MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-255O13
Chromosome	X (Build37)
Map Location	5,983,345 - 6,096,198
singlet/doublet	doublet
Overlap gene	Shroom4
Upstream gene	Mycs, LOC668969, LOC668970, OTTMUSG00000016453, LOC627412, LOC436185, LOC668971, LOC100043936, LOC668972, Nudt11, LOC208428, AU022751, Nudt10, Bmp15
Downstream gene	LOC100043937, Dgkk, Ccnb3, Akap4, Clcn5, Usp27x, 2010204K13Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mycs (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17870 MGI:1332242
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668969 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC668970 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668970
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	OTTMUSG00000016453 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434725 MGI:3709265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins

name	LOC627412 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:627412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 202 ESTs, 10 Proteins pseudo : _no_value

name	LOC436185 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC668971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins

name	LOC100043936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC668972 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 12 Proteins pseudo : _no_value

name	Nudt11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:58242 MGI:1930957
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC208428 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:208428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 447 ESTs, 1 Protein

name	AU022751 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102991 MGI:2147968
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nudt10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102954 MGI:2147931
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bmp15 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12155 MGI:1316745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Shroom4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:208431 MGI:2685570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043937 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Dgkk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331374 MGI:3580254
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ccnb3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209091 MGI:2183443
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Akap4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11643 MGI:102794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Clcn5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12728 MGI:99486
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Usp27x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54651 MGI:1859645
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2010204K13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68355 MGI:1922859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	Mycs (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6754769 GeneID:17870 MGI:1332242
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myc-like oncogene, s-myc protein transcript_id : NM_010850.1

name	OTTMUSG00000016453 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94406963 GeneID:434725 MGI:3709265
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 12 ESTs, 15 Proteins product : predicted gene, OTTMUSG00000016453 transcript_id : XM_486609.4

name	LOC436185 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:82999675 GeneID:436185
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to SMPTB transcript_id : XM_488311.2

name	LOC668971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406964 GeneID:668971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins product : similar to SMPTB transcript_id : XM_001006607.1

name	LOC100043936 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270925 GeneID:100043936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : similar to cyclic nucleotide gated channel beta 1 transcript_id : XM_001481245.1

name	Nudt11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384358 GeneID:58242 MGI:1930957
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 11 transcript_id : NM_021431.2

name	LOC208428 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94406967 GeneID:208428
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 447 ESTs, 1 Protein product : similar to Mus musculus ribosomal protein L19 transcript_id : XM_141608.7

name	AU022751 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142383176 GeneID:102991 MGI:2147968
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence AU022751 transcript_id : NM_001033211.2

name	Nudt10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:72384356 GeneID:102954 MGI:2147931
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nudix (nucleoside diphosphate linked moiety X)-type motif 10 transcript_id : NM_001031664.1

name	Bmp15 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328446 GeneID:12155 MGI:1316745
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bone morphogenetic protein 15 transcript_id : NM_009757.3

name	Shroom4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94818778 GeneID:208431 MGI:2685570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 4 transcript_id : NM_001040459.1

name	LOC100043937 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270927 GeneID:100043937
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : similar to gamma-aminobutyric acid A receptor, epsilon transcript_id : XM_001481246.1

name	Dgkk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054140 GeneID:331374 MGI:3580254
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol kinase kappa transcript_id : NM_177914.2

name	Ccnb3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142371324 GeneID:209091 MGI:2183443
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cyclin B3 transcript_id : NM_183015.2

name	Akap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347480 GeneID:11643 MGI:102794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 4 transcript_id : NM_009651.3

name	Akap4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:110347482 GeneID:11643 MGI:102794
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : A kinase (PRKA) anchor protein 4 transcript_id : NM_001042542.1

name	Clcn5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980677 GeneID:12728 MGI:99486
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chloride channel 5 transcript_id : NM_016691.2

name	Usp27x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388539 GeneID:54651 MGI:1859645
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 27, X chromosome transcript_id : NM_019461.2

name	Mycs (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754770 CCDS:CCDS29953.1 GeneID:17870 MGI:1332242
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0050875 - cellular physiological process [Evidence IEA]; GO:0000074 - regulation of progression through cell cycle [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation product : myc-like oncogene, s-myc protein protein_id : NP_034980.1

