MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-243C24
Chromosome	X (Build37)
Map Location	160,403,051 - 160,556,988
singlet/doublet	doublet
Overlap gene	Car5b, Siah1b, Tmem27
Upstream gene	Ctps2, LOC100040610, EG637051, Grpr, 1700045I19Rik, Ap1s2, Zrsr2
Downstream gene	Ace2, Bmx, Pir, Figf, Piga, Asb11, Asb9, Mospd2, Fancb, LOC627045
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ctps2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55936 MGI:1933185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040610 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040610
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG637051 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:637051 MGI:3645878
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Grpr (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14829 MGI:95836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700045I19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74264 MGI:1921514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Ap1s2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108012 MGI:1889383
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zrsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Car5b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56078 MGI:1926249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Siah1b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20438 MGI:108063
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem27 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57394 MGI:1926234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ace2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70008 MGI:1917258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12169 MGI:1101778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pir (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69656 MGI:1916906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Figf (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14205 MGI:108037
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Piga (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18700 MGI:99461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68854 MGI:1916104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69299 MGI:1916549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mospd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76763 MGI:1924013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fancb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237211 MGI:2448558
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC627045 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627045
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ctps2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377114 GeneID:55936 MGI:1933185
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cytidine 5'-triphosphate synthase 2 transcript_id : NM_018737.3

name	Grpr (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130941 GeneID:14829 MGI:95836
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gastrin releasing peptide receptor transcript_id : NM_008177.2

name	Ap1s2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254483 GeneID:108012 MGI:1889383
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : adaptor-related protein complex 1, sigma 2 subunit transcript_id : NM_026887.2

name	Zrsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949799 GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 transcript_id : NM_009453.2

name	Zrsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:121949774 GeneID:22184 MGI:103287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger (CCCH type), RNA binding motif and serine/arginine rich 2 transcript_id : NM_178794.3

name	Car5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9506462 GeneID:56078 MGI:1926249
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5b, mitochondrial transcript_id : NM_019513.1

name	Car5b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144227235 GeneID:56078 MGI:1926249
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : carbonic anhydrase 5b, mitochondrial transcript_id : NM_181315.3

name	Siah1b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677948 GeneID:20438 MGI:108063
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : seven in absentia 1B transcript_id : NM_009173.1

name	Tmem27 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133892354 GeneID:57394 MGI:1926234
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 27 transcript_id : NM_020626.2

name	Ace2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142389001 GeneID:70008 MGI:1917258
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 transcript_id : NM_027286.3

name	Bmx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802105 GeneID:12169 MGI:1101778
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : BMX non-receptor tyrosine kinase transcript_id : NM_009759.3

name	Pir (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130337 GeneID:69656 MGI:1916906
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pirin transcript_id : NM_027153.2

name	Figf (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753873 GeneID:14205 MGI:108037
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : c-fos induced growth factor transcript_id : NM_010216.1

name	Piga (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126273665 GeneID:18700 MGI:99461
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphatidylinositol glycan anchor biosynthesis, class A transcript_id : NM_011081.2

name	Asb11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:17105325 GeneID:68854 MGI:1916104
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 11 transcript_id : NM_026853.1

name	Asb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373912 GeneID:69299 MGI:1916549
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 9 transcript_id : NM_027027.2

name	Mospd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142356338 GeneID:76763 MGI:1924013
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : motile sperm domain containing 2 transcript_id : NM_029730.2

name	Fancb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54020736 GeneID:237211 MGI:2448558
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Fanconi anemia, complementation group B transcript_id : NM_175027.3

name	Ctps2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055198 GeneID:55936 MGI:1933185
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0016874 - ligase activity [Evidence IEA] GO_process : GO:0006541 - glutamine metabolism [Evidence IEA] codon_start : 1 note : CTP synthetase homolog product : cytidine triphosphate synthase II protein_id : NP_061207.1

name	Grpr (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680111 CCDS:CCDS30512.1 GeneID:14829 MGI:95836
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004946 - bombesin receptor activity [Evidence TAS]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0042127 - regulation of cell proliferation [Evidence IMP]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : bombesin receptor product : gastrin releasing peptide receptor protein_id : NP_032203.1

