MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-235M17
Chromosome	X (Build37)
Map Location	8,450,012 - 8,451,172
singlet/doublet	singlet
Overlap gene	EG436188
Upstream gene	Otud5, Pim2, Slc35a2, Pqbp1, Timm17b, Pcsk1n, Eras, Hdac6, LOC668974, Gata1, Glod5, LOC668975, EG627737, EG632013, Suv39h1, Was, EG627782, Wdr13, Rbm3, Tbc1d25, Ebp, Porcn, Ftsj1, Slc38a5, Ssxb10, Ssxb9, Ssxb1, Ssxb2, LOC546263, Ssxb6, Ssxb3, EG627853, EG627857, LOC668977, LOC631002, Ssx9, Ssxb5, LOC625480
Downstream gene	B630019K06Rik, LOC100009698, LOC436189, LOC673817, LOC331380, EG434726, LOC100043940, EG434727, LOC436190, LOC100042782, EG668980, Fthl17, LOC100043942, EG434728, LOC100043943, LOC385316, EG434729, LOC100043944, LOC628008, 4930402K13Rik, EG436193, Lancl3, Xk, 1700012L04Rik, EG628040, LOC100042834, LOC100042839, Rp23-423l11.5, Cybb, EG333452, LOC100042867, Dynlt3, 1700054O13Rik, 4930557A04Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Otud5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54644 MGI:1859615
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pim2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18715 MGI:97587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc35a2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22232 MGI:1345297
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pqbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54633 MGI:1859638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Timm17b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21855 MGI:1343176
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pcsk1n (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30052 MGI:1353431
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Eras (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353283 MGI:2665023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15185 MGI:1333752
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668974 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668974
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Gata1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14460 MGI:95661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glod5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69824 MGI:1917074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668975 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins pseudo : _no_value

name	EG627737 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627737 MGI:3644276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 7 Proteins

name	EG632013 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:632013 MGI:3643105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 254 ESTs, 4 Proteins

name	Suv39h1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20937 MGI:1099440
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Was (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22376 MGI:105059
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627782 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627782 MGI:3646481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Wdr13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73447 MGI:1914661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbm3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19652 MGI:1099460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tbc1d25 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209815 MGI:2444862
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ebp (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13595 MGI:107822
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Porcn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53627 MGI:1890212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Ftsj1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54632 MGI:1859648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc38a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209837 MGI:2148066
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssxb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385312 MGI:2446779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssxb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387131 MGI:2446778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssxb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67985 MGI:1915235
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssxb2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387132 MGI:2446771
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC546263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 Proteins

name	Ssxb6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668976 MGI:2446775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 14 Proteins

name	Ssxb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278174 MGI:2446772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG627853 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627853 MGI:3646261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins

name	EG627857 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:627857 MGI:3646258
definition	note : predicted gene, EG627857 pseudo : _no_value

name	LOC668977 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein pseudo : _no_value

name	LOC631002 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssx9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382206 MGI:2446773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ssxb5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:387586 MGI:2446774
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC625480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG436188 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436188 MGI:3642927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins

name	B630019K06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102941 MGI:2147918
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100009698 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100009698
definition	note : pyruvate kinase, muscle pseudogene pseudo : _no_value

name	LOC436189 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC673817 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673817
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC331380 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:331380
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	EG434726 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434726 MGI:3642940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins

name	LOC100043940 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	EG434727 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434727 MGI:3704135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 13 Proteins

name	LOC436190 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	LOC100042782 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins

name	EG668980 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668980 MGI:3648373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 4 Proteins pseudo : _no_value

name	Fthl17 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83457 MGI:1933180
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein pseudo : _no_value

name	EG434728 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434728 MGI:3704136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 15 Proteins

name	LOC100043943 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC385316 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385316
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	EG434729 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434729 MGI:3642941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043944 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043944
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC628008 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:628008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 16 Proteins pseudo : _no_value

name	4930402K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75775 MGI:1923025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	EG436193 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436193 MGI:3643671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins

name	Lancl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236285 MGI:2443335
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Xk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22439 MGI:103569
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700012L04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76383 MGI:1923633
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628040 MGI:3648590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 261 ESTs, 3 Proteins

name	LOC100042834 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs

name	LOC100042839 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Rp23-423l11.5 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins

name	Cybb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13058 MGI:88574
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG333452 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:333452 MGI:3643069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	LOC100042867 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Dynlt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67117 MGI:1914367
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700054O13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930557A04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein

name	Otud5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560767 GeneID:54644 MGI:1859615
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : OTU domain containing 5 transcript_id : NM_138604.2

name	Pim2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133908617 GeneID:18715 MGI:97587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proviral integration site 2 transcript_id : NM_138606.2

name	Slc35a2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17530970 GeneID:22232 MGI:1345297
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 35 (UDP-galactose transporter), member A2 transcript_id : NM_078484.1

name	Pqbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130717 GeneID:54633 MGI:1859638
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : polyglutamine binding protein 1 transcript_id : NM_019478.3

name	Timm17b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357331 GeneID:21855 MGI:1343176
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 17b transcript_id : NM_011591.3

name	Pcsk1n (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475958 GeneID:30052 MGI:1353431
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proprotein convertase subtilisin/kexin type 1 inhibitor transcript_id : NM_013892.2

name	Eras (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31581542 GeneID:353283 MGI:2665023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ES cell-expressed Ras transcript_id : NM_181548.2

name	Hdac6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6996925 GeneID:15185 MGI:1333752
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 6 transcript_id : NM_010413.2

name	Gata1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679946 GeneID:14460 MGI:95661
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : GATA binding protein 1 transcript_id : NM_008089.1

name	Glod5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360348 GeneID:69824 MGI:1917074
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glyoxalase domain containing 5 transcript_id : NM_027227.2

name	EG627737 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406983 GeneID:627737 MGI:3644276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 94 ESTs, 7 Proteins product : predicted gene, EG627737 transcript_id : XM_892438.2

name	EG632013 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270949 GeneID:632013 MGI:3643105
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 254 ESTs, 4 Proteins product : predicted gene, EG632013 transcript_id : XM_001476014.1

