MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-253I23
Chromosome	X (Build37)	13 (Build37)
Map Location	92,503,469 - 92,504,536	29,329,104 - 29,329,598
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	Klhl15, LOC385495, LOC670263, LOC100042098, LOC631145, 0610008C08Rik, EG668148, Maged1, LOC668150, EG385499, EG668156, Gspt2, LOC385500, Zxdb, LOC631331, EG631319, Zxda, Gm371, 9630042H07Rik, Arhgef9, LOC619688
Downstream gene	LOC100042189, 2810002O09Rik, Asb12, LOC668202, AK129302, A130028J20Rik, 1700010D01Rik, Las1l, Msn, Psmb7-ps1, LOC668221, Vsig4, B230358A15Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Klhl15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	LOC385495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 50 Proteins pseudo : _no_value

name	LOC670263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100042098 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042098
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC631145 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	0610008C08Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68316 MGI:1915566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG668148 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668148 MGI:3647163
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Maged1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94275 MGI:1930187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668150 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668150
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG385499 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385499 MGI:3645347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins

name	EG668156 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668156 MGI:3643998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins pseudo : _no_value

name	Gspt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14853 MGI:1316727
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385500 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385500
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	Zxdb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668166 MGI:3694898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC631331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:631331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 Proteins pseudo : _no_value

name	EG631319 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:631319 MGI:3648527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins

name	Zxda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:668171 MGI:1921689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Gm371 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236914 MGI:2685217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins

name	9630042H07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270624 MGI:2444925
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236915 MGI:2442233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619688 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619688
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100042189 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	2810002O09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Asb12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70392 MGI:1917642
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668202 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	AK129302 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245522 MGI:2679294
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	A130028J20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547176 MGI:2442133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700010D01Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76386 MGI:1923636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Las1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76130 MGI:1923380
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Msn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17698 MGI:97167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmb7-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19178 MGI:1096396
definition	gene_synonym : Psmb7-ps note : proteasome (prosome, macropain) subunit, beta type 7, pseudogene 1 pseudo : _no_value

name	LOC668221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Vsig4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278180 MGI:2679720
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B230358A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245525 MGI:3045337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klhl15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84794654 GeneID:236904 MGI:1923400
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kelch-like 15 (Drosophila) transcript_id : NM_001039061.1

name	LOC631145 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271777 GeneID:631145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to Putative uncharacterized protein CXorf58 transcript_id : XM_001477581.1

name	0610008C08Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142368551 GeneID:68316 MGI:1915566
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 0610008C08 gene transcript_id : NM_026673.2

name	Maged1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130592 GeneID:94275 MGI:1930187
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family D, 1 transcript_id : NM_019791.2

name	EG385499 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407669 GeneID:385499 MGI:3645347
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins product : predicted gene, EG385499 transcript_id : XM_358254.4

name	Gspt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331155 GeneID:14853 MGI:1316727
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G1 to S phase transition 2 transcript_id : NM_008179.2

name	Zxdb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490364 GeneID:668166 MGI:3694898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, X-linked, duplicated B transcript_id : NM_001081473.1

name	EG631319 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407672 GeneID:631319 MGI:3648527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins product : predicted gene, EG631319 transcript_id : XM_994723.1

name	Gm371 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83002976 GeneID:236914 MGI:2685217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 Proteins product : gene model 371, (NCBI) transcript_id : XM_141955.3

name	9630042H07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364187 GeneID:270624 MGI:2444925
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 9630042H07 gene transcript_id : NM_178753.3

name	Arhgef9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384851 GeneID:236915 MGI:2442233
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cdc42 guanine nucleotide exchange factor (GEF) 9 transcript_id : NM_001033329.2

name	2810002O09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:123858769 GeneID:72345 MGI:1919595
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810002O09 gene transcript_id : NM_175179.3

name	Asb12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370473 GeneID:70392 MGI:1917642
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ankyrin repeat and SOCS box-containing protein 12 transcript_id : NM_080858.2

name	LOC668202 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271785 GeneID:668202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Predicted gene, EG546347 transcript_id : XM_001477719.1

name	AK129302 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51491857 GeneID:245522 MGI:2679294
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence AK129302 transcript_id : NM_001003916.1

name	A130028J20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347403 GeneID:547176 MGI:2442133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA A130028J20 gene transcript_id : NM_001034907.2