name	Ap1s2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254484 CCDS:CCDS30514.1 GeneID:108012 MGI:1889383
definition	GO_component : GO:0030121 - AP-1 adaptor complex [Evidence ISS]; GO:0030662 - coated vesicle membrane [Evidence IEA]; GO:0005802 - Golgi trans face [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0008565 - protein transporter activity [Evidence ISS] GO_process : GO:0006897 - endocytosis [Evidence IEA]; GO:0006886 - intracellular protein transport [Evidence IEA] [Evidence ISS]; GO:0015031 - protein transport [Evidence IEA]; GO:0006898 - receptor mediated endocytosis [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : adaptor-related protein complex 1 sigma 2 subunit protein_id : NP_081163.2

name	Zrsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949800 GeneID:22184 MGI:103287
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 isoform 1 protein_id : NP_033479.2

name	Zrsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:121949775 GeneID:22184 MGI:103287
definition	GO_component : GO:0005689 - minor (U12-dependent) spliceosome complex [Evidence ISS]; GO:0005730 - nucleolus [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008380 - RNA splicing [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF), 35 kDa, related sequence 2; U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 product : U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 1, related sequence 2 isoform 2 protein_id : NP_848909.2

name	Car5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506463 CCDS:CCDS30515.1 GeneID:56078 MGI:1926249
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carbonic anhydrase VB product : carbonic anhydrase 5b, mitochondrial protein_id : NP_062386.1

name	Car5b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31044449 CCDS:CCDS30515.1 GeneID:56078 MGI:1926249
definition	GO_component : GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0004089 - carbonate dehydratase activity [Evidence IDA] [Evidence IEA]; GO:0016829 - lyase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006730 - one-carbon compound metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : carbonic anhydrase VB product : carbonic anhydrase 5b, mitochondrial protein_id : NP_851832.1

name	Siah1b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677949 CCDS:CCDS30516.1 GeneID:20438 MGI:108063
definition	GO_function : GO:0016874 - ligase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence TAS]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 product : seven in absentia 1B protein_id : NP_033199.1

name	Tmem27 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181182 CCDS:CCDS30517.1 GeneID:57394 MGI:1926234
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : kidney-specific membrane protein product : transmembrane protein 27 protein_id : NP_065651.1

name	Ace2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83582782 CCDS:CCDS30518.1 GeneID:70008 MGI:1917258
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] GO_function : GO:0004180 - carboxypeptidase activity [Evidence TAS]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008237 - metallopeptidase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 protein_id : NP_081562.2

name	Bmx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753196 CCDS:CCDS30519.1 GeneID:12169 MGI:1101778
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : TYRO8 protein tyrosine kinase 8 product : BMX non-receptor tyrosine kinase protein_id : NP_033889.1

name	Pir (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51317401 CCDS:CCDS30520.1 GeneID:69656 MGI:1916906
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005506 - iron ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : iron-binding nuclear protein product : pirin protein_id : NP_081429.1

name	Figf (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753874 CCDS:CCDS30521.1 GeneID:14205 MGI:108037
definition	GO_component : GO:0005576 - extracellular region [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008083 - growth factor activity [Evidence IDA] [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005172 - vascular endothelial growth factor receptor binding [Evidence TAS] GO_process : GO:0001525 - angiogenesis [Evidence IEA]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0008283 - cell proliferation [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA] codon_start : 1 product : c-fos induced growth factor protein_id : NP_034346.1

name	Piga (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126273666 CCDS:CCDS30522.1 GeneID:18700 MGI:99461
definition	EC_number : 2.4.1.198 GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0000506 - glycosylphosphatidylinositol-N- acetylglucosaminyltransferase (GPI-GnT) complex [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0017176 - phosphatidylinositol N-acetylglucosaminyltransferase activity [Evidence ISS]; GO:0005515 - protein binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006506 - GPI anchor biosynthesis [Evidence ISS] [Evidence IEA]; GO:0009893 - positive regulation of metabolism [Evidence ISS] codon_start : 1 note : phosphatidylinositolglycan class A product : phosphatidylinositol glycan, class A protein_id : NP_035211.2