name	Suv39h1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6755701 GeneID:20937 MGI:1099440
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : suppressor of variegation 3-9 homolog 1 (Drosophila) transcript_id : NM_011514.1

name	Was (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6678580 GeneID:22376 MGI:105059
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Wiskott-Aldrich syndrome homolog (human) transcript_id : NM_009515.1

name	Wdr13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370534 GeneID:73447 MGI:1914661
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : WD repeat domain 13 transcript_id : NM_026137.3

name	Rbm3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367595 GeneID:19652 MGI:1099460
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein 3 transcript_id : NM_016809.3

name	Tbc1d25 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142359040 GeneID:209815 MGI:2444862
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TBC1 domain family, member 25 transcript_id : NM_172478.2

name	Ebp (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31560706 GeneID:13595 MGI:107822
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phenylalkylamine Ca2+ antagonist (emopamil) binding protein transcript_id : NM_007898.2

name	Porcn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803118 GeneID:53627 MGI:1890212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : porcupine homolog (Drosophila) transcript_id : NM_016913.2

name	Porcn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382779 GeneID:53627 MGI:1890212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : porcupine homolog (Drosophila) transcript_id : NM_145907.2

name	Porcn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366168 GeneID:53627 MGI:1890212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : porcupine homolog (Drosophila) transcript_id : NM_145908.2

name	Porcn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801705 GeneID:53627 MGI:1890212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : porcupine homolog (Drosophila) transcript_id : NM_023638.2

name	Ftsj1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46877061 GeneID:54632 MGI:1859648
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FtsJ homolog 1 (E. coli) transcript_id : NM_133991.2

name	Slc38a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369655 GeneID:209837 MGI:2148066
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 38, member 5 transcript_id : NM_172479.1

name	Ssxb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51468089 GeneID:385312 MGI:2446779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B, breakpoint 10 transcript_id : NM_199064.1

name	Ssxb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51468091 GeneID:387131 MGI:2446778
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B, breakpoint 9 transcript_id : NM_199066.1

name	Ssxb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51468095 GeneID:67985 MGI:1915235
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B, breakpoint 1 transcript_id : NM_026492.2

name	Ssxb2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350705 GeneID:387132 MGI:2446771
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B, breakpoint 2 transcript_id : NM_001001450.2

name	LOC546263 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271026 GeneID:546263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 14 Proteins product : similar to Ssxb3 protein transcript_id : XM_620949.4

name	Ssxb6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271028 GeneID:668976 MGI:2446775
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 14 Proteins product : synovial sarcoma, X member B, breakpoint 6 transcript_id : XM_001481250.1

name	Ssxb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130902 GeneID:278174 MGI:2446772
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B, breakpoint 3 transcript_id : NM_198898.2

name	EG627853 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:82999812 GeneID:627853 MGI:3646261
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 Proteins product : predicted gene, EG627853 transcript_id : XM_892557.1

name	LOC631002 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:125858423 GeneID:631002
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B family member transcript_id : NM_001081565.1

name	Ssx9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130912 GeneID:382206 MGI:2446773
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X breakpoint 9 transcript_id : NM_199063.2

name	Ssxb5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142361643 GeneID:387586 MGI:2446774
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : synovial sarcoma, X member B, breakpoint 5 transcript_id : NM_199319.2

name	LOC625480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:125858425 GeneID:625480
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical LOC625480 transcript_id : NM_001081564.1

name	EG436188 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271030 GeneID:436188 MGI:3642927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins product : predicted gene, EG436188 transcript_id : XM_488314.5

name	B630019K06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802569 GeneID:102941 MGI:2147918
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B630019K06 gene transcript_id : NM_175327.3

name	EG434726 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270952 GeneID:434726 MGI:3642940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins product : predicted gene, EG434726 transcript_id : XM_486615.4

name	EG434727 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270953 GeneID:434727 MGI:3704135
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 15 ESTs, 13 Proteins product : predicted gene, EG434727 transcript_id : XM_486616.4

name	LOC100042782 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270954 GeneID:100042782
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 18 Proteins product : similar to ferritin, heavy polypeptide-like 17 transcript_id : XM_001476385.1

name	Fthl17 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752592 GeneID:83457 MGI:1933180
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ferritin, heavy polypeptide-like 17 transcript_id : NM_031261.1

name	EG434728 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270956 GeneID:434728 MGI:3704136
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 14 ESTs, 15 Proteins product : predicted gene, EG434728 transcript_id : XM_486618.4

name	EG434729 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84662778 GeneID:434729 MGI:3642941
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434729 transcript_id : NM_001038697.1

name	4930402K13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407002 GeneID:75775 MGI:1923025
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4930402K13 gene transcript_id : XM_135594.5

name	EG436193 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51830682 GeneID:436193 MGI:3643671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 20 Proteins product : predicted gene, EG436193 transcript_id : XM_488319.1

name	Lancl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373066 GeneID:236285 MGI:2443335
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LanC lantibiotic synthetase component C-like 3 (bacterial) transcript_id : NM_173414.2

name	Xk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134053936 GeneID:22439 MGI:103569
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kell blood group precursor (McLeod phenotype) homolog transcript_id : NM_023500.2

name	1700012L04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142350916 GeneID:76383 MGI:1923633
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700012L04 gene transcript_id : NM_029588.2

name	EG628040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407003 GeneID:628040 MGI:3648590
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 22 mRNAs, 261 ESTs, 3 Proteins product : predicted gene, EG628040 transcript_id : XM_892769.2

name	LOC100042834 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270958 GeneID:100042834
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 10 ESTs product : hypothetical protein LOC100042834 transcript_id : XM_001476540.1

name	LOC100042839 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270960 GeneID:100042839
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : hypothetical protein LOC100042839 transcript_id : XM_001476550.1

name	Rp23-423l11.5 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407004 GeneID:547154
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 11 ESTs, 5 Proteins product : Novel protein similar to histone H2a (1700012L04Rik) transcript_id : XM_622011.3

name	Cybb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227198 GeneID:13058 MGI:88574
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytochrome b-245, beta polypeptide transcript_id : NM_007807.3

