MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-233H16
Chromosome	X (Build37)
Map Location	72,822,556 - 73,002,384
singlet/doublet	doublet
Overlap gene	Rab39b, EG635243
Upstream gene	Olfr1325, EG434797, LOC385383, EG667379, LOC667382, LOC546321, LOC667387, EG628518, Olfr1327-ps1, LOC628637, LOC667413, LOC100041594, LOC627775, EG546325, LOC100041017, EG628573, LOC100041642, LOC667437, EG667446, LOC669291, Gab3, Dkc1, Mpp1, EG547412, 4930428E23Rik, EG667190, F8, LOC572559, LOC667218, Fundc2, Mtcp1, Brcc3, LOC667496, Vbp1
Downstream gene	Pls3, LOC635275, EG635295, LOC667537, LOC385472, LOC100041147, EG238829, Magea7, 4930428D18Rik, EG544974, 4930468A15Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Olfr1325 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258393 MGI:3031159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434797 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434797 MGI:3645126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 10 Proteins

name	LOC385383 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein pseudo : _no_value

name	EG667379 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667379 MGI:3704139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins

name	LOC667382 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins pseudo : _no_value

name	LOC546321 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 208 ESTs, 3 Proteins

name	LOC667387 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 4 Proteins

name	EG628518 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628518 MGI:3645826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Olfr1327-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:404499 MGI:3031161
definition	note : olfactory receptor 1327, pseudogene 1 pseudo : _no_value

name	LOC628637 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein

name	LOC667413 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins pseudo : _no_value

name	LOC100041594 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 28 Proteins

name	LOC627775 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein pseudo : _no_value

name	EG546325 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546325 MGI:3645575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041017 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041017
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG628573 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628573 MGI:3645236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein

name	LOC100041642 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 2 ESTs, 28 Proteins

name	LOC667437 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	EG667446 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667446 MGI:3645523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins pseudo : _no_value

name	LOC669291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Gab3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210710 MGI:2387324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Dkc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245474 MGI:1861727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mpp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17524 MGI:105941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG547412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547412 MGI:3646428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 3 Proteins

name	4930428E23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434800 MGI:3588243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	EG667190 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667190 MGI:3646324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 244 ESTs, 10 Proteins pseudo : _no_value

name	F8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14069 MGI:88383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC572559 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:572559
definition	note : protein phosphatase 4, regulatory subunit 2 pseudogene pseudo : _no_value

name	LOC667218 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins pseudo : _no_value

name	Fundc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67391 MGI:1914641
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mtcp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17763 MGI:102699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Brcc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210766 MGI:2389572
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667496 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins pseudo : _no_value

name	Vbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22327 MGI:1333804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab39b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67790 MGI:1915040
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG635243 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635243 MGI:3644674
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Pls3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102866 MGI:104807
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC635275 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635275
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG635295 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635295 MGI:3646473
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC667537 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667537
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC385472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC100041147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG238829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238829 MGI:3648293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17143 MGI:1333836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	4930428D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619294 MGI:3588232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544974 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544974 MGI:3644190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4930468A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74987 MGI:1922237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins

name	Olfr1325 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239363 GeneID:258393 MGI:3031159
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1325 transcript_id : NM_146398.1

name	EG434797 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271728 GeneID:434797 MGI:3645126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 9 Proteins product : predicted gene, EG434797, transcript variant 1 transcript_id : XM_486708.5

name	EG667379 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271731 GeneID:667379 MGI:3704139
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : predicted gene, EG667379 transcript_id : XM_990209.2

name	LOC546321 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271699 GeneID:546321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 208 ESTs, 3 Proteins product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) transcript_id : XM_001475536.1

name	LOC667387 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271735 GeneID:667387
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 ESTs, 4 Proteins product : similar to X-linked lymphocyte-regulated 4A transcript_id : XM_001487797.1

name	EG628518 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271701 GeneID:628518 MGI:3645826
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : predicted gene, EG628518 transcript_id : XM_893271.3

name	LOC628637 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271703 GeneID:628637
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 1 Protein product : similar to RIKEN cDNA 1700030B21 gene transcript_id : XM_893398.2

name	LOC100041594 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271740 GeneID:100041594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001476843.1

name	LOC100041594 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271742 GeneID:100041594
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001476854.1

name	EG546325 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126157512 GeneID:546325 MGI:3645575
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG546325 transcript_id : NM_001081670.1

name	EG628573 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271747 GeneID:628573 MGI:3645236
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : predicted gene, EG628573 transcript_id : XM_893332.2