name	1700010D01Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364117 GeneID:76386 MGI:1923636
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700010D01 gene transcript_id : NM_029590.2

name	Las1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71979674 GeneID:76130 MGI:1923380
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : LAS1-like (S. cerevisiae) transcript_id : NM_152822.2

name	Msn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:70778914 GeneID:17698 MGI:97167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : moesin transcript_id : NM_010833.2

name	Vsig4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142382466 GeneID:278180 MGI:2679720
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : V-set and immunoglobulin domain containing 4 transcript_id : NM_177789.3

name	B230358A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370938 GeneID:245525 MGI:3045337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B230358A15 gene transcript_id : NM_172931.2

name	Klhl15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84794655 CCDS:CCDS30278.1 GeneID:236904 MGI:1923400
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : kelch-like 15 isoform a protein_id : NP_001034150.1

name	LOC631145 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271778 GeneID:631145
definition	codon_start : 1 product : similar to Putative uncharacterized protein CXorf58 protein_id : XP_001477631.1

name	0610008C08Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311967 GeneID:68316 MGI:1915566
definition	codon_start : 1 note : Novel transmembrane domain containing protein product : hypothetical protein LOC68316 protein_id : NP_080949.1

name	Maged1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9789935 CCDS:CCDS30280.1 GeneID:94275 MGI:1930187
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0003713 - transcription coactivator activity [Evidence IDA] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IDA] codon_start : 1 product : melanoma antigen family D, 1 protein_id : NP_062765.1

name	EG385499 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772187 GeneID:385499 MGI:3645347
definition	codon_start : 1 product : hypothetical protein protein_id : XP_358254.2

name	Gspt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331156 GeneID:14853 MGI:1316727
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence IEA] codon_start : 1 product : G1 to phase transition 2 protein_id : NP_032205.2

name	Zxdb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490365 GeneID:668166 MGI:3694898
definition	codon_start : 1 product : zinc finger, X-linked, duplicated B protein_id : NP_001074942.1

name	EG631319 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407673 GeneID:631319 MGI:3648527
definition	codon_start : 1 product : hypothetical protein protein_id : XP_999817.1

name	Gm371 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83002977 GeneID:236914 MGI:2685217
definition	codon_start : 1 product : similar to GMCL2 protein_id : XP_141955.3

name	9630042H07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30520207 CCDS:CCDS30282.1 GeneID:270624 MGI:2444925
definition	codon_start : 1 note : novel Spin/Ssty repeat containing protein product : hypothetical protein LOC270624 protein_id : NP_848868.1

name	Arhgef9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84370312 GeneID:236915 MGI:2442233
definition	GO_component : GO:0005938 - cell cortex [Evidence TAS]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence TAS]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA]; GO:0007264 - small GTPase mediated signal transduction [Evidence TAS] codon_start : 1 note : Cdc42 guanine exchange factor 9; collybistin product : Cdc42 guanine nucleotide exchange factor (GEF) 9 protein_id : NP_001028501.1

name	2810002O09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:123858770 GeneID:72345 MGI:1919595
definition	codon_start : 1 product : RIKEN cDNA 2810002O09 protein_id : NP_780388.2

name	Asb12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20270029 CCDS:CCDS30283.1 GeneID:70392 MGI:1917642
definition	GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA] codon_start : 1 product : ankyrin repeat domain-containing SOCS box protein 12 protein_id : NP_543134.1

name	LOC668202 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271786 GeneID:668202
definition	codon_start : 1 product : similar to Predicted gene, EG546347 protein_id : XP_001477769.1

name	AK129302 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51491858 CCDS:CCDS30284.1 GeneID:245522 MGI:2679294
definition	codon_start : 1 product : hepatocellular carcinoma-associated antigen 127 protein_id : NP_001003916.1

name	1700010D01Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21729782 GeneID:76386 MGI:1923636
definition	codon_start : 1 product : hypothetical protein LOC76386 protein_id : NP_083866.1

name	A130028J20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347404 GeneID:547176 MGI:2442133
definition	codon_start : 1 product : hypothetical protein LOC547176 protein_id : NP_001030079.2

name	Las1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71979675 CCDS:CCDS30287.1 GeneID:76130 MGI:1923380
definition	codon_start : 1 product : LAS1-like protein_id : NP_690035.2