name	Asb11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17105326 CCDS:CCDS30523.1 GeneID:68854 MGI:1916104
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 11 protein_id : NP_081129.1

name	Asb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311897 CCDS:CCDS30524.1 GeneID:69299 MGI:1916549
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : ankyrin repeat and SOCS box-containing protein 9 protein_id : NP_081303.1

name	Mospd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110626072 GeneID:76763 MGI:1924013
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : motile sperm domain containing 2 protein_id : NP_084006.1

name	Fancb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54020737 GeneID:237211 MGI:2448558
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006281 - DNA repair [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA] codon_start : 1 product : Fanconi anemia, complementation group B protein_id : NP_778192.2

name	LOC100040610 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040610
definition	number : 1 pseudo : _no_value

name	EG637051 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:637051
definition	number : 1 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 1 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 2 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 3 pseudo : _no_value

name	LOC627045 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:627045
definition	number : 4 pseudo : _no_value

name	1700045I19Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272401 GeneID:74264 MGI:1921514
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700045I19 gene pseudo : _no_value transcript_id : XR_035172.1

clone name	MSMg01-362P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-417K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444L04
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-357I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125B12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-275I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383C20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-511A07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-102P02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-174G12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-352F24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-101I15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484K14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453E08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-058O17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-056M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-312P09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-048E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-392O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-058G20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-061I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-478L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459N09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-066M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-404K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498P19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332F13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-444P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129J06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-194K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032I15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-127H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-344P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208K22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-141L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-343H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-320B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154P23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-030F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-039N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063H18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