name	LOC100041642 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271750 GeneID:100041642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 2 transcript_id : XM_001476944.1

name	LOC100041642 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271748 GeneID:100041642
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1 EST, 28 Proteins product : similar to 4930408F14Rik protein, transcript variant 1 transcript_id : XM_001476927.1

name	LOC669291 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271705 GeneID:669291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to RIKEN cDNA 1700030B21 gene transcript_id : XM_001475692.1

name	Gab3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356007 GeneID:210710 MGI:2387324
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 2-associated protein 3 transcript_id : NM_153073.2

name	Gab3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345510 GeneID:210710 MGI:2387324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : growth factor receptor bound protein 2-associated protein 3 transcript_id : NM_181584.3

name	Dkc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91064866 GeneID:245474 MGI:1861727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dyskeratosis congenita 1, dyskerin homolog (human) transcript_id : NM_001030307.1

name	Mpp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982179 GeneID:17524 MGI:105941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : membrane protein, palmitoylated transcript_id : NM_008621.2

name	EG547412 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271754 GeneID:547412 MGI:3646428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 26 ESTs, 3 Proteins product : predicted gene, EG547412 transcript_id : XM_486711.4

name	F8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679732 GeneID:14069 MGI:88383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : coagulation factor VIII transcript_id : NM_007977.1

name	Fundc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366263 GeneID:67391 MGI:1914641
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FUN14 domain containing 2 transcript_id : NM_026126.3

name	Mtcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343581 GeneID:17763 MGI:102699
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mature T-cell proliferation 1 transcript_id : NM_010839.5

name	Mtcp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372643 GeneID:17763 MGI:102699
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mature T-cell proliferation 1 transcript_id : NM_001039373.2

name	Brcc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31542276 GeneID:210766 MGI:2389572
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BRCA1/BRCA2-containing complex, subunit 3 transcript_id : NM_145956.2

name	Vbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124248571 GeneID:22327 MGI:1333804
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : von Hippel-Lindau binding protein 1 transcript_id : NM_011692.2

name	Rab39b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360120 GeneID:67790 MGI:1915040
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB39B, member RAS oncogene family transcript_id : NM_175122.3

name	Pls3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21704119 GeneID:102866 MGI:104807
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : plastin 3 (T-isoform) transcript_id : NM_145629.1

name	LOC100041147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271707 GeneID:100041147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041147 transcript_id : XM_001475884.1

name	EG238829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377390 GeneID:238829 MGI:3648293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG238829 transcript_id : NM_001013760.2

name	Magea7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271767 GeneID:17143 MGI:1333836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : melanoma antigen, family A, 7 transcript_id : XM_001481307.1

name	4930428D18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365301 GeneID:619294 MGI:3588232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930428D18 gene transcript_id : NM_001033799.2

name	EG544974 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001663 GeneID:544974 MGI:3644190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG544974 transcript_id : XM_484337.2

name	4930468A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407580 GeneID:74987 MGI:1922237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins product : RIKEN cDNA 4930468A15 gene transcript_id : XM_135954.3

name	Olfr1325 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239364 CCDS:CCDS30234.1 GeneID:258393 MGI:3031159
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2QD78-203513-202575; olfactory receptor MOR102-1 product : olfactory receptor 1325 protein_id : NP_666510.1

name	EG434797 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271729 GeneID:434797 MGI:3645126
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_486708.3

name	EG667379 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271732 GeneID:667379 MGI:3704139
definition	codon_start : 1 product : hypothetical protein protein_id : XP_995303.2

name	LOC546321 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271700 GeneID:546321
definition	codon_start : 1 product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) protein_id : XP_001475586.1

name	LOC667387 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271736 GeneID:667387
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001487847.1

name	EG628518 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271702 GeneID:628518 MGI:3645826
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898364.3

name	LOC628637 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271704 GeneID:628637
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898491.2

name	LOC100041594 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271741 GeneID:100041594
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476893.1

name	LOC100041594 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271743 GeneID:100041594
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476904.1

name	EG546325 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126157513 GeneID:546325 MGI:3645575
definition	codon_start : 1 product : hypothetical protein LOC546325 protein_id : NP_001075139.1

name	EG628573 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001620 GeneID:628573 MGI:3645236
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898425.1

name	LOC100041642 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271749 GeneID:100041642
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001476977.1

name	LOC100041642 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271751 GeneID:100041642
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001476994.1

name	LOC669291 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271706 GeneID:669291
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475742.1

