MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-241L06
Chromosome	X (Build37)
Map Location	121,628,870 - 121,674,858
singlet/doublet	doublet
Overlap gene	none
Upstream gene	EG625591, LOC665325, EG382265, LOC665364, EG546368, LOC100038940, LOC100038941, EG625699, LOC100038942, LOC100039828, EG434843
Downstream gene	EG665463, EG665522, LOC100038969, LOC100038978, EG665579, EG665611, EG626048
Link	Open Mouse BAC browser

Click to get alignment info.

name	EG625591 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625591 MGI:3644765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	LOC665325 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 107 ESTs, 5 Proteins pseudo : _no_value

name	EG382265 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382265 MGI:3645501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein

name	LOC665364 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 226 ESTs, 5 Proteins pseudo : _no_value

name	EG546368 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546368 MGI:3646000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein

name	LOC100038940 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100038941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG625699 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625699 MGI:3643045
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038942 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039828 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 821 ESTs, 7 Proteins

name	EG434843 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434843 MGI:3646126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG665463 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665463 MGI:3646874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG665522 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665522 MGI:3645463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 983 ESTs, 7 Proteins

name	LOC100038969 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 823 ESTs, 7 Proteins

name	LOC100038978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 813 ESTs, 7 Proteins

name	EG665579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665579 MGI:3649140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG665611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665611 MGI:3646259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG626048 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626048 MGI:3645883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 937 ESTs, 7 Proteins

name	EG625591 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408138 GeneID:625591 MGI:3644765
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : predicted gene, EG625591 transcript_id : XM_621081.3

name	EG382265 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408141 GeneID:382265 MGI:3645501
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs, 1 Protein product : predicted gene, EG382265 transcript_id : XM_356374.4

name	EG546368 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408144 GeneID:546368 MGI:3646000
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs, 1 Protein product : predicted gene, EG546368 transcript_id : XM_621082.3

name	LOC100038940 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272123 GeneID:100038940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038940, transcript variant 1 transcript_id : XM_001471631.1

name	LOC100038940 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272125 GeneID:100038940
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038940, transcript variant 2 transcript_id : XM_001471633.1

name	LOC100038941 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272127 GeneID:100038941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038941 transcript_id : XM_001471636.1

name	EG625699 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272129 GeneID:625699 MGI:3643045
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG625699 transcript_id : XM_890269.2

name	LOC100038942 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272131 GeneID:100038942
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038942 transcript_id : XM_001471635.1

name	LOC100039828 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272168 GeneID:100039828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 820 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 1 transcript_id : XM_001473276.1

name	LOC100039828 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272170 GeneID:100039828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 402 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 2 transcript_id : XM_001473295.1

name	EG434843 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272172 GeneID:434843 MGI:3646126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG434843 transcript_id : XM_486761.4

name	EG665463 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272173 GeneID:665463 MGI:3646874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG665463 transcript_id : XM_977110.2

name	EG665522 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272221 GeneID:665522 MGI:3645463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 983 ESTs, 7 Proteins product : predicted gene, EG665522 transcript_id : XM_977540.2

name	LOC100038969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272224 GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 404 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 2 transcript_id : XM_001472037.1

name	LOC100038969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272226 GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 483 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 3 transcript_id : XM_001472061.1

name	LOC100038969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272222 GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 821 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 1 transcript_id : XM_001472007.1

name	LOC100038978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272228 GeneID:100038978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 812 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 1 transcript_id : XM_001472084.1

name	LOC100038978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272230 GeneID:100038978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 401 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 2 transcript_id : XM_001472119.1

name	EG665579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272232 GeneID:665579 MGI:3649140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG665579 transcript_id : XM_977918.2

name	EG665611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272237 GeneID:665611 MGI:3646259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG665611 transcript_id : XM_978135.2

name	EG626048 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408243 GeneID:626048 MGI:3645883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 936 ESTs, 7 Proteins product : predicted gene, EG626048, transcript variant 2 transcript_id : XM_890604.2

name	EG626048 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272238 GeneID:626048 MGI:3645883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 420 ESTs, 7 Proteins product : predicted gene, EG626048, transcript variant 1 transcript_id : XM_001473380.1

name	EG625591 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63748758 GeneID:625591 MGI:3644765
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_621081.1