name	EG333452 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149270962 GeneID:333452 MGI:3643069
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : predicted gene, EG333452 transcript_id : XM_285588.6

name	LOC100042867 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270963 GeneID:100042867
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : hypothetical protein LOC100042867 transcript_id : XM_001476632.1

name	Dynlt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364447 GeneID:67117 MGI:1914367
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dynein light chain Tctex-type 3 transcript_id : NM_025975.4

name	1700054O13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385599 GeneID:67334 MGI:1914584
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700054O13 gene transcript_id : NM_026096.1

name	4930557A04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271037 GeneID:385317 MGI:1922521
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 1 Protein product : RIKEN cDNA 4930557A04 gene transcript_id : XM_001481251.1

name	Otud5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31560768 CCDS:CCDS29975.1 GeneID:54644 MGI:1859615
definition	codon_start : 1 product : OTU domain containing 5 protein_id : NP_613070.2

name	Pim2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20070430 CCDS:CCDS29976.1 GeneID:18715 MGI:97587
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IDA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence IDA]; GO:0008637 - apoptotic mitochondrial changes [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 exception : alternative start codon note : non-AUG (CUG) translation initiation codon product : serine-threonine protein kinase pim-2 protein_id : NP_613072.1 transl_except : (pos:7455445..7455447,aa:Met)

name	Slc35a2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17530971 GeneID:22232 MGI:1345297
definition	GO_component : GO:0000139 - Golgi membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005338 - nucleotide-sugar transporter activity [Evidence IEA]; GO:0005351 - sugar porter activity [Evidence IEA]; GO:0005459 - UDP-galactose transporter activity [Evidence IMP] [Evidence IDA] GO_process : GO:0008643 - carbohydrate transport [Evidence IDA]; GO:0015780 - nucleotide-sugar transport [Evidence IEA]; GO:0006810 - transport [Evidence IMP] codon_start : 1 exception : unclassified translation discrepancy function : sugar transporter note : UDP-galactose translocator; solute carrier family (UDP-N-acetylglucosamine transporter), member 2 product : solute carrier family 35, member 2 protein_id : NP_511039.1

name	Pqbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980927 CCDS:CCDS29977.1 GeneID:54633 MGI:1859638
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : scurfy candidate 2; polyglutamine tract binding protein-1 product : polyglutamine binding protein 1 protein_id : NP_062351.2

name	Timm17b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468937 CCDS:CCDS29978.1 GeneID:21855 MGI:1343176
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005744 - mitochondrial inner membrane presequence translocase complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IEA] GO_function : GO:0015450 - protein translocase activity [Evidence IEA]; GO:0008565 - protein transporter activity [Evidence IEA] GO_process : GO:0006886 - intracellular protein transport [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : translocator of inner mitochondrial membrane 17 kDa, b; translocator of inner mitochondrial membrane b product : translocator of inner mitochondrial membrane 17b protein_id : NP_035721.1

name	Pcsk1n (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305455 CCDS:CCDS29979.1 GeneID:30052 MGI:1353431
definition	GO_component : GO:0005615 - extracellular space [Evidence IDA]; GO:0005802 - Golgi trans face [Evidence IDA]; GO:0030141 - secretory granule [Evidence IDA] GO_function : GO:0004867 - serine-type endopeptidase inhibitor activity [Evidence IDA] GO_process : GO:0016486 - peptide hormone processing [Evidence IDA] codon_start : 1 exception : mismatches in translation function : inhibits prohormone processing note : protein serine alanine alanine serine; pancreas protein 3; basic protein IA-4; granin-like neuroendocrine peptide product : proprotein convertase subtilisin/kexin type 1 inhibitor protein_id : NP_038920.1

name	Eras (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31559801 CCDS:CCDS29980.1 GeneID:353283 MGI:2665023
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 note : small GTPase E-Ras product : ES cell-expressed Ras protein_id : NP_853526.1

name	Hdac6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6996926 GeneID:15185 MGI:1333752
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence TAS] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0004407 - histone deacetylase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0007026 - negative regulation of microtubule depolymerization [Evidence IDA]; GO:0006476 - protein amino acid deacetylation [Evidence IDA]; GO:0000209 - protein polyubiquitination [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence TAS] codon_start : 1 exception : mismatches in translation note : histone deacetylase 5; scurfy candidate 6 product : histone deacetylase 6 protein_id : NP_034543.2

name	Gata1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679947 CCDS:CCDS29981.1 GeneID:14460 MGI:95661
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IDA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : GATA-binding protein 1 product : GATA binding protein 1 protein_id : NP_032115.1

name	Glod5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312444 CCDS:CCDS29982.1 GeneID:69824 MGI:1917074
definition	GO_function : GO:0018583 - biphenyl-2,3-diol 1,2-dioxygenase activity [Evidence IEA]; GO:0016702 - oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen [Evidence IEA] codon_start : 1 product : glyoxalase domain containing 5 protein_id : NP_081503.1

name	EG627737 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999799 GeneID:627737 MGI:3644276
definition	codon_start : 1 product : similar to ribosomal protein L22 protein_id : XP_897531.1

name	EG632013 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149270950 GeneID:632013 MGI:3643105
definition	codon_start : 1 product : similar to 40S ribosomal protein S29 protein_id : XP_001476064.1

name	Suv39h1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755702 GeneID:20937 MGI:1099440
definition	GO_component : GO:0000785 - chromatin [Evidence IEA]; GO:0005677 - chromatin silencing complex [Evidence IDA]; GO:0005720 - nuclear heterochromatin [Evidence TAS]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003682 - chromatin binding [Evidence IEA]; GO:0018024 - histone-lysine N-methyltransferase activity [Evidence IDA] [Evidence IEA]; GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0008276 - protein methyltransferase activity [Evidence TAS]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006333 - chromatin assembly or disassembly [Evidence IEA]; GO:0016568 - chromatin modification [Evidence IEA]; GO:0006342 - chromatin silencing [Evidence TAS]; GO:0006323 - DNA packaging [Evidence TAS] codon_start : 1 note : Suv39h histone methyltransferase product : suppressor of variegation 3-9 homolog 1 protein_id : NP_035644.1