014N20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157K20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070A01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-134D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243C24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-091G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-175A15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322O20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-057E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253M22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133L12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-324C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-242P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209K21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-108N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329N16
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-243C24.b	B6Ng01-243C24.g
ACC	GA052642	GA052643
length	1,174	1,165
definition	B6Ng01-243C24.b	B6Ng01-243C24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(160,403,051 - 160,404,107)	(160,555,819 - 160,556,988)
sequence	gaattcagtaagaatgttacctattcagtaacacttctattacagatggt gaaacgaattaggcattacaaagaacggagctagaatagctcagggctgg tctgcagagtgattacttaggacagtagccagtctcacccaaacaagttg cgaataggtgggttaaccatgaaagagttagggaatcccccagacaggtt tcttcactaggcccaaaggaacagcataatcaggcatttactaagaaccc ctgtaatgagatctggtgccctcttctggtgcgtctgaagacaaccgcag tgtacttacatataataaataaataaataaataaataaataaatctttaa aaaaaaaaaaaaagagcccctggcagtgggcttaacaatagactagcatt acacctggctccttccttccttccttccttccttccttcctgtctgtctg tctgtctgtttgtttgtttgtttgtttgtttgtttttcaagacagggttt ctctgtatagccctggctgtcctggaacttgttttgtagaccaggctggc cttgaattcaggaatctgcctacctctgcctcccaagtgctgggattaaa ggcatgcgccaccacttccggccacctagctcctttcttagtggtaaaca acggtcctttttttttttaaggtattttcctcgtttacatttccaatgct atcccaaaagtcccccatacccacctccacaatcccctacccacccactc cccctttttggccctggcgttcccctgtactggggcatataaagtttgca agtccaatgggcctctctttccagtgatggccgactaggccatctttttg atacatatgcacctagagacaagagctccgggttcgttcataatgttgtt ccacctatagggttgcagttccctttagctccttgggtaatttctctaga gcttatctttgagcacaggatctcctggtctcttcactgccctctctgag agcattttgccctgtttcatagactctgggtctgcagtctagaggatgcc tgaggagttctttcatagctgtagagatcccacctattaccaggagggca aatgaattcaggtcaattctcagctacgaagggtgaattggaggactgat acatgaaggcttctaaatagccat	gaattccaggacagccagggctattacacagagaaactctgtctcgaaaa caaaacaaaacaaaatggatgtacaccataagagtaacatccatttccag ggctgtagatgaaattaaatataactaataaagttaaactcactatgttc caccttgtgaaaatgtctaaaagcgtagtcagccatacaatcaaaatgag atgatcactactttattaaatcagcataggtaggatgtgtacaaattgca ggcaacaacaaatagatctgcttgccctactaaagactaatatgcagaaa ctatacaagcaactgttggtgtgataacagaataaaattcccttgccatt tttatccatctcttgtttaattttactcgatgcatcatatacagagtaat ataaacagtattcaaaaagatccatttttaatgatttctatgccatgtta tagccattctccagtgaaaatttttttcttaggtcttcaaaatatgaaat atagttacagccctgactttatttctagaaatgctcaaatcagtaactac aaacacacactatacctacataatcagttatcaaaaagaaaattctagaa tattttgagaagctaacaccttatgatttcattggtctttgtggatataa tttgttgtcaatcacattcaagcatcttaaaattttcttacaagactgtc actctcagagaggggtgaggcgctcatcctctgtcaagaagccatcatta atgtgccctcccttcatgtccaagggatcacaagggatgccattttctat tgtgatgatgttttcacacttgtcttctgcatcttccactccaggtggtc ctttgttgttcctgaaagcacataaaaaaagagagtggaatctagaatga ggaagggttggataaatacagtcttgtttgcaattgtggcaataaaaaga ggcacagaagttatgaatgctgaataatttctgtgtactttccaggacta tacagttaatggggtaaaagactacccagaataaagattgcataatgatg taatcttatttacaagtagtcttatttaaaatactagaataaggagcata gatagtatattaataattttacacaattggaattccatgcatataattcc gtaccaaaacaagtt