name	Gab3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346479 CCDS:CCDS30235.1 GeneID:210710 MGI:2387324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030225 - macrophage differentiation [Evidence IDA] codon_start : 1 exception : mismatches in translation function : differentiation signaling product : growth factor receptor bound protein 2-associated protein 3 protein_id : NP_694713.1

name	Gab3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31712032 CCDS:CCDS30235.1 GeneID:210710 MGI:2387324
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0030225 - macrophage differentiation [Evidence IDA] codon_start : 1 product : growth factor receptor bound protein 2-associated protein 3 protein_id : NP_853615.1

name	Dkc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:91064867 GeneID:245474 MGI:1861727
definition	GO_function : GO:0004730 - pseudouridylate synthase activity [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006396 - RNA processing [Evidence IEA] codon_start : 1 product : dyskerin protein_id : NP_001025478.1

name	Mpp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678924 CCDS:CCDS30236.1 GeneID:17524 MGI:105941
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : membrane protein, palmitoylated (55 kDa) product : membrane protein, palmitoylated protein_id : NP_032647.1

name	EG547412 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001635 GeneID:547412 MGI:3646428
definition	codon_start : 1 product : similar to MGC12966 protein protein_id : XP_486711.2

name	F8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679733 CCDS:CCDS30238.1 GeneID:14069 MGI:88383
definition	GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0005507 - copper ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006953 - acute-phase response [Evidence IEA]; GO:0007596 - blood coagulation [Evidence IEA]; GO:0007155 - cell adhesion [Evidence IEA] codon_start : 1 exception : mismatches in translation note : Factor VIII product : coagulation factor VIII protein_id : NP_032003.1

name	Fundc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541957 CCDS:CCDS30239.1 GeneID:67391 MGI:1914641
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation product : FUN14 domain containing 2 protein_id : NP_080402.2

name	Mtcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754760 GeneID:17763 MGI:102699
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : mature T-cell proliferation 1 isoform b protein_id : NP_034969.1

name	Mtcp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:86439951 CCDS:CCDS30241.1 GeneID:17763 MGI:102699
definition	GO_component : GO:0005739 - mitochondrion [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : mature T-cell proliferation 1 isoform a protein_id : NP_001034462.1

name	Brcc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165366 GeneID:210766 MGI:2389572
definition	GO_component : GO:0000151 - ubiquitin ligase complex [Evidence ISS] GO_function : GO:0030234 - enzyme regulator activity [Evidence ISS] GO_process : GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0010165 - response to X-ray [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : 6.1A protein product : c6.1a protein protein_id : NP_666068.1

name	Vbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124248572 GeneID:22327 MGI:1333804
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] codon_start : 1 product : von Hippel-Lindau binding protein 1 protein_id : NP_035822.2

name	Rab39b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424726 CCDS:CCDS30242.1 GeneID:67790 MGI:1915040
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : RAB39B, member RAS oncogene family protein_id : NP_780331.1

name	Pls3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21704120 CCDS:CCDS30243.1 GeneID:102866 MGI:104807
definition	codon_start : 1 note : T-plastin; plastin 3, T product : plastin 3 precursor protein_id : NP_663604.1

name	LOC100041147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271708 GeneID:100041147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475934.1

name	EG238829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000638 GeneID:238829 MGI:3648293
definition	codon_start : 1 note : novel protein similar to 1700042B14Rik product : hypothetical protein LOC238829 protein_id : NP_001013782.1

name	Magea7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271768 GeneID:17143 MGI:1333836
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : melanoma antigen, family A, 7 protein_id : XP_001481357.1 transl_except : (pos:73592973..73592975,aa:OTHER) transl_except : (pos:73593540..73593542,aa:OTHER) transl_except : (pos:73593627..73593629,aa:OTHER)

name	4930428D18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702129 GeneID:619294 MGI:3588232
definition	GO_component : GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC619294 protein_id : NP_001028971.1

name	EG544974 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001664 GeneID:544974 MGI:3644190
definition	codon_start : 1 product : similar to Predicted gene, EG238829 protein_id : XP_484337.2

name	4930468A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984390 GeneID:74987 MGI:1922237
definition	codon_start : 1 product : hypothetical protein LOC74987 protein_id : XP_135954.1