name	Msn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:70778915 GeneID:17698 MGI:97167
definition	GO_component : GO:0016324 - apical plasma membrane [Evidence IDA]; GO:0016323 - basolateral plasma membrane [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0001931 - uropod [Evidence IDA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0008092 - cytoskeletal protein binding [Evidence IEA]; GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : moesin protein_id : NP_034963.2

name	Vsig4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244314 CCDS:CCDS30288.1 GeneID:278180 MGI:2679720
definition	codon_start : 1 product : V-set and immunoglobulin domain containing 4 protein_id : NP_808457.1

name	B230358A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370438 GeneID:245525 MGI:3045337
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006986 - response to unfolded protein [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : hypothetical protein LOC245525 protein_id : NP_766519.1

name	LOC385495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385495
definition	number : 1 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 3 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 2 pseudo : _no_value

name	LOC670263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670263
definition	number : 1 pseudo : _no_value

name	LOC100042098 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042098
definition	number : 1 pseudo : _no_value

name	EG668148 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668148
definition	number : 2 pseudo : _no_value

name	EG668148 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668148
definition	number : 1 pseudo : _no_value

name	LOC668150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668150
definition	number : 2 pseudo : _no_value

name	LOC668150 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668150
definition	number : 1 pseudo : _no_value

name	LOC385500 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385500
definition	number : 2 pseudo : _no_value

name	LOC385500 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385500
definition	number : 1 pseudo : _no_value

name	LOC631331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631331
definition	number : 2 pseudo : _no_value

name	LOC631331 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:631331
definition	number : 1 pseudo : _no_value

name	LOC619688 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:619688
definition	number : 1 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 2 pseudo : _no_value

name	LOC100042189 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042189
definition	number : 1 pseudo : _no_value

name	LOC668221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668221
definition	number : 2 pseudo : _no_value

name	LOC668221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668221
definition	number : 1 pseudo : _no_value

name	Psmb7-ps1 (CDS detail)
type	polyA_signal
link	vega ensembl
xref
definition	gene_synonym : Psmb7-ps

name	EG668156 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407670 GeneID:668156 MGI:3643998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 2 Proteins product : predicted gene, EG668156 pseudo : _no_value transcript_id : XR_002150.1

name	Zxda (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:125628683 GeneID:668171 MGI:1921689
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, X-linked, duplicated A pseudo : _no_value transcript_id : NR_003292.1