quality values	Open. Hide. 58 33 35 32 62 31 22 62 62 62 62 62 62 43 37 47 49 54 62 62 62 62 62 62 62 44 37 62 59 62 62 56 43 59 34 38 50 46 51 51 46 62 62 49 62 59 62 62 62 62 62 54 62 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 59 62 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 54 62 62 62 59 62 62 62 49 49 54 54 62 62 62 62 62 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 59 59 50 62 50 46 62 62 62 59 62 62 59 62 59 56 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 50 52 52 47 52 62 52 52 62 54 52 52 47 52 52 43 62 52 47 52 52 58 58 58 46 58 58 58 58 52 58 48 58 58 52 54 54 52 52 38 22 46 52 48 54 58 48 54 58 54 52 52 58 58 42 54 52 54 54 52 52 48 52 43 41 52 54 54 54 54 54 54 52 54 48 48 52 48 54 58 58 58 58 58 58 45 39 42 52 49 41 58 51 50 40 58 58 54 50 54 51 50 44 45 48 49 49 47 47 51 47 58 40 48 46 46 47 48 51 50 50 46 49 47 47 50 54 50 58 58 51 46 50 58 38 50 41 58 51 52 39 58 53 49 50 46 43 42 42 50 58 58 58 58 58 58 58 58 42 34 52 48 43 27 52 41 58 58 40 50 51 52 43 52 53 53 51 40 53 50 58 58 43 42 44 20 50 50 58 40 54 50 53 50 43 43 34 58 58 58 53 50 50 42 43 42 42 37 41 49 40 44 44 30 49 49 50 50 37 34 45 31 52 42 40 44 44 50 35 31 27 49 49 32 50 34 42 32 41 49 37 40 40 39 27 40 45 54 46 36 51 40 33 49 28 30 44 34 33 33 39 22 25 46 42 38 34 39 25 30 32 30 41 52 54 41 30 35 40 37 39 21 51 20 30 39 53 33 20 29 21 46 34 32 26 47 23 33 33 36 47 35 21 29 32 39 31 25 31 49 25 23 34 27 33 21 40 31 32 31 41 21 40 32 42 31 33 27 10 31 20 33 18 31 32 37 47 37 41 27 21 31 19 28 31 21 30 36 36 32 30 22 33 44 36 37 17 43 24 31 23 19 17 13 33 10 29 26 24 23 16 40 31 29 12 23 16 38 31 31 32 31 36 32 30 34 12 37 36 31 30 27 31 22 30 33 26 30 29 15 27 48 36 17 23 28 30 31 21 37 31 21 39 31 31 48 21 22 28 32 28 21 42 22 33 33 44 31 26 30 21 32 48 25 27 34 34 25 25 22 37 22 31 36 20 17 27 30 26 41 22 19 29 19 31 18 7 11 8 30 14 33 12 12 8 24 22 30 19 19 23 19 34 6 18 15 8 15 4 14 22 24 15 14 12 10 5 6 10 33 5 30 8 20 22 37 48 34 28 18 11 33 14 12 22 22 39 26 19 27 24 22 8 27 16 14 14 20 25 34 15 10 26 18 15 23 24 13 13 27 13 28 12 26 12 27 18 9 20 16 14 22 19 26 10 20 15 5 13 7 27 13 27 9 14 20 24 15 7 14 28 26 14 24 7 14 7 27 15 7 30 17 7 6 11 15 12 4 3 3 2 12 6 16 7 20 10 16 3 2 13 29 20 12 5 3 2 3 5 9 12 3 11 4 13 7 5 25 10 9 9 13 15 5 6 16 16 7 1 4 12 7 7 4 4 8 14 6 13 19 7 5 10 7 3 2 1 2 3 1 2 5 6 4 2 2 3 3 3 1 2 3 9 4 4 13 17 16 4 15 5 15 17 7 10	Open. Hide. 62 47 42 41 62 62 39 37 62 62 39 34 28 21 27 21 19 21 27 28 29 43 62 62 59 62 62 62 62 59 62 59 59 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 62 62 62 59 62 62 62 62 62 62 59 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 52 48 52 52 50 52 52 46 52 54 54 36 43 52 52 54 58 58 58 58 58 58 54 58 58 58 54 54 58 54 54 54 54 58 58 58 58 58 58 48 48 48 44 48 52 58 52 54 58 58 54 58 50 51 50 51 53 53 49 48 43 41 49 49 54 50 51 58 58 58 58 58 58 58 47 58 51 51 58 58 58 58 58 51 58 58 58 48 41 58 51 51 54 54 58 48 49 47 37 58 58 58 54 58 53 58 58 43 48 49 50 50 43 48 43 41 48 51 58 58 58 51 39 58 58 53 46 58 58 58 39 52 52 58 58 54 58 53 58 44 46 40 41 49 40 58 47 58 54 54 53 58 58 50 50 51 41 58 52 51 49 50 58 58 53 52 53 43 43 33 51 50 58 41 40 54 54 41 50 49 49 39 44 51 47 40 44 30 50 40 54 35 41 54 53 49 50 35 54 42 53 39 49 37 54 29 37 33 49 49 50 37 51 46 35 49 24 36 45 54 29 32 40 40 46 49 40 38 51 37 37 39 42 42 53 39 21 35 39 31 52 40 37 47 47 40 40 38 54 40 45 40 36 27 30 37 40 32 26 38 25 28 32 47 34 31 41 31 53 23 49 38 17 29 35 32 45 32 41 26 53 32 28 20 34 28 47 31 45 53 53 30 30 23 40 45 37 38 19 32 42 32 37 31 22 51 31 51 51 34 34 29 35 31 42 32 32 26 25 31 29 23 32 24 30 28 31 38 42 31 32 28 31 31 31 27 18 32 34 24 42 29 46 32 29 29 36 43 48 36 43 31 31 33 31 36 31 30 30 27 31 47 31 26 31 24 28 23 29 30 47 47 47 47 48 41 31 39 19 30 21 31 32 28 25 22 30 32 30 26 29 35 25 31 30 22 19 23 23 12 10 32 26 31 27 31 20 29 24 30 44 22 32 25 32 27 33 34 36 30 24 32 19 48 26 27 24 16 21 16 27 31 24 31 37 24 43 38 28 36 48 47 47 25 22 32 14 22 15 18 4 8 7 23 25 20 33 28 27 22 31 23 21 18 30 22 32 18 30 11 22 23 14 28 47 26 28 24 32 14 21 21 27 21 30 48 32 19 20 18 18 16 21 21 32 14 12 24 5 14 10 13 14 15 21 18 22 34 38 31 12 25 47 38 27 14 19 24 26 24 12 26 5 8 3 5 20 7 11 40 10 13 28 28 22 5 16 13 23 3 15 10 22 19 20 13 10 11 14 13 11 6 15 22 13 34 21 9 7 6 22 16 15 17 9 9 18 12 22 16 13 28 13 3 20 26 14 12 5 22 9 7 6 3 4 6 11 7 7 5 8 5 18 5 11 14 5 5 2 4 10 3 4 10 7 5 14 5 6 9 7 10 7 5 20 18 5 8 5 2 1 3 5 10 5 5 11 17 6 9 5 11 1 3 2 5 4 9 7 8 4 5 1 4 8 10 1 2 4 4 6 8 25 17 4 8 10 7 3 3 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_160403051_160404107
seq2: B6Ng01-243C24.b_170_1217