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 4 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 3 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 2 pseudo : _no_value

name	LOC100041017 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041017
definition	number : 1 pseudo : _no_value

name	EG635243 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635243
definition	number : 1 pseudo : _no_value

name	LOC635275 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635275
definition	number : 1 pseudo : _no_value

name	LOC635275 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635275
definition	number : 2 pseudo : _no_value

name	EG635295 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635295
definition	number : 1 pseudo : _no_value

name	LOC667537 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667537
definition	number : 1 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 1 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 2 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 3 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 4 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 5 pseudo : _no_value

name	LOC385383 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271730 GeneID:385383
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : similar to X-linked lymphocyte-regulated 5D pseudo : _no_value transcript_id : XR_032906.1

name	LOC667382 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271733 GeneID:667382
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 4 Proteins product : similar to xlr3a gene product pseudo : _no_value transcript_id : XR_032920.1

name	LOC667413 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271739 GeneID:667413
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 ESTs, 8 Proteins product : hypothetical LOC667413 pseudo : _no_value transcript_id : XR_032929.1

name	LOC627775 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271744 GeneID:627775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : similar to X-linked lymphocyte-regulated 5D pseudo : _no_value transcript_id : XR_032949.1

name	LOC667437 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271752 GeneID:667437
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to xlr3a gene product pseudo : _no_value transcript_id : XR_032994.1

name	EG667446 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271753 GeneID:667446 MGI:3645523
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 4 Proteins product : predicted gene, EG667446 pseudo : _no_value transcript_id : XR_035679.1

name	4930428E23Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271759 GeneID:434800 MGI:3588243
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930428E23 gene transcript_id : XR_035328.1

name	EG667190 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407543 GeneID:667190 MGI:3646324
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 244 ESTs, 10 Proteins product : predicted gene, EG667190 pseudo : _no_value transcript_id : XR_002058.1

name	LOC667218 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271762 GeneID:667218
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to D19Bwg1357e protein pseudo : _no_value transcript_id : XR_033077.1

name	LOC667496 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271764 GeneID:667496
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 93 ESTs, 3 Proteins product : similar to high mobility group nucleosomal binding domain 1 pseudo : _no_value transcript_id : XR_033121.1