name	Was (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6678581 CCDS:CCDS29984.1 GeneID:22376 MGI:105059
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0012506 - vesicle membrane [Evidence IDA] GO_function : GO:0042802 - identical protein binding [Evidence IDA] GO_process : GO:0030041 - actin filament polymerization [Evidence IDA]; GO:0030048 - actin filament-based movement [Evidence IDA]; GO:0008154 - actin polymerization and/or depolymerization [Evidence IDA]; GO:0016197 - endosome transport [Evidence IDA]; GO:0042110 - T cell activation [Evidence IMP] codon_start : 1 note : Wiskott-Aldrich syndrome protein product : Wiskott-Aldrich syndrome homolog protein_id : NP_033541.1

name	Wdr13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336024 CCDS:CCDS29986.1 GeneID:73447 MGI:1914661
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : memory-related protein product : WD repeat protein 13 protein_id : NP_080413.1

name	Rbm3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37497112 CCDS:CCDS29987.1 GeneID:19652 MGI:1099460
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0043023 - ribosomal large subunit binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0035196 - miRNA-mediated gene silencing, production of miRNAs [Evidence IDA]; GO:0009409 - response to cold [Evidence IDA]; GO:0043037 - translation [Evidence IDA] codon_start : 1 product : RNA binding motif protein 3 protein_id : NP_058089.2

name	Tbc1d25 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369646 CCDS:CCDS29988.1 GeneID:209815 MGI:2444862
definition	codon_start : 1 exception : mismatches in translation note : ornithine aminotransferase-like 1 product : TBC1 domain family, member 25 protein_id : NP_766066.1

name	Ebp (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681255 CCDS:CCDS29989.1 GeneID:13595 MGI:107822
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence TAS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000247 - C-8 sterol isomerase activity [Evidence IDA] [Evidence IMP]; GO:0047750 - cholestenol delta-isomerase activity [Evidence IEA]; GO:0016853 - isomerase activity [Evidence IEA] GO_process : GO:0006695 - cholesterol biosynthesis [Evidence IEA]; GO:0030097 - hemopoiesis [Evidence IMP]; GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006694 - steroid biosynthesis [Evidence IEA]; GO:0016126 - sterol biosynthesis [Evidence TAS] [Evidence IMP]; GO:0016125 - sterol metabolism [Evidence IEA] codon_start : 1 note : tattered product : phenylalkylamine Ca2+ antagonist (emopamil) binding protein protein_id : NP_031924.1

name	Porcn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094151 CCDS:CCDS29990.1 GeneID:53627 MGI:1890212
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009100 - glycoprotein metabolism [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform Mporc-a is encoded by transcript variant Mporc-a; porcupine-A; porcupine-B; porcupine-C; porcupine-D product : porcupine homolog isoform Mporc-a protein_id : NP_058609.1

name	Porcn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094137 CCDS:CCDS29992.1 GeneID:53627 MGI:1890212
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009100 - glycoprotein metabolism [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform Mporc-c is encoded by transcript variant Mporc-c; porcupine-A; porcupine-B; porcupine-C; porcupine-D product : porcupine homolog isoform Mporc-c protein_id : NP_665914.1

name	Porcn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094145 CCDS:CCDS29993.1 GeneID:53627 MGI:1890212
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009100 - glycoprotein metabolism [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform Mporc-b is encoded by transcript variant Mporc-b; porcupine-A; porcupine-B; porcupine-C; porcupine-D product : porcupine homolog isoform Mporc-b protein_id : NP_665915.1

name	Porcn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094133 CCDS:CCDS29991.1 GeneID:53627 MGI:1890212
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0030176 - integral to endoplasmic reticulum membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0009100 - glycoprotein metabolism [Evidence IDA]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : isoform Mporc-d is encoded by transcript variant Mporc-d; porcupine-A; porcupine-B; porcupine-C; porcupine-D product : porcupine homolog isoform Mporc-d protein_id : NP_076127.1

name	Ftsj1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46877062 CCDS:CCDS29994.1 GeneID:54632 MGI:1859648
definition	codon_start : 1 product : Ftsj homolog protein_id : NP_598752.2

name	Slc38a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369656 GeneID:209837 MGI:2148066
definition	codon_start : 1 exception : mismatches in translation product : solute carrier family 38, member 5 protein_id : NP_766067.1

name	Ssxb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51468090 CCDS:CCDS29995.1 GeneID:385312 MGI:2446779
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : synovial sarcoma, X member B, breakpoint 10 protein_id : NP_951019.1

name	Ssxb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51468092 CCDS:CCDS29996.1 GeneID:387131 MGI:2446778
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : synovial sarcoma, X member B, breakpoint 9 protein_id : NP_951021.1

name	Ssxb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385978 CCDS:CCDS29997.1 GeneID:67985 MGI:1915235
definition	codon_start : 1 product : SSXB1 protein protein_id : NP_080768.1

name	Ssxb2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51371943 CCDS:CCDS29998.1 GeneID:387132 MGI:2446771
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : synovial sarcoma, X member B, breakpoint 2 protein_id : NP_001001450.1

name	LOC546263 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271027 GeneID:546263
definition	codon_start : 1 product : similar to Ssxb3 protein protein_id : XP_620949.4

name	Ssxb6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271029 GeneID:668976 MGI:2446775
definition	codon_start : 1 product : similar to Ssxb3 protein protein_id : XP_001481300.1

name	Ssxb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51371946 CCDS:CCDS29999.1 GeneID:278174 MGI:2446772
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : synovial sarcoma, X member B, breakpoint 3 protein_id : NP_942601.1

name	EG627853 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999813 GeneID:627853 MGI:3646261
definition	codon_start : 1 product : similar to Ssxb3 protein protein_id : XP_897650.1

name	LOC631002 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:125858424 GeneID:631002
definition	codon_start : 1 note : SSXB1-like product : synovial sarcoma, X member B family member protein_id : NP_001075034.1

name	Ssx9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:39979618 CCDS:CCDS30000.1 GeneID:382206 MGI:2446773
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : synovial sarcoma, X member B, breakpoint 4 product : synovial sarcoma, X breakpoint 9 protein_id : NP_951018.1