clone name	MSMg01-154H16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516I06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460B22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404P22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-312C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-103A02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-490A05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332I04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158N22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385P18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546J18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-355O22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371O05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505C09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-503H10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-268I22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-098M04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-108J20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-492F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149J16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-355E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-389J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-164N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332E18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-187F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-335E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-325N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-326N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-274D10
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-211E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-327A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288B24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-118I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115D07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261L10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-003H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-186C14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275K11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-196F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122K24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-338N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027K08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324N13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176A19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100C19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-120P03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-340L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-292I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329O04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-253I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-290G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308J10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118I03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-197B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323D06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-132K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-316L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-124A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-212J01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-253I23.b	B6Ng01-253I23.g
ACC	GA060258	GA060259
length	1,067	1,042
definition	B6Ng01-253I23.b	B6Ng01-253I23.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(92,503,469 - 92,504,536)	(29,329,104 - 29,329,598)
sequence	gaattcagcatatgggataaggctgataggtaacagatctactaaataga atatctaagccatcaaagtgtaaataatggattctataaagagaaacaaa actatgcaatgatttatactaaaaaaaaaatctcactcatacaagagatg aactccaaagtatgcaaagggatgtacaagaacatcccagaggaatatac aagaactctggacttgccttggaaggatgcaaaggtcctgtatatttatt tgtttatcttaccattgcctagaagaaaagaggaaagaaaaaatgaaatt ccttcactaaaaagaaagacctaggggtaaaataataaccaaagcttaag tcctactttcaaattcagagcttccatttatatcttcagcatgtctagaa aggtattagccttttctctttaaaaagagattttcaaaagagaggttttt tattggtttatttgaagaaactaaggctatatttttaaactttaattgta aaaattcacaattgttttgataaaattcaggctgcctctacaccccctgg gactcctcctatgtcctagccagttttttactccatgtcctctgtttgct ttttagtccatgggcccacttagtgtttccagtatgtgtataggtatagg gtcttccactggagtatgacaagctgtgatggtttgtatatactcagccc agggaatggcactattagaaggtgtggcactattggagtaggtgtggccc tgttggttaggtgtgtcactgtggatgtgggctttaagaccctcatccta gctgcatagaagccagcattctgctaagcagccttcagatgaagatgtag aactcttggctcctcctgcaccatgcctgcctgggtgctgctatactccc accttgatgataatggactgactctctgaacctgtaagtcagccctaatt aactgtccttataagactagccttggtcattgtgtctgttcacagcagta aaccctaactagacacgagcctcttcaggtgtgtaaccatggagaaaaac tgactcattttccagta	gaattctttgcttagctctgggccccattttttaatggggttatttgatt ttctggagtccaccttcttgagttccttatatatattggatattagtctc ctatctaatttaggatagataaagatcctttcccaatctcttggtggcct ttttttcttattgacagtgtcttttgctttatagaagctttgtaattttt tcttttaaaatataatgtattaggtattttccccatttacatttccaatg