name	EG382265 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38087252 GeneID:382265 MGI:3645501
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_356374.1

name	EG546368 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63748772 GeneID:546368 MGI:3646000
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_621082.1

name	LOC100038940 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272124 GeneID:100038940
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001471681.1

name	LOC100038940 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272126 GeneID:100038940
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001471683.1

name	LOC100038942 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272132 GeneID:100038942
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471685.1

name	LOC100038941 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272128 GeneID:100038941
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001471686.1

name	EG625699 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272130 GeneID:625699 MGI:3643045
definition	codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein protein_id : XP_895362.2

name	LOC100039828 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272169 GeneID:100039828
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001473326.1

name	LOC100039828 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272171 GeneID:100039828
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_001473345.1

name	EG434843 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772387 GeneID:434843 MGI:3646126
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_486761.1

name	EG665463 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408152 GeneID:665463 MGI:3646874
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_982204.1

name	EG665522 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408225 GeneID:665522 MGI:3645463
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_982634.1

name	LOC100038969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272223 GeneID:100038969
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001472057.1

name	LOC100038969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272225 GeneID:100038969
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_001472087.1

name	LOC100038969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272227 GeneID:100038969
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 3 protein_id : XP_001472111.1

name	LOC100038978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272229 GeneID:100038978
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001472134.1

name	LOC100038978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272231 GeneID:100038978
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_001472169.1

name	EG665579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408233 GeneID:665579 MGI:3649140
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_983012.1

name	EG665611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408240 GeneID:665611 MGI:3646259
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_983229.1

name	EG626048 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272239 GeneID:626048 MGI:3645883
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001473430.1

name	EG626048 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83003650 GeneID:626048 MGI:3645883
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_895697.1

name	LOC665325 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272166 GeneID:665325
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 107 ESTs, 5 Proteins product : similar to 40S ribosomal protein S12 pseudo : _no_value transcript_id : XR_031083.1

name	LOC665364 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272167 GeneID:665364
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 226 ESTs, 5 Proteins product : similar to 40S ribosomal protein S12 pseudo : _no_value transcript_id : XR_031105.1