seq1  AGCCAGTCTCACCCAAACAAGTTGCGAATAGGTGGGTTAACCATGAAAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAGTCTCACCCAAACAAGTTGCGAATAGGTGGGTTAACCATGAAAGA  50

seq1  GTTAGGGAATCCCCCAGACAGGTTTCTTCACTAGGCCCAAAGGAACAGCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAGGGAATCCCCCAGACAGGTTTCTTCACTAGGCCCAAAGGAACAGCA  100

seq1  TAATCAGGCATTTACTAAGAACCCCTGTAATGAGATCTGGTGCCCTCTTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCAGGCATTTACTAAGAACCCCTGTAATGAGATCTGGTGCCCTCTTC  150

seq1  TGGTGCGTCTGAAGACAACCGCAGTGTACTTACATATAATAAATAAATAA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGCGTCTGAAGACAACCGCAGTGTACTTACATATAATAAATAAATAA  200

seq1  ATAAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAGAGCCCCTGGCAG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAGAGCCCCTGGCAG  250

seq1  TGGGCTTAACAATAGACTAGCATTACACCTGGCTCCTTCCTTCCTTCCTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGCTTAACAATAGACTAGCATTACACCTGGCTCCTTCCTTCCTTCCTT  300

seq1  CCTTCCTTCCTTCCTGTCTGTCTGTCTGTCTGTTTGTTTGTTTGTTTGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCCTTCCTTCCTGTCTGTCTGTCTGTCTGTTTGTTTGTTTGTTTGTT  350

seq1  TGTTTGTTTTTCAAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTGTTTTTCAAGACAGGGTTTCTCTGTATAGCCCTGGCTGTCCTGGA  400

seq1  ACTTGTTTTGTAGACCAGGCTGGCCTTGAATTCAGGAATCTGCCTACCTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTTGTTTTGTAGACCAGGCTGGCCTTGAATTCAGGAATCTGCCTACCTC  450

seq1  TGCCTCCCAAGTGCTGGGATTAAAGGCATGCGCCACCACTTCCGGCCACC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTCCCAAGTGCTGGGATTAAAGGCATGCGCCACCACTTCCGGCCACC  500

seq1  TAGCTCCTTTCTTAGTGGTAAACAACGGTCCTTTTTTTTTTTAAGGTATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTCCTTTCTTAGTGGTAAACAACGGTCCTTTTTTTTTTTAAGGTATT  550

seq1  TTCCTCGTTTACATTTCCAATGCTATCCCAAAAGTCCCCCATACCCACCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCTCGTTTACATTTCCAATGCTATCCCAAAAGTCCCCCATACCCACCT  600

seq1  CCACAATCCCCTACCCACCCACTCCCCCTTTTTGGCCCTGGCGTTCCCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAATCCCCTACCCACCCACTCCCCCTTTTTGGCCCTGGCGTTCCCCT  650

seq1  GTACTGGGGCATATAAAGTTTGCAAGTCCAATGGGCCTCTCTTTCCAGTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTGGGGCATATAAAGTTTGCAAGTCCAATGGGCCTCTCTTTCCAGTG  700

seq1  ATGGCCGACTAGGCCATCTTTTTGATACATATGCACCTAGAGACAAGAGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGCCGACTAGGCCATCTTTTTGATACATATGCACCTAGAGACAAGAGC  750