clone name	MSMg01-422G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-474A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-124J21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-469F07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-162H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-435M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-385J03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-069H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-380A14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-122E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-095L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405E22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-537J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303G19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127J19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-382M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232B05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026G16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067O11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335M13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-239C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327P06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-123A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-084C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-083O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141J08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-050M12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-051N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343H08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106C05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-233H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337I21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190G20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063C06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249L16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-269I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-156J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030F07
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-233H16.b	B6Ng01-233H16.g
ACC	GA045526	GA045527
length	1,148	904
definition	B6Ng01-233H16.b	B6Ng01-233H16.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(72,822,556 - 72,823,698)	(73,001,483 - 73,002,384)
sequence	ggaattctcttatgtgagtaacctcatactatttcttcagaaatgattcc accctctggcaactgactgtatgatggttacaagacagtcaattaatcag tctccatttcctttatattagggcatattcattctctctgtgtctctgtc tctccctctgtcttttcttccccacaaatataaacggatatatagaaaga agtcaatatacatctacctacctatagctttcagttatgttaaaatgact tggatttttttaaactatgaatcatagggtctgattttgatgaattatac agtgatcaatttcaagttatttattagctaccaaaagcagattgatggag ttgtggttcaaataatgtgataatgaatggccttctcctgcctgggcggt tctttcctgcatcgaactcaaaggtagctcaaagtgggcttgaaaagccc cagacagacccttgtttgtcaccctggcagcatcgcgaaaagaaccggga agtcctctttccccagggactgaataagccccaaagaccctcccactgct cgcgcgggcccgtggtgcactcccacctgaacctctcttgacccgctgta tcccagatctggagcttgatgcgttttcctggctcgatctccaccaaacg ggagaaaaaatctacccccacggtgggatctgaaacctgagcaaagcggc cctcggtgaagcggcggatcaggcaggacttgcccaccgtggaatcgccg atgacaatgagccggaactggtacagccagatggcctccatggcagtggc ctggcaggactcttcggcccgggcctggggaggcgggagggggcgcccca ccaaggcctttagcacagatcaacccgtttctaggatcgggccgcgagaa catcacctggcctggtagctgaaagcaagggtaggcccaggcgctggggg aacgaagggatggatgctgcgctcgcaaaggtgatgaatggcagcagcat cagcaccacgcactctgactcatcactgaaaaccgagttactgtaatttc tctgcgtagacgcggcagtagtttccaccacctgttctgtagaggagcgc acacaaaaacggacagagaaagtatggatctggattttaattataccg	gaattcacagatgcagtggtctaggatcttagaagactgggagacccgag tttctttctttgtctgcctgtctgtctctgtcctttctatctgtccccct gcctctctgtctctgtctctgtctctgtctctgtctctgtcttctgtctc tctctgtctctcaccatctctctctacctctctctctctccctctctgtt tgtgtcagtgtatgtgtgtgtcccatggtcaaaaagctaggagactcaag tccctgaaggaggtccatcttggttcagggtttggcagttcttatggtgt tgagctcagtattgtgtgagaaggacaggattggctgtaggggaaacctt aaggtttcatgtatccccaggccataggtcaggtgtgcaggaggtgcata aagatcctagggctaaggcaggggtattgtcccctatacttctgttcagg tggatgagacaactgtgtaacactaatatggagggtggctggatcagtcc ttccttgtggttgcaggccttgcacctctgagaactcagagcaggcctgc ctgtgcagacagaactctcttggttgtattagagcagatccctcctgcaa tttggtagggagggagaattgagaggcaatgtcaggcttgtctcctcgag actgttagaggggtcttcttccaccagctgtgaactaagatctcaggagt gcgaggctggacctctggagattctcagtgctcatgaaaggaaggcttgc ctgtgggtcgtgaaatcatttcccacatggtcatggtatccatcatgtgg aaccaaagagacccatctgccctggaaactgtgcctggaactgtacatat tggtgatccagaggcagagaataggtaggttaggtaggtaggtagggaag gggg
quality values	Open. Hide. 10 13 17 34 35 58 54 58 58 58 45 52 42 62 62 62 62 62 62 62 62 62 62 62 47 47 62 62 62 47 62 62 62 51 51 36 32 24 21 21 56 59 62 59 62 59 59 62 62 59 43 62 62 49 49 62 62 62 62 62 62 62 62 62 59 59 59 62 62 59 62 62 54 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 54 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 39 62 54 62 62 62 62 48 62 47 62 62 62 62 58 58 54 58 58 58 39 52 54 58 54 58 58 58 58 58 54 58 58 54 54 58 58 54 42 58 58 54 45 34 58 58 58 54 58 54 52 58 54 54 52 58 58 54 58 58 58 54 58 58 54 58 58 54 47 58 58 54 58 58 52 48 58 58 58 47 42 54 58 58 58 58 58 53 58 53 53 58 50 58 50 58 38 42 58 58 51 53 58 53 58 42 47 58 58 49 51 40 51 50 51 58 45 46 54 39 49 58 50 58 46 49 58 47 41 51 58 58 35 53 58 53 58 49 52 53 58 53 46 37 50 53 58 51 32 42 51 34 58 49 41 52 58 48 58 35 58 58 58 58 58 46 40 53 53 42 39 58 58 41 58 39 50 39 58 42 53 58 51 32 38 45 53 50 44 41 16 21 40 41 51 58 37 35 17 58 50 27 41 49 50 40 50 50 53 39 53 39 41 52 47 44 27 39 37 52 42 49 54 31 32 33 33 16 21 26 40 39 51 28 23 51 32 45 28 50 38 34 49 50 37 37 50 25 45 53 37 42 39 51 39 27 42 31 34 53 32 21 45 40 45 51 26 53 53 32 39 33 28 31 40 36 33 32 31 37 33 38 40 37 32 32 42 35 34 53 22 41 41 42 24 22 38 33 12 13 19 23 40 43 41 39 32 32 17 24 6 21 9 15 31 24 37 32 34 28 17 6 15 18 53 51 24 52 40 22 27 26 19 52 52 33 22 13 35 20 10 52 46 17 21 51 51 46 30 26 24 30 45 45 31 26 33 33 14 12 24 27 8 12 7 51 30 31 15 17 6 15 8 11 18 31 39 38 18 24 37 29 22 30 51 31 30 13 18 9 9 31 38 30 13 40 27 27 16 30 32 8 30 11 26 32 28 14 25 30 16 8 15 31 10 46 31 34 19 12 41 28 25 12 40 12 30 23 48 25 9 30 27 29 21 41 21 16 11 21 30 26 36 11 10 9 20 30 21 30 29 23 46 33 41 16 15 26 24 10 35 22 6 44 25 13 17 30 30 22 15 29 23 20 31 17 7 17 10 14 7 32 26 35 24 22 17 11 18 32 9 13 26 30 13 7 19 19 12 6 16 6 6 19 13 10 15 7 6 7 5 14 27 10 16 10 17 6 17 21 12 8 8 21 7 6 6 7 8 17 21 19 32 32 21 39 31 21 14 6 8 25 9 19 20 25 34 21 22 15 33 16 23 27 10 5 7 8 29 21 15 8 28 14 7 23 10 11 28 5 27 16 27 19 21 27 6 21 29 8 9 6 4 7 8 9 6 3 5 3 3 3 4 4 4 8 3 3 4 9 7 9 4 7 5 8 12 12 7 6 11 28 28 24 22 15 6 25 9 5 3 3 4 5 14 5 4 4 5 15 4 6 5 2 20 8 12 8 2 1 3 24 23 11 14 4 12 6 14 14 8 21 15 5	Open. Hide. 62 47 35 47 62 44 42 62 47 62 59 62 39 43 17 18 30 43 27 36 50 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 49 62 62 62 62 59 49 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 49 54 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 44 59 62 62 62 62 62 62 62 62 43 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 62 62 62 62 62 47 54 62 62 47 47 54 62 62 62 62 58 54 58 58 58 48 54 58 54 58 44 58 58 58 54 58 58 54 54 58 58 54 54 58 54 58 58 58 54 47 54 52 52 58 58 58 58 58 54 58 58 58 58 53 58 58 50 58 58 58 52 54 46 34 58 58 58 58 58 46 54 58 58 58 58 54 46 34 58 52 52 58 53 54 35 58 39 50 51 30 46 49 58 49 58 58 58 47 58 50 50 50 47 29 45 39 37 50 51 49 35 58 50 58 52 58 58 58 37 46 42 58 37 49 47 49 51 40 58 43 51 52 39 58 49 49 48 49 36 46 58 51 51 53 50 50 51 51 49 39 39 50 50 19 49 44 44 16 54 44 46 37 49 37 52 58 37 58 50 51 26 51 37 49 32 50 53 42 50 49 29 58 42 58 50 37 32 53 53 52 51 50 49 35 38 35 47 39 35 54 50 49 52 20 47 21 26 33 42 40 49 49 43 42 52 26 41 49 23 41 41 39 29 45 45 40 50 34 37 49 38 52 37 53 25 36 52 41 53 33 33 29 51 39 30 53 45 37 34 52 36 35 19 37 42 44 28 20 33 53 53 37 41 38 33 31 23 11 36 34 42 40 34 31 33 39 32 40 40 31 37 35 36 53 52 18 47 31 31 22 32 22 34 33 52 24 52 37 42 34 31 51 51 30 31 29 29 31 31 51 46 36 32 33 37 51 45 31 51 41 31 31 32 31 27 29 18 31 20 28 31 51 26 31 36 43 34 31 35 37 29 31 31 31 36 28 28 28 24 32 33 46 25 26 46 19 9 6 40 40 25 18 26 32 31 24 46 31 14 11 18 9 33 27 24 32 39 27 26 24 21 26 17 7 6 37 27 30 31 19 30 20 25 30 25 30 24 29 24 30 30 25 33 34 38 31 44 33 13 14 24 32 32 44 11 26 37 33 30 24 29 32 32 16 12 8 15 12 9 26 15 14 17 30 25 20 6 12 14 18 8 38 8 25 20 22 7 4 5 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_72822556_72823698
seq2: B6Ng01-233H16.b_45_1192