name	Ssxb5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51468094 CCDS:CCDS30001.1 GeneID:387586 MGI:2446774
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : synovial sarcoma, X member B, breakpoint 5 protein_id : NP_955023.1

name	LOC625480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:125858426 GeneID:625480
definition	codon_start : 1 note : synovial sarcoma, X member B family member product : hypothetical protein LOC625480 protein_id : NP_001075033.1

name	EG436188 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271031 GeneID:436188 MGI:3642927
definition	codon_start : 1 product : similar to SSXB10 protein protein_id : XP_488314.5

name	B630019K06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425012 CCDS:CCDS30002.1 GeneID:102941 MGI:2147918
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC102941 protein_id : NP_780536.1

name	EG434726 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830623 GeneID:434726 MGI:3642940
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486615.1

name	EG434727 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830625 GeneID:434727 MGI:3704135
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486616.1

name	LOC100042782 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270955 GeneID:100042782
definition	codon_start : 1 product : similar to ferritin, heavy polypeptide-like 17 protein_id : XP_001476435.1

name	Fthl17 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752593 CCDS:CCDS30003.1 GeneID:83457 MGI:1933180
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008199 - ferric iron binding [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006879 - iron ion homeostasis [Evidence IEA]; GO:0006826 - iron ion transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ferritin, heavy polypeptide-like 17 protein_id : NP_112551.1

name	EG434728 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830627 GeneID:434728 MGI:3704136
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486618.1

name	EG434729 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84662779 GeneID:434729 MGI:3642941
definition	codon_start : 1 note : Novel protein similar to ferritin, heavy polypeptide-like 17, Fthl17 product : ferritin, heavy polypeptide-like protein_id : NP_001033786.1

name	4930402K13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830631 GeneID:75775 MGI:1923025
definition	codon_start : 1 product : hypothetical protein LOC75775 protein_id : XP_135594.3

name	EG436193 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51830683 GeneID:436193 MGI:3643671
definition	codon_start : 1 product : similar to ferritin heavy chain protein_id : XP_488319.1

name	Lancl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27734148 CCDS:CCDS30007.1 GeneID:236285 MGI:2443335
definition	codon_start : 1 exception : mismatches in translation product : LanC lantibiotic synthetase component C-like 3 protein_id : NP_775590.1

name	Xk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963703 CCDS:CCDS30008.1 GeneID:22439 MGI:103569
definition	GO_component : GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS]; GO:0005215 - transporter activity [Evidence ISS] GO_process : GO:0006865 - amino acid transport [Evidence IEA]; GO:0006810 - transport [Evidence ISS] [Evidence IEA] codon_start : 1 note : McLeod syndrome gene homolog product : Kell blood group precursor (McLeod phenotype) homolog protein_id : NP_075989.1

name	1700012L04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386420 GeneID:76383 MGI:1923633
definition	GO_component : GO:0005694 - chromosome [Evidence IEA] codon_start : 1 note : Novel protein similar to histone H2a (1700012L04Rik) product : histone variant H2al1 protein_id : NP_083864.1

name	EG628040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:82999846 GeneID:628040 MGI:3648590
definition	codon_start : 1 product : similar to Golgi autoantigen, golgin subfamily a, 7 protein_id : XP_897862.1

name	LOC100042834 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270959 GeneID:100042834
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476590.1

name	LOC100042839 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270961 GeneID:100042839
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476600.1

name	Rp23-423l11.5 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:63743381 GeneID:547154
definition	codon_start : 1 product : hypothetical protein protein_id : XP_622011.1

name	Cybb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542440 CCDS:CCDS30010.1 GeneID:13058 MGI:88574
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0050660 - FAD binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006118 - electron transport [Evidence IEA]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : cytochrome b-245, beta polypeptide protein_id : NP_031833.2

name	EG333452 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086068 GeneID:333452 MGI:3643069
definition	codon_start : 1 product : hypothetical protein protein_id : XP_285588.2

name	LOC100042867 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270964 GeneID:100042867
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476682.1

name	Dynlt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543851 CCDS:CCDS30011.1 GeneID:67117 MGI:1914367
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0030286 - dynein complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003774 - motor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : T-complex associated-testis-expressed 1-like; vt-complex-associated-testis-expressed 1-like product : t-complex-associated-testis-expressed 1-like protein_id : NP_080251.3

name	1700054O13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385600 CCDS:CCDS30012.1 GeneID:67334 MGI:1914584
definition	GO_component : GO:0000786 - nucleosome [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007001 - chromosome organization and biogenesis (sensu Eukaryota) [Evidence IEA]; GO:0006334 - nucleosome assembly [Evidence IEA] codon_start : 1 product : Huntingtin interacting protein M protein_id : NP_080372.1

name	4930557A04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271038 GeneID:385317 MGI:1922521
definition	codon_start : 1 product : hypothetical protein LOC385317 protein_id : XP_001481301.1

name	LOC668974 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668974
definition	number : 1 pseudo : _no_value

name	LOC436189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436189
definition	number : 1 pseudo : _no_value

name	LOC673817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673817
definition	number : 1 pseudo : _no_value

name	LOC673817 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673817
definition	number : 2 pseudo : _no_value

name	LOC331380 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:331380
definition	number : 1 pseudo : _no_value

name	LOC385316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385316
definition	number : 2 pseudo : _no_value

name	LOC385316 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385316
definition	number : 1 pseudo : _no_value

name	LOC100043944 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043944
definition	number : 2 pseudo : _no_value

name	LOC100043944 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043944
definition	number : 1 pseudo : _no_value

name	LOC668975 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270948 GeneID:668975
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 3 Proteins product : similar to chromosome 20 open reading frame 111 pseudo : _no_value transcript_id : XR_032513.1

name	EG627782 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270938 GeneID:627782 MGI:3646481
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG627782 pseudo : _no_value transcript_id : XR_035160.1

name	LOC668977 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270951 GeneID:668977
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 1 Protein product : similar to cell division cycle 6 homolog pseudo : _no_value transcript_id : XR_035696.1

name	LOC100043940 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271032 GeneID:100043940
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to zinc finger protein 161 pseudo : _no_value transcript_id : XR_035061.1