clone name	MSMg01-177J21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-212I16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-231H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-480B14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-495H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-149I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-110C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057O18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-294B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-405N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-412C08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390J19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373A22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-335J15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-421M07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534L05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-114N01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-052J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-099F13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318M09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-073G15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-073P20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-110P02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-155I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-205H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328M16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-341J11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-395F16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-404J20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461O07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-085H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-379K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-193F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-181F21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-336J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340F23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-456D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288I08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-528D10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-140C13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368G08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-471M11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-519H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-533N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536L01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-323N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-446K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-111G09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070N15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-439H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181N12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-461M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-195N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-304N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511L11
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-058L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204D11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-330N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-278I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052B23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-040N23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-337O24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153B19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-244J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-278I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-148L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-241L06.b	B6Ng01-241L06.g
ACC	GA051549	GA051550
length	1,115	1,174
definition	B6Ng01-241L06.b	B6Ng01-241L06.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(121,628,870 - 121,629,997)	(121,673,692 - 121,674,858)
sequence	gaattctaggctcttcatcttccatagaggcttctggacattccctttct gaccaagggtctctaaaactgtctataactaggcaagggagtgtacaaaa tgtgccatctactccaaagactgtgcaacatccaacttattgccagaaag gtatgagattttctcccctttctgaaccttctggacaaagatccccagct tcctcatgggatattgggccgttactacctagccagacatatcaaaaatc catttcatattcaccagcagatgttacacactcaccatctgtactaggta ctcaggggcatcctctatctagtaaagactctcaaggatatgtgctaacc tctcaaaagtgtaaggacctttccacagctgcagatgggactttgcctgt gcaaagatctttgtcatccacccaaatgaatctagaaccttcggcagatt acacagggatattgggcttgagaaaatgtaaacacacagagactacctcg ggcccgttgcctctagtgagggagaatacaaaatcttctacatctactct gcctactctaggacatttgccaccaccacctcgagaacctggtagacatt catcttttactcaaggagcgtgcagaaacattcccatctggtcccaggaa cctagcacatttgcaatcagcccaggggcctctgacaatttccatctcaa cccaggcaatgacacatatctctggatctgctgaaggggctctactgcat tcagctccttcctcagcagtttcagaaacaaatgaatattctccatctac ccaagggacttcagacactcccagatgtgctggaccgcacctggatctta ctacatcactacaggtgtccccatcatctttgagatctgagcaaaaaact gtgggaccttgctcatctgaagggactaaatctaaaggaaacaactgtag ggttttctgcatctgctcaggaactagagagcattcctatcagacagcca cagtagaatgccatgtctgcaaagcagtctgtggaaaattgctcccatca gtacttagggtctcgcaatcactcggtggtctcagagtctttggacatct gatccgaagctctgg	gaattcaaaaattctccaagtattaattgtcatttcattggtgagatgaa atatttgaattcagattctactttctgaaaaaaaaattccacctatctct