seq1  TCCGGGTTCGTTCATAATGTTGTTCCACCTATAGGGTTGCAGTTCCCTTT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCGGGTTCGTTCATAATGTTGTTCCACCTATAGGGTTGCAGTTCCCTTT  800

seq1  AGCTCCTTGGGTAATTTCTCTAGAGCTTATCTTTGAGCACAAGGATCTCC  850
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  AGCTCCTTGGGTAATTTCTCTAGAGCTTATCTTTGAGCAC-AGGATCTCC  849

seq1  TGGTCTCCTTCACCTGCCCTCTCTGAAGAGCATTTTGCCCTGTTTCATAG  900
      |||||| ||||| |||||||||||| ||||||||||||||||||||||||
seq2  TGGTCT-CTTCA-CTGCCCTCTCTG-AGAGCATTTTGCCCTGTTTCATAG  896

seq1  ACTCTGGGTCTGCAGTCTAGAGGATGCCTGAGGAGTTCCTTCATAGCTGT  950
      |||||||||||||||||||||||||||||||||||||| |||||||||||
seq2  ACTCTGGGTCTGCAGTCTAGAGGATGCCTGAGGAGTTCTTTCATAGCTGT  946

seq1  AGAGATCCCA-CTATTAACAGGAGGGGAAAATGAAATTCAAGGTC-ATTC  998
      |||||||||| |||||| ||||| ||| ||||| ||||| ||||| ||||
seq2  AGAGATCCCACCTATTACCAGGA-GGGCAAATG-AATTC-AGGTCAATTC  993

seq1  TCAGCTAC--AGAGTGAATTTGAGGGAGTCTGGTATACATGAAAGTTTCT  1046
      ||||||||  || ||||||| |||   | |||  ||||||||| | ||||
seq2  TCAGCTACGAAGGGTGAATTGGAG---GACTG--ATACATGAAGGCTTCT  1038

seq1  AAAATAGCCAT  1057
       ||||||||||
seq2  -AAATAGCCAT  1048

seq1: chrX_160555819_160556988
seq2: B6Ng01-243C24.g_65_1229 (reverse)

seq1  AACTTGTTT--GTAAGGATTTATATGCAAATGAATT-CATATGTGTAATA  47
      |||||||||  ||| ||| |||||||| |  ||||| ||  ||||||| |
seq2  AACTTGTTTTGGTACGGAATTATATGC-ATGGAATTCCAATTGTGTAAAA  49

seq1  -TATTAATATACCTATTCTTATGCT-CTTATTCTAGTATTTTAAATAAGA  95
       |||||||||| ||||   |||||| ||||||||||||||||||||||||
seq2  TTATTAATATA-CTAT--CTATGCTCCTTATTCTAGTATTTTAAATAAGA  96

seq1  CTACTTGTAAATAAGATTACATCATTAATGCAAATCTTTA-TCTTGGTAG  144
      |||||||||||||||||||||||||| |||| |||||||| ||| |||||
seq2  CTACTTGTAAATAAGATTACATCATT-ATGC-AATCTTTATTCTGGGTAG  144

seq1  TCTTTTTACCCCATTAACTGTTATAGTCCTGGAAAGTACACAGAAATTAT  194
      || ||||||||||||||||| |||||||||||||||||||||||||||| 
seq2  TC-TTTTACCCCATTAACTG-TATAGTCCTGGAAAGTACACAGAAATTA-  191

seq1  TTCAGCATTCATAACTTCTTGTGCCTCTTTTTATTTGCCACAATTGCAAA  244
      |||||||||||||||||| |||||||||||||| ||||||||||||||||
seq2  TTCAGCATTCATAACTTC-TGTGCCTCTTTTTA-TTGCCACAATTGCAAA  239

seq1  CAAGACTGTATTTATCCAACCCTTCCTCATTCTAGATTCCACTCTCTTTT  294
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAGACTGTATTTATCCAACCCTTCCTCATTCTAGATTCCACTCTCTTTT  289

seq1  TTTATGTGCTTTCAGGAACAACAAAGGACCACCTGGAGTGGAAGATGCAG  344
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATGTGCTTTCAGGAACAACAAAGGACCACCTGGAGTGGAAGATGCAG  339

