 17 13 22 15 20 34 32 28 21 22 9 11 34 25 23 20 19 32 34 24 22 26 25 18 32 31 17 15 28 17 26 14 13 23 15 11 6 15 7 27 28 14 20 40 34 17 8 24 14 27 24 20 20 27 14 17 6 11 24 21 13 4 3 10 13 8 9 13 4 21 13 6 13 14 16 28 16 19 16 20 27 13 6 4 4 9 8 11 23 12 25 8 3 4 14 5 10 11 19 13 20 28 17 8 6 6 4 4 18 6 11 20 11 18 22 19 8 3 4 15 12 6 20 10 22 14 17 14 7 7 6 11 15 17 17 17 23 6 6 17 16 19 7 14 14 4 10 12 5 11 17 10 6 6 6 6 23 30 26 12 6 19 13 4 4 6 3 2 3 4 2 5 4 11 7 7 5 7 14 5 4 8 7 4 5 10 10 12 14 4 2 1 2 1 3 3 4 14 5 14 25 17 10

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_66892615_66893381
seq2: B6Ng01-233E19.b_49_815

seq1  GAATTCTCTAATAATAAAACTCTAAGCATCATTGAAGTTATCACATATTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCTAATAATAAAACTCTAAGCATCATTGAAGTTATCACATATTA  50

seq1  AGTTATCCAGTATCTACATGTCCGTCTATCCATCCCTATGTTTGACTACT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTATCCAGTATCTACATGTCCGTCTATCCATCCCTATGTTTGACTACT  100

seq1  AAGTTATAATATAGGATGCTTCCTAACTTCTGCTTGCAACATTTAAATAC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTATAATATAGGATGCTTCCTAACTTCTGCTTGCAACATTTAAATAC  150

seq1  ATTCCTGAAAGAAATAATCAGTTGAATACCTGAACTACTTAGTCAGTTAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTCCTGAAAGAAATAATCAGTTGAATACCTGAACTACTTAGTCAGTTAA  200

seq1  GGAAAATCAGTGAGGTCAAATAGCTAAGGTGAAGTACTACTTAGGTTTAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAATCAGTGAGGTCAAATAGCTAAGGTGAAGTACTACTTAGGTTTAC  250

seq1  TGTTTACAGTTACTGGCCTTTTTTTTTAAAGATATTTTCTTTATTCACAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTACAGTTACTGGCCTTTTTTTTTAAAGATATTTTCTTTATTCACAT  300

seq1  TTCCAATGTTATCCCCTTTCCTTGTTTTCCCTCTGAAAACCCCAAATCCC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCAATGTTATCCCCTTTCCTTGTTTTCCCTCTGAAAACCCCAAATCCC  350

seq1  ATCCCCCTTCACCCTGCTCACCAACCCACCCACTCCCCCTACTCTGTCCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCCCCTTCACCCTGCTCACCAACCCACCCACTCCCCCTACTCTGTCCT  400

seq1  GGCATTCCCCTACACTGGGGCATTGAGCCTTCTCAGGACCAAGGGCCTAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATTCCCCTACACTGGGGCATTGAGCCTTCTCAGGACCAAGGGCCTAT  450

seq1  CCTTCCAATGATGTCCAACAAGGCCATTATCAGCTACATATGCAGAAGGT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCAATGATGTCCAACAAGGCCATTATCAGCTACATATGCAGAAGGT  500

seq1  AGGAGCCATGAGTCCCACCATGTGTACTCTTTGGTTGGTGGTTTAGTCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGCCATGAGTCCCACCATGTGTACTCTTTGGTTGGTGGTTTAGTCCC  550

seq1  TGAGAGCTCTGGGGGTACTGGTTGGTTTATATTGTTGTTCCTACTATGAG  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGAGCTCTGGGGGTACTGGTTGGTTTATATTGTTGTTCCTACTATGAG  600

seq1  ACTGTAAGCTCCTTCAGCTCCTTCAGTCCTTTCTTTAACTTGTCCACTGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGTAAGCTCCTTCAGCTCCTTCAGTCCTTTCTTTAACTTGTCCACTGG  650

seq1  TGACCTTGTGTTCAGTCCAATGCTTGGCTGTGAGCATCCACCTCTGTATT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACCTTGTGTTCAGTCCAATGCTTGGCTGTGAGCATCCACCTCTGTATT  700

seq1  TGTCAGGCACTGTCAGAGCCTCTCAGGAGACAGCTATATCAGGCTCCTGT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTCAGGCACTGTCAGAGCCTCTCAGGAGACAGCTATATCAGGCTCCTGT  750

seq1  CAGCAAACACTTGTTGG  767
      |||||||||||||||||
seq2  CAGCAAACACTTGTTGG  767

seq1: chrX_67024173_67025334
seq2: B6Ng01-233E19.g_64_1218 (reverse)

seq1  GGGGACCTTGTGCT-CAGTT-CAATGG-ATGGCTGTGAGCATCCA-TTTC  46
      ||||||||| || | ||||| |||||| |||||| |||||||||| ||||
seq2  GGGGACCTT-TGTTCCAGTTCCAATGGAATGGCT-TGAGCATCCATTTTC  48

seq1  TGTATTTGTCAGGCGAGTATTTTTTCCTCTTTTTAAGAAGGACCAAAGCA  96
      |||| |||||||||||||||||||  ||| |||||||||| ||  |||||
seq2  TGTA-TTGTCAGGCGAGTATTTTT--CTC-TTTTAAGAAGAAC--AAGCA  92