seq1  GGAATTCTCTTATGTGAGTAACCTCATACTATTTCTTCAGAAATGATTCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAATTCTCTTATGTGAGTAACCTCATACTATTTCTTCAGAAATGATTCC  50

seq1  ACCCTCTGGCAACTGACTGTATGATGGTTACAAGACAGTCAATTAATCAG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCTCTGGCAACTGACTGTATGATGGTTACAAGACAGTCAATTAATCAG  100

seq1  TCTCCATTTCCTTTATATTAGGGCATATTCATTCTCTCTGTGTCTCTGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCATTTCCTTTATATTAGGGCATATTCATTCTCTCTGTGTCTCTGTC  150

seq1  TCTCCCTCTGTCTTTTCTTCCCCACAAATATAAACGGATATATAGAAAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCCCTCTGTCTTTTCTTCCCCACAAATATAAACGGATATATAGAAAGA  200

seq1  AGTCAATATACATCTACCTACCTATAGCTTTCAGTTATGTTAAAATGACT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCAATATACATCTACCTACCTATAGCTTTCAGTTATGTTAAAATGACT  250

seq1  TGGATTTTTTTAAACTATGAATCATAGGGTCTGATTTTGATGAATTATAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATTTTTTTAAACTATGAATCATAGGGTCTGATTTTGATGAATTATAC  300

seq1  AGTGATCAATTTCAAGTTATTTATTAGCTACCAAAAGCAGATTGATGGAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGATCAATTTCAAGTTATTTATTAGCTACCAAAAGCAGATTGATGGAG  350