name	LOC436190 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271033 GeneID:436190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to zinc finger 5 protein pseudo : _no_value transcript_id : XR_035711.1

name	EG668980 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271034 GeneID:668980 MGI:3648373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 62 ESTs, 4 Proteins product : predicted gene, EG668980 pseudo : _no_value transcript_id : XR_002278.2

name	LOC100043942 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271035 GeneID:100043942
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 1 Protein product : similar to zinc finger 5 protein pseudo : _no_value transcript_id : XR_035064.1

name	LOC100043943 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271036 GeneID:100043943
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to zinc finger protein 161 pseudo : _no_value transcript_id : XR_035065.1

name	LOC628008 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270957 GeneID:628008
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 16 Proteins product : similar to ferritin, heavy polypeptide-like 17 pseudo : _no_value transcript_id : XR_032749.1

clone name	MSMg01-437E06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-100A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-322E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-323G07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315I08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459K19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-062L17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-179B06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-515B13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482I18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-161I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-303I09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-318J24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-335A23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-522O10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-064M14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181L20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052K04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-316G13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160O15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-221D18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-213K15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071L07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-045H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067F22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-207B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-286G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-082L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086N02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-259B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235M17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089A07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-268G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-231D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-294N17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-283K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147H14
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-235M17.b	B6Ng01-235M17.g
ACC	GA047179	GA047180
length	1,158	1,181
definition	B6Ng01-235M17.b	B6Ng01-235M17.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcctcagggaactgatggaggaaatgcggtaagaacggaatgttgg agcccagggttccatgcaggaagtacatcaccaaagggatgtactaaata tccccactatagtatgatgattcctcctcccccatcccctgcattgctta ctcccggttctgtttacctgctgatacttgcattcctctggatacctgag ctttcccttatatctagactactgtctactgtgcagttgtttctctaaaa aaaaaatggctaaccacttcaaatctttctcctctgtcttccttagtcat tctaacctgggacctctttataataaacccataacatttatattatttat taaaggacagcattagagttgaaattattcctatatgtactctttctcca aagacccaagagcttgttttctgtgaaattcttatgaataatagcaaaac agtctgcatgtgattagagtttatagtgctctttaaagggttcccaagtg cttctgttaggaaggcttctctactcaaattgcatgtgcctccactcccc cttaatgctatgtagactttgcattctgaggactgctctgtcaataatgt cctgctcagaatgactgagacctttattctggcaagtcaatgtttcatgg actttgggaccagcattaatacttcaactgcatattttccttatgttttc ttcttaaacatttataaaaattaattttaagtcatattacaaaggaatgg cttcccccacagcccacagtcagtgttatcctaaatggagaacaatgtga agcagtccctctaaaaacataaacaagtcaggctgtccactgtccccact ccttttccctatagttcctgaagcagtaactgtagacaaactacttcaat ttaatcaagggatcaatcaattaataaaatactatagtactaagcaaata tgcacaaaactctggtgcagccaggtttcataattcatactaatggaata aacttccagattaacacaactcatagaagggaggcaatttcatcacctcc agtttctgctatagatgggacatctggaccaaaataaagaaacagaatac ttcagaatcatggaactctttttatcaagggaccaaggagaattcctacg gagtattc	gaattcaaggcccatacataaacatgataaaagcaatctacagcaaacca gtagccaacatcaaagtaaatggagagaagctggaagcaatcccactaaa atcagggactagacaaggctgcccactttctccctaccttttcaacatag tacttgaagtattagccagagcaattcgacaacaaaaggagatcaatggg atacaaattggaaaggaggaagtcaaaatatcactttttgcagatgatat gatagtatatataagtgaccctaaaaattccaccagagaactcctgaacc tgataaacagcttcggtgaagtagctggatataaaattaactcaaacaag tcaatggcctttctctacacaaagaataaacaggctgagaaagaaattag ggaaacaacacccttctcaatagtcacaaataatataaaatatcttggct tgactctaactaaggaagtggaagatctgtatgataagaacttcaagtct ctgaagaaagaaattaaagaagatctcagaagatggaaagatctcccatg ctcatggattggcaggatcaatattgtaaaaatggctatcttgccaaaag caatctacagattcaatgcaatccccatcaaaattccaactcaattcttc aacgaattagaaggagcaatttgcaaattcatctggaataacaaaaaacc taggatagcaaaaactcttctcaaggataaaagaacctctggtggaatca ccatgcctgacctaaagctgtactacagagcaattgtgataaaaactgca tggtactggtatagagacagacaagtagaccaatggaatagaattgaaga cccagaaatgaacccacacacctatggtcacttgatcttcgacaagggag ctaaaaccatccagtggaagaaagacagcattttcaacaattggtcctgg cacaactggttgttatcatgtaagaagaatgccaatcgatccatacttat ctctgtactaagtcaaatctaaatggatcaaagaacttcacataacagag acactgaaacttatagagagaaggtggggaaaagcttgaagaaatgggca caggaaaattttggaacgaacgcaatgcttgtgcgtagaaatcggattga caaagtgggaacctattgtgaaaacttccca