seq1  AAGACAAGTGTGAAAACATCATCACAATAGAAAATGGCATCCCTTGTGAT  394
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGACAAGTGTGAAAACATCATCACAATAGAAAATGGCATCCCTTGTGAT  389

seq1  CCCTTGGACATGAAGGGAGGGCACATTAATGATGGCTTCTTGACAGAGGA  444
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTGGACATGAAGGGAGGGCACATTAATGATGGCTTCTTGACAGAGGA  439

seq1  TGAGCGCCTCACCCCTCTCTGAGAGTGACAGTCTTGTAAGAAAATTTTAA  494
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGCGCCTCACCCCTCTCTGAGAGTGACAGTCTTGTAAGAAAATTTTAA  489

seq1  GATGCTTGAATGTGATTGACAACAAATTATATCCACAAAGACCAATGAAA  544
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGCTTGAATGTGATTGACAACAAATTATATCCACAAAGACCAATGAAA  539

seq1  TCATAAGGTGTTAGCTTCTCAAAATATTCTAGAATTTTCTTTTTGATAAC  594
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATAAGGTGTTAGCTTCTCAAAATATTCTAGAATTTTCTTTTTGATAAC  589

seq1  TGATTATGTAGGTATAGTGTGTGTTTGTAGTTACTGATTTGAGCATTTCT  644
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTATGTAGGTATAGTGTGTGTTTGTAGTTACTGATTTGAGCATTTCT  639

seq1  AGAAATAAAGTCAGGGCTGTAACTATATTTCATATTTTGAAGACCTAAGA  694
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAATAAAGTCAGGGCTGTAACTATATTTCATATTTTGAAGACCTAAGA  689

seq1  AAAAAATTTTCACTGGAGAATGGCTATAACATGGCATAGAAATCATTAAA  744
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAAATTTTCACTGGAGAATGGCTATAACATGGCATAGAAATCATTAAA  739

seq1  AATGGATCTTTTTGAATACTGTTTATATTACTCTGTATATGATGCATCGA  794
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGGATCTTTTTGAATACTGTTTATATTACTCTGTATATGATGCATCGA  789

seq1  GTAAAATTAAACAAGAGATGGATAAAAATGGCAAGGGAATTTTATTCTGT  844
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAAATTAAACAAGAGATGGATAAAAATGGCAAGGGAATTTTATTCTGT  839

seq1  TATCACACCAACAGTTGCTTGTATAGTTTCTGCATATTAGTCTTTAGTAG  894
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCACACCAACAGTTGCTTGTATAGTTTCTGCATATTAGTCTTTAGTAG  889

seq1  GGCAAGCAGATCTATTTGTTGTTGCCTGCAATTTGTACACATCCTACCTA  944
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCAAGCAGATCTATTTGTTGTTGCCTGCAATTTGTACACATCCTACCTA  939

seq1  TGCTGATTTAATAAAGTAGTGATCATCTCATTTTGATTGTATGGCTGACT  994
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTGATTTAATAAAGTAGTGATCATCTCATTTTGATTGTATGGCTGACT  989

seq1  ACGCTTTTAGACATTTTCACAAGGTGGAACATAGTGAGTTTAACTTTATT  1044
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGCTTTTAGACATTTTCACAAGGTGGAACATAGTGAGTTTAACTTTATT  1039

seq1  AGTTATATTTAATTTCATCTACAGCCCTGGAAATGGATGTTACTCTTATG  1094
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTATATTTAATTTCATCTACAGCCCTGGAAATGGATGTTACTCTTATG  1089

seq1  GTGTACATCCATTTTGTTTTGTTTTGTTTTCGAGACAGAGTTTCTCTGTG  1144
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTACATCCATTTTGTTTTGTTTTGTTTTCGAGACAGAGTTTCTCTGTG  1139

seq1  TAATAGCCCTGGCTGTCCTGGAATTC  1170
      ||||||||||||||||||||||||||
seq2  TAATAGCCCTGGCTGTCCTGGAATTC  1165

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information