seq1  TTGTGGTTCAAATAATGTGATAATGAATGGCCTTCTCCTGCCTGGGCGGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGGTTCAAATAATGTGATAATGAATGGCCTTCTCCTGCCTGGGCGGT  400

seq1  TCTTTCCTGCATCGAACTCAAAGGTAGCTCAAAGTGGGCTTGAAAAGCCC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCCTGCATCGAACTCAAAGGTAGCTCAAAGTGGGCTTGAAAAGCCC  450

seq1  CAGACAGACCCTTGTTTGTCACCCTGGCAGCATCGCGAAAAGAACCGGGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGACAGACCCTTGTTTGTCACCCTGGCAGCATCGCGAAAAGAACCGGGA  500

seq1  AGTCCTCTTTCCCCAGGGACTGAATAAGCCCCAAAGACCCTCCCACTGCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTCTTTCCCCAGGGACTGAATAAGCCCCAAAGACCCTCCCACTGCT  550

seq1  CGCGCGGGCCCGTGGTGCACTCCCACCTGAACCTCTCTTGACCCGCTGTA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGCGCGGGCCCGTGGTGCACTCCCACCTGAACCTCTCTTGACCCGCTGTA  600

seq1  TCCCAGATCTGGAGCTTGATGCGTTTTCCTGGCTCGATCTCCACCAAACG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCCAGATCTGGAGCTTGATGCGTTTTCCTGGCTCGATCTCCACCAAACG  650

seq1  GGAGAAAAAATCTACCCCCACGGTGGGATCTGAAACCTGAGCAAAGCGGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAGAAAAAATCTACCCCCACGGTGGGATCTGAAACCTGAGCAAAGCGGC  700

seq1  CCTCGGTGAAGCGGCGGATCAGGCAGGACTTGCCCACCGTGGAATCGCCG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCGGTGAAGCGGCGGATCAGGCAGGACTTGCCCACCGTGGAATCGCCG  750

seq1  ATGACAATGAGCCGGAACTGGTACAGCCAGATGGCCTCCATGGCAGTGGC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGACAATGAGCCGGAACTGGTACAGCCAGATGGCCTCCATGGCAGTGGC  800

seq1  CTGGCAGGACTCTTCGGCCCGGGCCTGGGGAGGCGGGAGGGGGCGCCCCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCAGGACTCTTCGGCCCGGGCCTGGGGAGGCGGGAGGGGGCGCCCCA  850

seq1  CCAAGGCC-TTAGCACAGATCAACCCGTTTCTA-GATC-GGCCGCGAGAA  897
      |||||||| |||||||||||||||||||||||| |||| |||||||||||
seq2  CCAAGGCCTTTAGCACAGATCAACCCGTTTCTAGGATCGGGCCGCGAGAA  900

seq1  CATCA-CTGGCCTGGTAGCCTGAAGCAA-GGTAGGCCCAGGCGCTGGGGG  945
      ||||| |||||||||||||   |||||| |||||||||||||||||||||
seq2  CATCACCTGGCCTGGTAGCTGAAAGCAAGGGTAGGCCCAGGCGCTGGGGG  950

seq1  AACGAAGGGATGGATGCTGCGCTCGCAAAGGTGATGAAATGGCAGCAGCA  995
      |||||||||||||||||||||||||||||||||||| |||||||||||||
seq2  AACGAAGGGATGGATGCTGCGCTCGCAAAGGTGATG-AATGGCAGCAGCA  999

seq1  TCAGCACCACGCACTCTGACTCATCACTGAAAACCGAGTTACTGTAA-TT  1044
      ||||||||||||||||||||||||||||||||||||||||||||||| ||
seq2  TCAGCACCACGCACTCTGACTCATCACTGAAAACCGAGTTACTGTAATTT  1049

seq1  CTCTGCGTAGACGCGGCAGTAGTTT-CACCACACTG-TCTGTTAGAGGAG  1092
      ||||||||||||||||||||||||| |||||| ||| |||| ||||||||
seq2  CTCTGCGTAGACGCGGCAGTAGTTTCCACCAC-CTGTTCTG-TAGAGGAG  1097

seq1  CGCACACAAAAACGGACAG-GAGAGTAATGTGTTCT-GTTTTTAATTATA  1140
      ||||||||||||||||||| || ||| ||| | ||| | |||||||||||
seq2  CGCACACAAAAACGGACAGAGAAAGT-ATG-GATCTGGATTTTAATTATA  1145