ctattccaaaagtcccccataccccccactcctctacccacccactccca ctttttggccctggcgttcccctgtactggggcatataaagtttacatga ccaatgggcctctctttccagtgatggccgattaggccatcttttttttt tttttttttttttttttaagcacttgcccatctcattttgtaatgctgat tgactaaggagatatataggtttctgtgatattataaatgatcattgtga aaggctggtcctggggatttatctcagttggtagattctctcttccatct cttgtattctgttgctgatgctcgcatctatggttccagatttctttcct agggtttctatctccagcgttgcctctctttgggttttctttattgtgtc tatttccctttttaggtcttgtatggttttgttcaattccatcacctgtt tggttgtgtttccctgtttttctttgaggacttctacctgtttggttgtg ttttcctatttttctttaaggacttgcaccttctttagcagtattctcct gtatttctttaagtgagttattaaagtccttcttggatgtcctctaccat catcatgagttatgcttttaaatcccgggtctacctttttgggtgtattg aggtatccaggactgggctgaggtgggagtggctggttctgatgatggtg agtggtcttggtttctgtagtagattcttattctaccttatagcagcctt cagccatctgggtaatctctggaaatagcttgtttatagttg
quality values	Open. Hide. 58 33 27 23 58 41 26 52 54 54 54 52 47 62 62 62 31 23 62 62 62 49 56 62 62 41 51 62 54 54 62 51 56 56 37 32 25 47 56 56 59 59 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 49 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 59 62 62 62 59 62 62 62 62 49 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 54 47 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 54 58 58 58 58 54 58 58 58 58 58 58 58 54 58 54 58 52 58 58 58 47 58 58 58 58 58 45 35 58 58 58 58 58 54 54 52 54 58 54 51 58 58 58 50 49 44 51 58 58 58 58 58 58 58 58 46 58 58 54 52 58 58 49 58 58 58 58 51 58 58 58 51 58 49 58 58 58 58 51 51 58 53 53 50 53 58 58 58 51 51 58 49 50 58 58 58 52 53 53 58 50 58 51 48 40 48 53 52 49 41 58 52 58 53 53 50 51 58 46 53 53 53 51 48 49 58 35 53 58 58 48 42 50 41 50 58 49 58 31 50 47 28 51 54 37 37 51 52 50 58 58 51 51 41 39 58 53 52 58 50 58 39 52 50 50 51 41 38 51 53 42 39 51 58 33 50 32 58 41 54 41 33 54 52 35 52 41 42 40 50 53 45 34 33 38 10 54 28 54 52 51 51 32 41 42 45 39 45 39 44 44 54 33 42 42 22 46 35 49 41 51 38 14 54 38 34 52 35 40 33 38 40 54 42 44 49 31 51 37 49 40 39 42 53 47 46 36 51 52 31 29 53 40 35 54 47 33 44 54 53 38 51 29 41 12 40 40 53 40 34 43 34 34 32 52 31 53 32 32 32 21 32 31 29 48 52 24 31 32 31 32 34 21 22 40 32 32 40 37 52 41 32 18 32 32 28 33 32 31 42 33 31 16 29 17 31 40 42 18 22 14 26 34 31 26 51 43 23 37 32 41 24 41 19 23 43 35 42 38 33 32 28 31 23 31 31 22 30 31 32 17 30 27 31 26 26 31 36 46 37 31 27 28 34 30 32 32 32 30 26 34 42 36 46 31 28 33 26 28 31 29 24 22 31 43 27 33 36 26 31 20 14 13 31 31 27 22 31 29 31 31 29 17 32 27 15 16 19 30 25 30 26 31 28 28 28 27 26 41 19 28 22 30 27 25 13 17 22 33 42 35 23 22 27 19 20 29 26 27 7 31 19 31 32 16 21 10 25 14 30 32 15 26 25 18 24 21 23 21 21 27 28 33 15 19 16 8 9 23 21 28 32 17 31 37 36 18 4 21 28 30 8 17 32 19 23 6 16 11 31 20 7 19 7 23 15 28 13 8 11 11 3 5 5 12 25 15 22 18 12 13 9 13 7 19 28 17 18 8 16 34 38 31 16 8 27 27 28 20 23 18 10 24 34 38 26 10 20 18 26 18 27	Open. Hide. 62 47 21 38 62 62 62 62 62 62 56 46 43 28 32 56 56 56 46 43 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 43 49 49 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 56 54 59 62 62 62 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 49 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 29 37 38 17 19 22 35 41 30 36 41 41 38 24 27 19 19 19 21 25 52 52 50 43 35 40 40 29 47 30 35 30 38 33 43 46 43 43 29 40 52 19 35 23 12 33 23 23 34 33 34 32 33 52 39 37 34 33 27 32 33 33 40 32 35 33 34 47 35 47 52 40 34 42 52 42 39 35 42 42 46 22 26 40 52 47 22 39 27 35 42 44 33 52 52 50 52 52 52 32 31 16 28 29 33 40 42 46 50 42 34 47 50 43 34 15 33 25 53 30 34 42 33 34 25 42 33 34 42 35 29 34 42 33 46 40 42 50 32 37 30 34 50 34 48 34 32 42 37 32 32 50 27 35 30 24 34 19 42 33 35 46 29 39 48 41 53 26 46 32 51 31 25 47 28 26 27 32 37 42 50 31 40 33 39 25 50 44 34 42 34 33 49 39 50 37 40 39 47 31 36 50 33 27 39 39 46 58 39 50 31 39 53 50 49 50 44 42 22 49 50 28 32 35 42 41 33 25 50 49 18 51 32 40 37 52 37 51 52 29 51 32 25 54 54 44 32 45 24 32 14 37 23 30 52 27 40 36 39 31 16 54 51 51 34 17 25 17 9 14 19 42 18 31 26 38 32 18 31 42 21 40 30 44 37 40 40 12 12 36 22 42 31 51 29 21 47 46 31 47 36 47 52 53 34 29 31 45 36 32 45 10 40 24 16 31 32 23 24 42 32 32 18 36 17 52 31 30 33 8 32 42 23 43 24 51 51 28 30 51 28 33 32 51 51 51 32 31 33 40 25 30 40 11 31 31 20 19 51 24 31 17 28 31 28 10 15 24 16 32 21 18 31 36 27 27 31 27 31 25 14 19 33 20 43 28 21 31 46 24 10 15 46 21 22 42 32 31 31 30 20 34 25 17 20 22 27 41 31 20 20 28 27 24 34 35 17 41 11 12 36 11 15 21 32 31 32 37 28 31 24 38 25 21 28 34 33 31 30 19 34 31 19 31 28 15 16 31 26 21 44 38 38 20 48 33 16 11 41 11 30 48 26 30 32 24 28 18 22 24 48 48 48 31 26 44 31 22 36 24 11 13 16 11 16 17 32 18 17 15 14 19 21 19 9 12 17 28 8 34 21 22 32 16 9 5 6 6 6 31 15 18 9 8 5 11 8 18 20 10 4 6 32 16 10 31 13 28 34 10 22 30 11 9 32 14 32 28 34 7 30 10 19 20 18 10 12 15 21 7 13 26 15 8 7 24 5 15 10 9 9 9 15 17 10 7 5 8 5 8 4 6 3 3 16 25 6 4 27 6 13 6 19 20 6 17 5 15 20 13 14 6 6 8 28 20 7 18 9 7 22 6 6 5 15 11 9 22 7 19 5 4 5 16 8 7 7 22 8 12 7 8 9 9 12 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_92503469_92504536
seq2: B6Ng01-253I23.b_45_1111