tttatttatttttatttttgctctttctttcccagaagtatttgctgtgg gcaatttctgaatctttaaagttttgcaacactggctggattggctctag actttcctcaccatcaaatttggattcagttttgtcttcttggctcagtt gtttattttccattcatctttcttattactttgttctttcatgtgaattc acagctggtcacttgatattaagtaactaatttggttccttttttggcaa aaaaaatatcagtcactgtatttataataaattttagattaataaagtca gtggcctttataaaaattataaactgaattgtagtgggtttgacctaatg ctgcttacattataattttctgcatgtacaacactgagggattctgctct gagttggttttgattggtaaataaagattcaaccaggtaatggctggcca gggcagacagaggtaggacttttaaggttccagagcttaaaacagagagg aagtagtacaaaggagatccatcaggctgggagaagaagaggtgaaatgc catacctgagaagagtggagggcaggagtcatagccagcattttaaggtg ctggaagagtatgacccagtttggcagctctctggttccagggcaacaaa ggtaacatatagaagttagtaagtaataagctggattgtcagtgggaggt tgattaaccacatggaggctagaaaatggcccaactgttacactgtttaa agcataacaaaatataacatttctgtgagtttttttttttttcataaggg agtgcaaatcattggggcatgtaaacaggaacatgccactatgatttaat acataaaaaatattgtaacactgaatattaataaaaaataggttcaggga gtactaattgaattttgtacttgtataatttaaatatatcaatatacata tacagtgagttaattgttcatatttctttaactcattataaaataccata aatgtatcagtaatagatgaattttcctaatagttggaatcagtcactat cttttatcgtataaaaccatgtat
quality values	Open. Hide. 58 26 31 26 58 58 54 42 58 54 58 58 58 58 58 33 27 62 62 62 62 62 37 23 62 62 62 62 62 54 62 62 56 56 56 46 62 32 31 56 54 62 62 62 62 62 62 62 62 62 62 59 59 44 59 62 62 62 49 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 59 59 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 51 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 54 54 58 58 58 44 58 54 41 58 52 58 58 49 44 58 58 58 58 58 58 58 54 49 58 58 54 58 58 58 58 58 58 58 58 54 54 54 58 58 58 54 54 58 46 52 52 54 58 58 58 58 49 52 49 58 50 58 54 50 58 58 58 51 41 47 49 58 54 30 47 58 58 58 50 58 49 46 35 52 51 58 53 52 58 51 58 58 58 50 50 49 58 47 39 50 50 42 35 29 9 12 10 46 50 50 29 58 58 48 50 46 51 58 50 41 43 41 49 48 49 44 58 42 48 58 50 50 40 58 58 39 31 58 54 53 42 41 50 40 38 47 58 49 44 28 17 58 50 49 39 52 43 43 42 41 39 58 58 49 43 50 51 50 50 46 35 29 26 38 50 54 51 38 32 32 53 45 54 53 34 29 15 28 42 45 31 54 41 45 33 39 52 28 22 6 12 26 42 45 53 52 53 42 39 42 54 32 34 43 52 42 32 52 42 54 33 19 49 54 53 28 45 40 35 32 33 40 52 42 28 34 33 28 24 32 52 53 28 42 37 32 31 41 39 36 32 22 33 45 31 52 49 27 31 25 26 53 53 40 31 20 52 32 31 32 37 33 32 32 19 33 37 45 31 32 26 36 42 34 39 30 37 29 21 30 25 51 28 20 17 36 42 33 27 24 42 18 30 31 43 35 51 40 29 34 41 29 31 30 31 34 43 28 31 30 19 33 22 27 27 31 41 31 27 37 23 31 27 22 28 25 25 27 29 30 18 32 32 31 30 31 32 31 18 21 44 26 36 27 28 41 41 23 23 31 32 32 28 31 31 48 33 16 31 22 27 23 31 31 30 39 17 31 31 39 44 36 37 30 23 31 37 22 33 44 25 25 9 26 18 31 38 33 36 34 30 33 31 32 31 21 19 9 32 18 22 21 32 33 44 18 31 35 17 6 31 12 25 13 30 48 21 21 6 19 15 32 34 22 22 16 48 34 20 43 43 20 29 21 32 32 22 32 23 18 30 31 31 22 10 26 23 4 6 24 22 21 19 29 17 26 24 21 27 26 25 15 6 25 4 9 15 5 3 3 5 20 13 24 11 9 21 24 9 11 10 20 9 10 15 9 20 22 9 19 19 19 17 28 27 16 15 31 14 18 16 22 20 27 27 24 27 23 10 19 17 47 40 17 8 22 16 11 16 4 30 15 11 8 3 6 12 15 12 15 7 13 12 9 28 16 6 12 11 15 6 10 17 17 7 12 10 7 9 5 4 8 5 7 12 3 9 16 16 20 10 25 5 7 8 4 22 15 5 6 21 10 6 7 5 5 14 14 10 9 5 7 16 13 5 11 2 6 8 5 3	Open. Hide. 62 47 42 42 62 47 29 62 62 62 62 47 51 51 38 41 44 30 33 38 43 59 59 59 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 59 59 59 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 59 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 54 58 58 58 54 53 58 58 45 41 58 58 58 49 38 58 58 58 58 58 54 58 58 54 58 54 58 58 58 58 58 39 58 58 54 52 58 58 58 52 58 58 58 54 54 31 58 45 35 58 58 58 51 52 58 58 54 58 51 58 51 51 58 58 58 48 51 40 53 58 58 58 51 41 45 49 50 54 58 38 45 40 51 45 58 49 33 58 58 58 58 49 40 28 38 21 51 50 49 32 46 58 50 54 53 46 41 58 58 58 50 39 49 58 33 54 47 50 58 44 40 50 52 50 50 37 52 31 58 51 37 58 54 31 35 30 50 54 28 51 52 42 31 58 50 50 49 58 49 53 39 49 51 30 58 50 29 54 25 39 35 51 38 36 44 39 37 25 51 26 53 43 49 44 50 54 51 24 49 40 30 54 32 38 54 49 49 40 54 51 25 39 23 54 39 26 42 43 34 49 52 37 49 44 28 40 42 31 50 54 54 45 40 40 44 51 24 52 37 37 30 52 37 44 25 46 30 37 33 33 37 42 19 33 36 37 20 36 54 21 51 40 32 39 34 42 37 32 44 37 35 36 46 16 47 31 32 19 32 53 46 34 31 25 27 19 52 53 22 52 19 18 47 33 24 40 36 40 35 36 53 53 31 40 41 34 31 43 42 32 32 31 24 42 31 29 29 30 31 36 37 31 15 17 28 45 32 33 30 36 26 43 51 30 41 29 30 13 33 30 27 13 16 11 18 18 32 19 36 26 36 29 33 31 25 33 28 31 31 32 42 48 46 31 24 27 24 19 36 24 23 32 30 31 31 23 41 31 31 21 25 31 42 30 47 31 37 47 19 25 31 20 31 24 32 28 22 44 48 21 24 16 20 13 25 17 21 31 48 31 31 29 31 19 23 43 18 38 48 48 48 48 48 48 48 48 48 48 48 31 18 6 8 10 12 10 37 9 21 8 14 31 23 21 48 11 12 20 21 37 27 38 48 48 31 23 28 33 30 19 19 35 6 8 15 29 24 25 21 11 16 33 32 30 25 17 32 32 21 32 22 33 21 43 8 5 5 7 9 14 7 19 12 39 34 39 37 14 17 10 11 5 8 11 7 7 7 6 19 21 10 16 6 10 9 6 6 14 27 15 6 47 34 23 14 5 5 22 5 7 21 18 23 8 9 27 10 16 5 7 15 27 13 26 21 6 7 9 11 19 15 40 40 14 12 6 13 16 7 9 14 16 3 6 10 8 23 38 27 8 28 16 16 15 22 5 14 20 11 9 10 18 27 8 11 6 5 8 24 16 13 6 19 8 22 14 9 14 13 8 18 16 7 7 4 8 13 24 5 8 7 23 17 21 7 23 17 5 5 5 11 12 5 13 9 11 7 16 26 28 9 6 7 6 17 7 11 9 29 15 13 18 8 9 10 8 5 7 9 14 12 5 5 4 22 8 10 9 4 3 7 22 16 7 6 5 9 12 6 8 1 1 5 6 3 2 5 4 15 9 2 3 2 3 2 2 1 5 8 28 28 25 6 7 5 19 4 3 3 4 4 25 26 4 6 9 5 7 6 3 4 7