seq1  TCCACACTTTTATCACCCTTCTTCTTGAGCTTCATGTGGTCTGTGAATTG  146
      | |||   |||||||||| |||   ||||| |||||||||||||||| ||
seq2  TTCACCACTTTATCACCC-TCT--CTGAGC-TCATGTGGTCTGTGAA-TG  137

seq1  TATGTTGGGTATTCAGAGCTTTGGGGCTAATATCCACTTATTAGTGAGTG  196
      |||||  |||||||||||||||||||||||||||||||||||||||||||
seq2  TATGT--GGTATTCAGAGCTTTGGGGCTAATATCCACTTATTAGTGAGTG  185

seq1  CATA-CCATGTGGGTTCTTTAGT-CTTATCACTTTCAAACTGAATGAATT  244
      |||| |||||||||||||||||| ||||||||||||||||||||||||||
seq2  CATACCCATGTGGGTTCTTTAGTCCTTATCACTTTCAAACTGAATGAATT  235

seq1  CTAGC-AAAAGATCTAGTTTCTATAAAATAAAGATAACAATACTACCTAG  293
      ||||| ||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCAAAAAGATCTAGTTTCTATAAAATAAAGATAACAATACTACCTAG  285

seq1  TCATAGTATATTCAATG-AAAAAAAATGGACCAATTCATAATCACAGAAC  342
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  TCATAGTATATTCAATGAAAAAAAAATGGACCAATTCATAATCACAGAAC  335

seq1  TTAACACTAAAGCTTAGGGCATAACAGGTACTCATCACTTTAGATGATAA  392
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAACACTAAAGCTTAGGGCATAACAGGTACTCATCACTTTAGATGATAA  385

seq1  CATTGTTATGGCTACATCTGATTATCTAAAATGTCTATAGTGCTTTGAAA  442
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTGTTATGGCTACATCTGATTATCTAAAATGTCTATAGTGCTTTGAAA  435

seq1  TGCTAGGTCTCTCCAGTTTTCCTTTCTTATAAAGAATGAGAAGATAAAAA  492
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTAGGTCTCTCCAGTTTTCCTTTCTTATAAAGAATGAGAAGATAAAAA  485

seq1  GAACTGCTGGATTAGGTACATGAAAAATACCCAACATGTGGCAAACTTGA  542
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACTGCTGGATTAGGTACATGAAAAATACCCAACATGTGGCAAACTTGA  535

seq1  ATGAAAAAAATCTGTCTTGTCTTAATGTTTATTAGCTGTGTGTGCCTGGC  592
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAAAAAAATCTGTCTTGTCTTAATGTTTATTAGCTGTGTGTGCCTGGC  585

seq1  CATGAGAAAGTAAAAGTGTAATCATTAAGAGTGTAGTTTCTGGAATGAAG  642
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGAGAAAGTAAAAGTGTAATCATTAAGAGTGTAGTTTCTGGAATGAAG  635

seq1  AAGCCTGATAAGTTCTACTTCATACATACTAATTATATCACATTTGGGGA  692
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCTGATAAGTTCTACTTCATACATACTAATTATATCACATTTGGGGA  685

seq1  AATTGCCAAACATCCTGAAGTCTAAGATCTCCTGCAAGTAAATTAGGATA  742
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGCCAAACATCCTGAAGTCTAAGATCTCCTGCAAGTAAATTAGGATA  735

seq1  AAATAGTCTTGTCTAATTTATGGTAGTGTTGTGAGGATCAGACAAAGCTT  792
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGTCTTGTCTAATTTATGGTAGTGTTGTGAGGATCAGACAAAGCTT  785

seq1  AGTTATGAGAAAGTATGCGGAAAACTGTTAAGTATGACAAGTATGTAGTT  842
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTATGAGAAAGTATGCGGAAAACTGTTAAGTATGACAAGTATGTAGTT  835

seq1  ATCCTTCCTTGTGGCTCATTTAGCATTAACTGAAATTCTCTCTTAGATAT  892
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCTTCCTTGTGGCTCATTTAGCATTAACTGAAATTCTCTCTTAGATAT  885

seq1  ACAAGAGAATAGATATTACTCTTCCTTTTGGCTTAGGTGCCCATAGGCTT  942
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGAGAATAGATATTACTCTTCCTTTTGGCTTAGGTGCCCATAGGCTT  935

seq1  TACTAAGAACTAGATTAAATGTCCTAACTGACATTTAAAGATATCTGTCA  992
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTAAGAACTAGATTAAATGTCCTAACTGACATTTAAAGATATCTGTCA  985

seq1  AGTATGGATCACCTTAACTCCCCTGAGCCCTGACAACTTTTAAGTCAGTG  1042
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATGGATCACCTTAACTCCCCTGAGCCCTGACAACTTTTAAGTCAGTG  1035

seq1  TCTCCAGGAATAAGGTCATCAATGACACTGTATGAAGTCCTCCAAAAAAT  1092
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCAGGAATAAGGTCATCAATGACACTGTATGAAGTCCTCCAAAAAAT  1085

seq1  TACATATCTCTGGAAGTTTTTCTTCCAAAAACTGATATAGATGGACAGTT  1142
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACATATCTCTGGAAGTTTTTCTTCCAAAAACTGATATAGATGGACAGTT  1135

seq1  GAATCACACATATTGAATTC  1162
      ||||||||||||||||||||
seq2  GAATCACACATATTGAATTC  1155

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information