seq1  GAATTCAGCATATGGGATAAGGCTGATAGGTAACAGATCTACTAAATAGA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGCATATGGGATAAGGCTGATAGGTAACAGATCTACTAAATAGA  50

seq1  ATATCTAAGCCATCAAAGTGTAAATAATGGATTCTATAAAGAGAAACAAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATCTAAGCCATCAAAGTGTAAATAATGGATTCTATAAAGAGAAACAAA  100

seq1  ACTATGCAATGATTTATACTAAAAAAAAAATCTCACTCATACAAGAGATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTATGCAATGATTTATACTAAAAAAAAAATCTCACTCATACAAGAGATG  150

seq1  AACTCCAAAGTATGCAAAGGGATGTACAAGAACATCCCAGAGGAATATAC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCCAAAGTATGCAAAGGGATGTACAAGAACATCCCAGAGGAATATAC  200

seq1  AAGAACTCTGGACTTGCCTTGGAAGGATGCAAAGGTCCTGTATATTTATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACTCTGGACTTGCCTTGGAAGGATGCAAAGGTCCTGTATATTTATT  250

seq1  TGTTTATCTTACCATTGCCTAGAAGAAAAGAGGAAAGAAAAAATGAAATT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTTATCTTACCATTGCCTAGAAGAAAAGAGGAAAGAAAAAATGAAATT  300

seq1  CCTTCACTAAAAAGAAAGACCTAGGGGTAAAATAATAACCAAAGCTTAAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTCACTAAAAAGAAAGACCTAGGGGTAAAATAATAACCAAAGCTTAAG  350

seq1  TCCTACTTTCAAATTCAGAGCTTCCATTTATATCTTCAGCATGTCTAGAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTACTTTCAAATTCAGAGCTTCCATTTATATCTTCAGCATGTCTAGAA  400

seq1  AGGTATTAGCCTTTTCTCTTTAAAAAGAGATTTTCAAAAGAGAGGTTTTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTATTAGCCTTTTCTCTTTAAAAAGAGATTTTCAAAAGAGAGGTTTTT  450

seq1  TATTGGTTTATTTGAAGAAACTAAGGCTATATTTTTAAACTTTAATTGTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTGGTTTATTTGAAGAAACTAAGGCTATATTTTTAAACTTTAATTGTA  500

seq1  AAAATTCACAATTGTTTTGATAAAATTCAGGCTGCCTCTACACCCCCTGG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATTCACAATTGTTTTGATAAAATTCAGGCTGCCTCTACACCCCCTGG  550

seq1  GACTCCTCCTATGTCCTAGCCAGTTTTTTACTCCATGTCCTCTGTTTGCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCCTCCTATGTCCTAGCCAGTTTTTTACTCCATGTCCTCTGTTTGCT  600

seq1  TTTTAGTCCATGGGCCCACTTAGTGTTTCCAGTATGTGTATAGGTATAGG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAGTCCATGGGCCCACTTAGTGTTTCCAGTATGTGTATAGGTATAGG  650

seq1  GTCTTCCACTGGAGTATGACAAGCTGTGATGGTTTGTATATACTCAGCCC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTCCACTGGAGTATGACAAGCTGTGATGGTTTGTATATACTCAGCCC  700

seq1  AGGGAATGGCACTATTAGAAGGTGTGGCACTATTGGAGTAGGTGTGGCCC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGGAATGGCACTATTAGAAGGTGTGGCACTATTGGAGTAGGTGTGGCCC  750

seq1  TGTTGGTTAGGTGTGTCACTGTGGATGTGGGCTTTAAGACCCTCATCCTA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTTGGTTAGGTGTGTCACTGTGGATGTGGGCTTTAAGACCCTCATCCTA  800

seq1  GCTGCATAGAAGCCAGCATTCTGCTAAGCAGCCTTCAGATGAAGATGTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGCATAGAAGCCAGCATTCTGCTAAGCAGCCTTCAGATGAAGATGTAG  850

seq1  AACTCTTGGCTCCTCCTGCACCATGCCTGCCTGGGTGCTGCTATACTCCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCTTGGCTCCTCCTGCACCATGCCTGCCTGGGTGCTGCTATACTCCC  900