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_121628870_121629997
seq2: B6Ng01-241L06.b_46_1160

seq1  GAATTCTAGGCTCTTCATCTTCCATAGAGGCTTCTGGACATTCCCTTTCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAGGCTCTTCATCTTCCATAGAGGCTTCTGGACATTCCCTTTCT  50

seq1  GACCAAGGGTCTCTAAAACTGTCTATAACTAGGCAAGGGAGTGTACAAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCAAGGGTCTCTAAAACTGTCTATAACTAGGCAAGGGAGTGTACAAAA  100

seq1  TGTGCCATCTACTCCAAAGACTGTGCAACATCCAACTTATTGCCAGAAAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGCCATCTACTCCAAAGACTGTGCAACATCCAACTTATTGCCAGAAAG  150

seq1  GTATGAGATTTTCTCCCCTTTCTGAACCTTCTGGACAAAGATCCCCAGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTATGAGATTTTCTCCCCTTTCTGAACCTTCTGGACAAAGATCCCCAGCT  200

seq1  TCCTCATGGGATATTGGGCCGTTACTACCTAGCCAGACATATCAAAAATC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCATGGGATATTGGGCCGTTACTACCTAGCCAGACATATCAAAAATC  250

seq1  CATTTCATATTCACCAGCAGATGTTACACACTCACCATCTGTACTAGGTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTCATATTCACCAGCAGATGTTACACACTCACCATCTGTACTAGGTA  300

seq1  CTCAGGGGCATCCTCTATCTAGTAAAGACTCTCAAGGATATGTGCTAACC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGGGGCATCCTCTATCTAGTAAAGACTCTCAAGGATATGTGCTAACC  350

seq1  TCTCAAAAGTGTAAGGACCTTTCCACAGCTGCAGATGGGACTTTGCCTGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTCAAAAGTGTAAGGACCTTTCCACAGCTGCAGATGGGACTTTGCCTGT  400

seq1  GCAAAGATCTTTGTCATCCACCCAAATGAATCTAGAACCTTCGGCAGATT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAGATCTTTGTCATCCACCCAAATGAATCTAGAACCTTCGGCAGATT  450

seq1  ACACAGGGATATTGGGCTTGAGAAAATGTAAACACACAGAGACTACCTCG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACACAGGGATATTGGGCTTGAGAAAATGTAAACACACAGAGACTACCTCG  500

seq1  GGCCCGTTGCCTCTAGTGAGGGAGAATACAAAATCTTCTACATCTACTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCGTTGCCTCTAGTGAGGGAGAATACAAAATCTTCTACATCTACTCT  550

seq1  GCCTACTCTAGGACATTTGCCACCACCACCTCGAGAACCTGGTAGACATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTACTCTAGGACATTTGCCACCACCACCTCGAGAACCTGGTAGACATT  600

seq1  CATCTTTTACTCAAGGAG-GTGCAGAAACATTCCCATCTGGTCCCAGGAA  649
      |||||||||||||||||| |||||||||||||||||||||||||||||||
seq2  CATCTTTTACTCAAGGAGCGTGCAGAAACATTCCCATCTGGTCCCAGGAA  650

seq1  CCTAGCACATTTGCAATCAGCCCAGGGGCCTCTGACAATTTCCATCTCAA  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGCACATTTGCAATCAGCCCAGGGGCCTCTGACAATTTCCATCTCAA  700