seq1  CCG  1143
      |||
seq2  CCG  1148

seq1: chrX_73001483_73002384
seq2: B6Ng01-233H16.g_67_970 (reverse)

seq1  CCACCTT-CCTACCTACCTACCT-ACCTACCTATTCTCTGCCTCTGGATC  48
      || |||| ||||||||||||||| ||||||||||||||||||||||||||
seq2  CCCCCTTCCCTACCTACCTACCTAACCTACCTATTCTCTGCCTCTGGATC  50

seq1  ACCAATATGTACAGTTCCAGGCACAGTTTCCAGGGCAGATGGGTCTCTTT  98
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAATATGTACAGTTCCAGGCACAGTTTCCAGGGCAGATGGGTCTCTTT  100

seq1  GGTTCCACATGATGGATACCATGACCATGTGGGAAATGATTTCACGACCC  148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTCCACATGATGGATACCATGACCATGTGGGAAATGATTTCACGACCC  150

seq1  ACAGGCAAGCCTTCCTTTCATGAGCACTGAGAATCTCCAGAGGTCCAGCC  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCAAGCCTTCCTTTCATGAGCACTGAGAATCTCCAGAGGTCCAGCC  200

seq1  TCGCACTCCTGAGATCTTAGTTCACAGCTGGTGGAAGAAGACCCCTCTAA  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGCACTCCTGAGATCTTAGTTCACAGCTGGTGGAAGAAGACCCCTCTAA  250

seq1  CAGTCTCGAGGAGACAAGCCTGACATTGCCTCTCAATTCTCCCTCCCTAC  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCTCGAGGAGACAAGCCTGACATTGCCTCTCAATTCTCCCTCCCTAC  300

seq1  CAAATTGCAGGAGGGATCTGCTCTAATACAACCAAGAGAGTTCTGTCTGC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATTGCAGGAGGGATCTGCTCTAATACAACCAAGAGAGTTCTGTCTGC  350

seq1  ACAGGCAGGCCTGCTCTGAGTTCTCAGAGGTGCAAGGCCTGCAACCACAA  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGGCAGGCCTGCTCTGAGTTCTCAGAGGTGCAAGGCCTGCAACCACAA  400

seq1  GGAAGGACTGATCCAGCCACCCTCCATATTAGTGTTACACAGTTGTCTCA  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAGGACTGATCCAGCCACCCTCCATATTAGTGTTACACAGTTGTCTCA  450

seq1  TCCACCTGAACAGAAGTATAGGGGACAATACCCCTGCCTTAGCCCTAGGA  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACCTGAACAGAAGTATAGGGGACAATACCCCTGCCTTAGCCCTAGGA  500

seq1  TCTTTATGCACCTCCTGCACACCTGACCTATGGCCTGGGGATACATGAAA  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTATGCACCTCCTGCACACCTGACCTATGGCCTGGGGATACATGAAA  550

seq1  CCTTAAGGTTTCCCCTACAGCCAATCCTGTCCTTCTCACACAATACTGAG  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTAAGGTTTCCCCTACAGCCAATCCTGTCCTTCTCACACAATACTGAG  600

seq1  CTCAACACCATAAGAACTGCCAAACCCTGAACCAAGATGGACCTCCTTCA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAACACCATAAGAACTGCCAAACCCTGAACCAAGATGGACCTCCTTCA  650

seq1  GGGACTTGAGTCTCCTAGCTTTTTGACCATGGGACACACACATACACTGA  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGACTTGAGTCTCCTAGCTTTTTGACCATGGGACACACACATACACTGA  700

seq1  CACAAACAGAGAGGGAGAGAGAGAGAGGTAGAGAGAGATGGTGAGAGACA  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAACAGAGAGGGAGAGAGAGAGAGGTAGAGAGAGATGGTGAGAGACA  750

seq1  GAGAGAGACAGAAGACAGAGACAGAGACAGAGACAGAGACAGAGACAGAG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGAGAGACAGAAGACAGAGACAGAGACAGAGACAGAGACAGAGACAGAG  800

seq1  AGGCAGGGGGACAGATAGAAAGGACAGAGACAGACAGGCAGACAAAGAAA  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCAGGGGGACAGATAGAAAGGACAGAGACAGACAGGCAGACAAAGAAA  850

seq1  GAAACTCGGGTCTCCCAGTCTTCTAAGATCCTAGACCACTGCATCTGTGA  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACTCGGGTCTCCCAGTCTTCTAAGATCCTAGACCACTGCATCTGTGA  900

seq1  ATTC  902
      ||||
seq2  ATTC  904

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information