seq1  ACCTTGATGATAATGGACTGACTCTCTGAACCTGTAAGTCAGCCCTAATT  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCTTGATGATAATGGACTGACTCTCTGAACCTGTAAGTCAGCCCTAATT  950

seq1  AACTGTCCTTATAAGACTAGCCTTGGTCATTGTGTCTGTTCACAGCAGTA  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  AACTGTCCTTATAAGACTAGCCTTGGTCATTGTGTCTGTTCACAGCAGT-  999

seq1  AAACCCTAACTAAGACACGAGCCTCTCAGGGTGTGTAACCATGGAG-AAA  1049
      ||||||||||| ||||||||||||||   ||||||||||||||||| |||
seq2  AAACCCTAACT-AGACACGAGCCTCTTCAGGTGTGTAACCATGGAGAAAA  1048

seq1  ACTGACTCATTTTCCAGTA  1068
      |||||||||||||||||||
seq2  ACTGACTCATTTTCCAGTA  1067

seq1: chr13_29329104_29329598
seq2: B6Ng01-253I23.g_600_1109 (reverse)

seq1  CAACTAT-AACAA-CTAACTCCAGAGATT-GCCAGATGGCGAAAGG----  43
      ||||||| ||||| |||  ||||||||||  |||||||||  ||||    
seq2  CAACTATAAACAAGCTATTTCCAGAGATTACCCAGATGGCTGAAGGCTGC  50

seq1  TAAACG------TAAGAATCCTACTAACAGGAACCAAGACCACTCACCAT  87
      || | |      ||||||| ||||| |||| |||||||||||||||||||
seq2  TATAAGGTAGAATAAGAAT-CTACT-ACAGAAACCAAGACCACTCACCAT  98

seq1  CATCAGAACCCAGCACTCCCACTTC-GCCCAGTCCAGGACATCCTAACAC  136
      ||||||||||   ||||||||| || ||||||||| ||| | |  || ||
seq2  CATCAGAACCAGCCACTCCCACCTCAGCCCAGTCCTGGATACCTCAATAC  148

seq1  ACCTGAAAAGGTAGA-CCTGGATTTAAAAGCATTTCTCATGATGATGGTA  185
      |||  |||||||||| || ||||||||||||||  |||||||||||||||
seq2  ACCCAAAAAGGTAGACCCGGGATTTAAAAGCATAACTCATGATGATGGTA  198

seq1  GAGGACAT-AAAGAAGGAATTTAATAACTCACTTAAGGAAATACAGGAGA  234
      ||||||||  |||||||| ||||||||||||||||| |||||||||||||
seq2  GAGGACATCCAAGAAGGACTTTAATAACTCACTTAAAGAAATACAGGAGA  248

seq1  ACACTGCTAAAG-AGTTACAAGTCCTTAAAGAAAAACAGGAAAACACAAC  283
      | |||||||||| || | |||||||||||||||||| |||||||||||||
seq2  ATACTGCTAAAGAAGGTGCAAGTCCTTAAAGAAAAATAGGAAAACACAAC  298

seq1  CAAACAGGTAGAAGTCCTTATAGAAAAACAGGAAAACACATCGAAACAGG  333
      |||||||||||||||||| | ||||||||||| ||||||| | |||||||
seq2  CAAACAGGTAGAAGTCCTCAAAGAAAAACAGGGAAACACAACCAAACAGG  348

seq1  TGATAGAAATGAACAAAACCATACTAGACCTAAAAAGGGAAGTAGACACA  383
      |||| ||| ||||||||||||||| |||||||||||||||| ||||||||
seq2  TGATGGAATTGAACAAAACCATACAAGACCTAAAAAGGGAAATAGACACA  398

seq1  ATAAAGAAAACCCAAAGTGAGGCAACGCTGGAGATAGAAACCCTAGGAAA  433
      ||||||||||||||||| ||||||||||||||||||||||||||||||||
seq2  ATAAAGAAAACCCAAAGAGAGGCAACGCTGGAGATAGAAACCCTAGGAAA  448

seq1  GAAATCTGGAACCATAGATGCCAGCATCAGCAACAGAATACAAGAGATGG  483
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  GAAATCTGGAACCATAGATGCGAGCATCAGCAACAGAATACAAGAGATGG  498

seq1  AAGAGAGAATCT  495
      ||||||||||||
seq2  AAGAGAGAATCT  510

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information