seq1  CCCAGGCAATGACCCATATCTCTGGATCTGCTGAAGGGGCTCTACTGCAT  749
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  CCCAGGCAATGACACATATCTCTGGATCTGCTGAAGGGGCTCTACTGCAT  750

seq1  TCAGCTCCTTCCTCAGCAGTTTCAGAAACAAATGAATATTCTCCATCTAC  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGCTCCTTCCTCAGCAGTTTCAGAAACAAATGAATATTCTCCATCTAC  800

seq1  CCAAGGGACTTCAGACACTCCCAGATGTGCTGGACCGCACCTGGATCTTA  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAAGGGACTTCAGACACTCCCAGATGTGCTGGACCGCACCTGGATCTTA  850

seq1  CTACATCACTACAGGTGTCCCCATCATCTTTGAGATCTGAGCAAAAAACT  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACATCACTACAGGTGTCCCCATCATCTTTGAGATCTGAGCAAAAAACT  900

seq1  GTGGGACCTTGCTCATCTGAAGGGACTAAATCT-AAGGAAACAACTGTAG  948
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  GTGGGACCTTGCTCATCTGAAGGGACTAAATCTAAAGGAAACAACTGTAG  950

seq1  GGTTTTCTGCATCTGCTCAGGGAACTAGAGAGCATTCCTTATCAGGACAA  998
      ||||||||||||||||||| |||||||||||||||||| ||||| ||| |
seq2  GGTTTTCTGCATCTGCTCA-GGAACTAGAGAGCATTCC-TATCA-GAC-A  996

seq1  GCCACAGTAGGAATGCCCATGTCTGCAAAGCAGTCTGTGGAAAATTTGCT  1048
      ||||||||| ||||| |||||||||||||||||||||||||||| |||| 
seq2  GCCACAGTA-GAATG-CCATGTCTGCAAAGCAGTCTGTGGAAAA-TTGC-  1042

seq1  TCCCATTCCAGTACCTTTAGGGTCTCCGCAAATCACTCGGGTGGTCTCAG  1098
      ||||||  ||||||  ||||||||| ||| |||||||| |||||||||||
seq2  TCCCAT--CAGTAC--TTAGGGTCT-CGC-AATCACTC-GGTGGTCTCAG  1085

seq1  AGTCTTT-GACATCTGATCAGAAGCCTCTGG  1128
      ||||||| ||||||||||| |||| ||||||
seq2  AGTCTTTGGACATCTGATCCGAAG-CTCTGG  1115

seq1: chrX_121673692_121674858
seq2: B6Ng01-241L06.g_67_1240 (reverse)

seq1  ATACAT-GTTTTATACGTATAAAAAATAGTGAACTGATTACAACTAT--A  47
      |||||| |||||||||| |||||| |||||| ||||||| |||||||   
seq2  ATACATGGTTTTATACG-ATAAAAGATAGTG-ACTGATTCCAACTATTAG  48

seq1  GAAATATCATCTATTACTTGATACATTTATGGTATTTTATAATGAGTTTA  97
      ||||  ||||||||||| |||||||||||||||||||||||||||||| |
seq2  GAAAATTCATCTATTAC-TGATACATTTATGGTATTTTATAATGAGTTAA  97

seq1  AAGAATATTGACAATTAACTCACTGTATATGTATA-TGATAATATTAAAT  146
      |  |||||  ||||||||||||||||||||||||| |||||   ||||||
seq2  AGAAATATGAACAATTAACTCACTGTATATGTATATTGATATATTTAAAT  147

seq1  ATAACAAGTACAAAATTC-ATTAGTACT-CCTGAACTTATTTTTTATT-A  193
         ||||||||||||||| ||||||||| ||||||| ||||||||||| |
seq2  TATACAAGTACAAAATTCAATTAGTACTCCCTGAACCTATTTTTTATTAA  197

seq1  TATTCAGTGTAACAATA-TTTTTATGTA-TAAATCATAGTGGCATGTTCC  241
      |||||||||| |||||| |||||||||| |||||||||||||||||||||
seq2  TATTCAGTGTTACAATATTTTTTATGTATTAAATCATAGTGGCATGTTCC  247

seq1  TG-TTACATGCCCCAATGATTTGCACTCCCTTATGAAAAAAAAAAAAACT  290
      || |||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTACATGCCCCAATGATTTGCACTCCCTTATGAAAAAAAAAAAAACT  297