quality values	Open. Hide. 58 31 35 41 58 58 58 62 41 31 52 49 47 47 56 42 54 62 47 41 62 62 62 62 62 49 62 51 38 47 33 34 22 24 27 27 24 33 36 38 46 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 59 49 62 62 62 62 56 62 59 62 62 62 62 62 49 56 59 43 56 46 36 59 62 62 62 62 59 54 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 56 54 56 59 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 54 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 62 62 52 62 62 62 62 62 62 54 62 62 62 62 62 62 62 58 58 46 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 54 58 58 54 58 54 52 58 58 58 58 58 58 46 58 54 41 58 58 58 58 58 58 58 58 41 41 58 52 54 58 58 58 52 58 58 58 58 54 58 54 50 46 58 52 52 58 54 46 49 58 58 31 42 26 47 43 51 54 42 58 58 52 51 58 49 52 52 58 51 53 52 43 34 49 58 52 58 58 49 50 51 58 58 45 50 58 58 37 36 58 58 37 27 47 47 51 58 40 51 41 26 51 52 50 54 54 58 43 40 50 58 54 51 52 41 47 41 47 58 58 50 50 50 51 51 53 53 58 39 58 58 30 41 49 49 41 31 32 25 51 50 52 35 49 50 46 33 50 40 58 54 58 50 50 31 26 50 50 58 51 53 39 46 29 37 39 34 40 52 45 47 34 40 24 29 44 30 51 34 39 41 54 49 27 50 45 45 47 50 42 34 40 52 42 49 53 54 41 37 35 38 38 20 37 37 37 34 51 27 42 41 40 53 53 42 37 54 42 31 47 36 47 26 41 47 28 23 40 33 54 29 40 53 53 26 37 45 25 37 37 52 38 33 28 26 26 49 49 52 40 32 32 32 14 49 31 32 31 42 32 41 31 12 10 10 6 21 39 24 27 40 26 40 32 33 32 40 53 46 51 30 30 31 31 33 27 46 51 31 33 51 33 31 43 36 35 33 33 36 31 43 29 37 38 28 21 35 33 27 33 24 27 28 30 45 20 23 18 29 11 18 42 15 33 9 27 31 26 35 31 28 25 30 46 32 11 33 26 31 19 15 23 46 36 21 32 26 29 6 27 32 23 32 27 34 12 27 21 31 46 46 30 17 18 36 38 31 31 31 31 31 31 31 21 16 32 21 30 31 46 33 29 23 33 34 31 23 29 31 41 41 29 22 21 16 8 21 10 21 37 17 12 17 30 28 14 10 13 33 48 35 31 12 6 11 8 5 13 13 30 27 33 25 35 21 30 12 22 26 9 16 8 10 23 12 7 9 11 7 27 18 13 31 23 22 22 19 25 20 18 21 28 24 43 11 12 10 30 13 21 16 7 31 6 17 11 30 13 17 11 21 48 32 18 21 34 23 22 19 7 8 9 32 11 21 26 28 13 26 18 27 28 27 9 20 7 5 9 11 16 33 15 6 16 6 9 14 16 14 13 26 9 15 8 27 9 4 3 3 28 10 21 38 33 27 20 10 15 27 7 9 6 12 7 8 8 13 13 32 11 3 5 24 7 11 11 17 9 6 11 5 11 26 30 28 7 4 5 2 3 5 10 23 12 9 11 11 12 5 5 7 7 6 15 4 5 12 5 6 5 3 6 6 4 6 5 6 5 21 23 8	Open. Hide. 62 59 41 59 62 59 44 59 62 62 34 43 43 22 28 25 28 25 50 34 62 59 59 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 59 62 62 62 62 62 59 62 59 62 62 56 59 56 59 62 59 62 62 56 59 62 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 56 59 59 48 54 59 62 59 59 62 54 62 62 62 62 62 62 59 59 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 59 54 56 62 62 62 62 62 62 59 62 62 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 47 62 49 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 41 42 58 58 58 58 58 58 58 52 58 42 58 58 58 54 52 58 58 49 58 44 58 58 58 58 58 58 42 41 58 58 58 58 58 54 54 58 58 58 58 52 58 58 58 45 51 58 58 46 51 51 58 58 54 51 58 54 54 58 53 58 58 58 52 48 31 31 58 58 54 58 58 58 58 53 58 58 58 58 58 51 51 46 54 58 52 49 51 51 50 49 58 46 51 58 48 50 58 39 43 51 25 58 51 58 51 58 50 49 43 58 58 40 43 58 51 52 58 58 50 51 49 39 39 24 58 51 58 53 50 50 37 58 50 50 53 52 32 51 58 50 58 37 52 58 42 42 58 52 32 58 54 43 53 44 31 49 54 54 46 44 40 54 38 53 54 39 37 52 53 53 54 41 54 32 40 39 32 42 21 53 54 54 54 35 40 46 49 42 37 54 33 33 52 44 52 45 54 54 54 34 35 45 53 53 42 44 52 29 24 53 53 54 23 16 33 54 54 54 25 54 14 12 54 53 52 32 47 47 32 51 20 25 27 32 45 35 40 32 31 32 52 32 52 31 37 25 13 33 27 23 53 52 32 32 52 40 32 34 42 42 34 45 32 31 38 16 41 31 30 32 32 40 32 31 45 28 46 51 51 51 25 27 31 45 34 35 31 39 46 25 27 28 33 32 37 32 31 31 31 31 41 31 27 27 20 30 25 26 30 33 31 42 36 26 27 13 12 16 40 31 38 33 25 12 22 31 32 37 37 25 33 29 24 38 24 22 12 44 36 27 27 38 47 20 31 30 24 29 22 37 33 24 41 23 32 24 31 32 31 32 36 31 35 17 30 19 24 32 37 32 27 34 31 19 19 28 22 33 29 22 19 18 47 25 23 24 34 34 33 44 41 18 18 27 24 42 33 31 26 31 15 14 24 16 25 19 35 44 28 21 21 19 27 32 32 23 33 48 48 33 32 22 17 32 11 10 19 17 31 24 9 22 32 23 17 19 12 15 12 7 22 15 23 21 26 18 12 20 26 18 27 27 32 27 26 34 20 11 11 7 34 34 12 28 31 16 17 14 18 14 21 27 28 20 26 27 13 26 13 27 10 8 8 10 16 15 12 16 14 3 7 9 15 28 18 16 15 3 3 8 12 30 15 28 22 18 16 30 13 22 15 14 11 27 22 16 29 28 20 20 21 20 13 15 7 4 16 12 12 11 5 3 3 10 25 5 6 4 7 19 17 11 12 30 14 9 18 19 13 9 4 7 16 18 4 4 22 18 7 5 10 4 28 30 19 3 19 22 18 6 9 3 6 15 15 16 8 21 8 4 6 7 23 14 2 5 14 3 3 5 3 3 25 22 15 28 17 15 4 5 15 11 6 9 11 13 12 10 9 7 8 8 10 1 3 1 3 7 4 5 1 2 2 4 4 19 15 16 5 3 1 11 3 7 9 11 4 6 11 11 3 5 8 25 10 12 5 13 20 10 4 1 6 10 7 7 16 25 20 11 4 7 12 5 8 7 6