seq1  CACAGAAATGTTATATTTTGTTATGCTTTAAACAGTGTAACAGTTGGGCC  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGAAATGTTATATTTTGTTATGCTTTAAACAGTGTAACAGTTGGGCC  347

seq1  ATTTTCTAGCCTCCATGTGGTTAATCAACCTCCCACTGACAATCCAGCTT  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCTAGCCTCCATGTGGTTAATCAACCTCCCACTGACAATCCAGCTT  397

seq1  ATTACTTACTAACTTCTATATGTTACCTTTGTTGCCCTGGAACCAGAGAG  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACTTACTAACTTCTATATGTTACCTTTGTTGCCCTGGAACCAGAGAG  447

seq1  CTGCCAAACTGGGTCATACTCTTCCAGCACCTTAAAATGCTGGCTATGAC  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCAAACTGGGTCATACTCTTCCAGCACCTTAAAATGCTGGCTATGAC  497

seq1  TCCTGCCCTCCACTCTTCTCAGGTATGGCATTTCACCTCTTCTTCTCCCA  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTGCCCTCCACTCTTCTCAGGTATGGCATTTCACCTCTTCTTCTCCCA  547

seq1  GCCTGATGGATCTCCTTTGTACTACTTCCTCTCTGTTTTAAGCTCTGGAA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTGATGGATCTCCTTTGTACTACTTCCTCTCTGTTTTAAGCTCTGGAA  597

seq1  CCTTAAAAGTCCTACCTCTGTCTGCCCTGGCCAGCCATTACCTGGTTGAA  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTAAAAGTCCTACCTCTGTCTGCCCTGGCCAGCCATTACCTGGTTGAA  647

seq1  TCTTTATTTACCAATCAAAACCAACTCAGAGCAGAATCCCTCAGTGTTGT  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTATTTACCAATCAAAACCAACTCAGAGCAGAATCCCTCAGTGTTGT  697

seq1  ACATGCAGAAAATTATAATGTAAGCAGCATTAGGTCAAACCCACTACAAT  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATGCAGAAAATTATAATGTAAGCAGCATTAGGTCAAACCCACTACAAT  747

seq1  TCAGTTTATAATTTTTATAAAGGCCACTGACTTTATTAATCTAAAATTTA  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGTTTATAATTTTTATAAAGGCCACTGACTTTATTAATCTAAAATTTA  797

seq1  TTATAAATACAGTGACTGATATTTTTTTTGCCAAAAAAGGAACCAAATTA  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAATACAGTGACTGATATTTTTTTTGCCAAAAAAGGAACCAAATTA  847

seq1  GTTACTTAATATCAAGTGACCAGCTGTGAATTCACATGAAAGAACAAAGT  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTACTTAATATCAAGTGACCAGCTGTGAATTCACATGAAAGAACAAAGT  897

seq1  AATAAGAAAGATGAATGGAAAATAAACAACTGAGCCAAGAAGACAAAACT  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAAGAAAGATGAATGGAAAATAAACAACTGAGCCAAGAAGACAAAACT  947

seq1  GAATCCAAATTTGATGGTGAGGAAAGTCTAGAGCCAATCCAGCCAGTGTT  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCCAAATTTGATGGTGAGGAAAGTCTAGAGCCAATCCAGCCAGTGTT  997

seq1  GCAAAACTTTAAAGATTCAGAAATTGCCCACAGCAAATACTTCTGGGAAA  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAAACTTTAAAGATTCAGAAATTGCCCACAGCAAATACTTCTGGGAAA  1047

seq1  GAAAGAGCAAAAATAAAAATAAATAAAAGAGATAGGTGGAATTTTTTTTT  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGAGCAAAAATAAAAATAAATAAAAGAGATAGGTGGAATTTTTTTTT  1097

seq1  CAGAAAGTAGAATCTGAATTCAAATATTTCATCTCACCAATGAAATGACA  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAAGTAGAATCTGAATTCAAATATTTCATCTCACCAATGAAATGACA  1147

seq1  ATTAATACTTGGAGAATTTTTGAATTC  1167
      |||||||||||||||||||||||||||
seq2  ATTAATACTTGGAGAATTTTTGAATTC  1174

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information