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_8450012_8451172
seq2: B6Ng01-235M17.b_47_1204 (reverse)

seq1  GAATACTCTGTA-GATATCTCTTTGGTCCTTTTGAT-AAAAGAGTTCATT  48
      |||||||| ||| ||  |||| |||||||  ||||| ||||||||||  |
seq2  GAATACTCCGTAGGAATTCTCCTTGGTCC-CTTGATAAAAAGAGTTCCAT  49

seq1  GAATTCTGAAGTA-TCTGTTTCTTTATTTTTGGTCCAGATGTCCCATCTA  97
      | ||||||||||| |||||||||||| |||||||||||||||||||||||
seq2  G-ATTCTGAAGTATTCTGTTTCTTTA-TTTTGGTCCAGATGTCCCATCTA  97

seq1  TAGCAGAAACTGGA-GTGATGAAATTGCCT-CCTCTTATGAAGTTTGTGT  145
      |||||||||||||| ||||||||||||||| |||  |||||   ||||||
seq2  TAGCAGAAACTGGAGGTGATGAAATTGCCTCCCTTCTATGA--GTTGTGT  145

seq1  TAATCTGGAGTTTTAATTCCATTAGTATGATTTTATGAAA-CTGGCTGCA  194
      |||||||||  ||| |||||||||||||||  |||||||| |||||||||
seq2  TAATCTGGAAGTTT-ATTCCATTAGTATGA-ATTATGAAACCTGGCTGCA  193

seq1  CCAGAGTTTTGTGCATATTTGCTTAGTACTATAGTATTTTATTAATTGAT  244
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAGTTTTGTGCATATTTGCTTAGTACTATAGTATTTTATTAATTGAT  243

seq1  TGATCCCTTGATTAAATTGAAGTAGGTTTGTCTACAGTTACTGCTTCAGG  294
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TGATCCCTTGATTAAATTGAAGTA-GTTTGTCTACAGTTACTGCTTCAGG  292

seq1  AACTATAGGGAAAAGGAGTGGGGACAGTGGACAGCCCTGACTTGTTTATG  344
      |||||||||||||||||||||||||||||||||| |||||||||||||||
seq2  AACTATAGGGAAAAGGAGTGGGGACAGTGGACAG-CCTGACTTGTTTATG  341

seq1  TTTTTAGAGGGACTGCTTCACATTGTTCTCCATTTAGGATAACACTGACT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTAGAGGGACTGCTTCACATTGTTCTCCATTTAGGATAACACTGACT  391

seq1  GTGGGCTGTGGGGGAAGCCATTCCTTTGTAATATGACTTAAAATTAATTT  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGGCTGTGGGGGAAGCCATTCCTTTGTAATATGACTTAAAATTAATTT  441

seq1  TTATAAATGTTTAAGAAGAAAACATAAGGAAAATATGCAGTTGAAGTATT  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAATGTTTAAGAAGAAAACATAAGGAAAATATGCAGTTGAAGTATT  491

seq1  AATGCTGGTCCCAAAGTCCATGAAACATTGACTTGCCAGAATAAAGGTCT  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCTGGTCCCAAAGTCCATGAAACATTGACTTGCCAGAATAAAGGTCT  541

seq1  CAGTCATTCTGAGCAGGACATTATTGACAGAGCAGTCCTCAGAATGCAAA  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTCATTCTGAGCAGGACATTATTGACAGAGCAGTCCTCAGAATGCAAA  591

seq1  GTCTACATAGCATTAAGGGGGAGTGGAGGCACATGCAATTTGAGTAGAGA  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTACATAGCATTAAGGGGGAGTGGAGGCACATGCAATTTGAGTAGAGA  641

seq1  AGCCTTCCTAACAGAAGCACTTGGGAACCCTTTAAAGAGCACTATAAACT  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTTCCTAACAGAAGCACTTGGGAACCCTTTAAAGAGCACTATAAACT  691

seq1  CTAATCACATGCAGACTGTTTTGCTATTATTCATAAGAATTTCACAGAAA  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAATCACATGCAGACTGTTTTGCTATTATTCATAAGAATTTCACAGAAA  741

seq1  ACAAGCTCTTGGGTCTTTGGAGAAAGAGTACATATAGGAATAATTTCAAC  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGCTCTTGGGTCTTTGGAGAAAGAGTACATATAGGAATAATTTCAAC  791

seq1  TCTAATGCTGTCCTTTAATAAATAATATAAATGTTATGGGTTTATTATAA  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAATGCTGTCCTTTAATAAATAATATAAATGTTATGGGTTTATTATAA  841

seq1  AGAGGTCCCAGGTTAGAATGACTAAGGAAGACAGAGGAGAAAGATTTGAA  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGGTCCCAGGTTAGAATGACTAAGGAAGACAGAGGAGAAAGATTTGAA  891

seq1  GTGGTTAGCCATTTTTTTTTTAGAGAAACAACTGCACAGTAGACAGTAGT  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGGTTAGCCATTTTTTTTTTAGAGAAACAACTGCACAGTAGACAGTAGT  941

seq1  CTAGATATAAGGGAAAGCTCAGGTATCCAGAGGAATGCAAGTATCAGCAG  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGATATAAGGGAAAGCTCAGGTATCCAGAGGAATGCAAGTATCAGCAG  991

seq1  GTAAACAGAACCGGGAGTAAGCAATGCAGGGGATGGGGGAGGAGGAATCA  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAACAGAACCGGGAGTAAGCAATGCAGGGGATGGGGGAGGAGGAATCA  1041

seq1  TCATACTATAGTGGGGATATTTAGTACATCCCTTTGGTGATGTACTTCCT  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATACTATAGTGGGGATATTTAGTACATCCCTTTGGTGATGTACTTCCT  1091

seq1  GCATGGAACCCTGGGCTCCAACATTCCGTTCTTACCGCATTTCCTCCATC  1144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCATGGAACCCTGGGCTCCAACATTCCGTTCTTACCGCATTTCCTCCATC  1141

seq1  AGTTCCCTGAGGAATTC  1161
      |||||||||||||||||
seq2  AGTTCCCTGAGGAATTC  1158

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information