name	OTTMUSG00000016453 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51771887 GeneID:434725 MGI:3709265
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486609.1

name	LOC436185 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:82999676 GeneID:436185
definition	codon_start : 1 product : similar to SMPTB protein_id : XP_488311.2

name	LOC668971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94406965 GeneID:668971
definition	codon_start : 1 product : similar to SMPTB protein_id : XP_001006607.1

name	LOC100043936 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270926 GeneID:100043936
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481295.1

name	Nudt11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384359 CCDS:CCDS29955.1 GeneID:58242 MGI:1930957
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0008486 - diphosphoinositol-polyphosphate diphosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : DIPP3 beta product : nudix-type motif 11 protein_id : NP_067406.2

name	LOC208428 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51771891 GeneID:208428
definition	codon_start : 1 product : similar to Mus musculus ribosomal protein L19 protein_id : XP_141608.4

name	AU022751 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701724 GeneID:102991 MGI:2147968
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC102991 protein_id : NP_001028383.1

name	Nudt10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:72384357 CCDS:CCDS29957.1 GeneID:102954 MGI:2147931
definition	GO_function : GO:0008486 - diphosphoinositol-polyphosphate diphosphatase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0030145 - manganese ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA] codon_start : 1 note : DIPP3 alpha product : nudix-type motif 10 protein_id : NP_001026834.1

name	Bmp15 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7106259 CCDS:CCDS29958.1 GeneID:12155 MGI:1316745
definition	GO_component : GO:0005576 - extracellular region [Evidence IEA] GO_function : GO:0005125 - cytokine activity [Evidence IEA]; GO:0008083 - growth factor activity [Evidence IEA] codon_start : 1 product : bone morphogenetic protein 15 protein_id : NP_033887.1

name	Shroom4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94818779 CCDS:CCDS29959.1 GeneID:208431 MGI:2685570
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : shroom family member 4 protein_id : NP_001035549.1

name	LOC100043937 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270928 GeneID:100043937
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001481296.1

name	Dgkk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054141 GeneID:331374 MGI:3580254
definition	GO_component : GO:0005886 - plasma membrane [Evidence ISS] GO_function : GO:0019992 - diacylglycerol binding [Evidence IEA]; GO:0004143 - diacylglycerol kinase activity [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0046339 - diacylglycerol metabolism [Evidence ISS]; GO:0007242 - intracellular signaling cascade [Evidence ISS]; GO:0007205 - protein kinase C activation [Evidence IEA]; GO:0006979 - response to oxidative stress [Evidence ISS] codon_start : 1 exception : unclassified translation discrepancy product : diacylglycerol kinase kappa protein_id : NP_808582.2

name	Ccnb3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33942087 CCDS:CCDS29961.1 GeneID:209091 MGI:2183443
definition	GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0051301 - cell division [Evidence IEA]; GO:0007126 - meiosis [Evidence IEA] codon_start : 1 exception : mismatches in translation function : G2 mitotic cyclin product : cyclin B3 protein_id : NP_898836.1 transl_except : (pos:complement(6608009..6608011),aa:Met)

name	Akap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347481 GeneID:11643 MGI:102794
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051018 - protein kinase A binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008104 - protein localization [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IPI] codon_start : 1 note : isoform a is encoded by transcript variant 1 product : A-kinase anchor protein 4 isoform a protein_id : NP_033781.2

name	Akap4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:110347483 GeneID:11643 MGI:102794
definition	GO_component : GO:0009434 - flagellum (sensu Eukaryota) [Evidence IDA] GO_function : GO:0016301 - kinase activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0051018 - protein kinase A binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA] GO_process : GO:0008104 - protein localization [Evidence IMP]; GO:0030317 - sperm motility [Evidence IMP]; GO:0007178 - transmembrane receptor protein serine/threonine kinase signaling pathway [Evidence IPI] codon_start : 1 note : isoform b is encoded by transcript variant 2 product : A-kinase anchor protein 4 isoform b protein_id : NP_001036007.1

name	Clcn5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980678 CCDS:CCDS29963.1 GeneID:12728 MGI:99486
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0005247 - voltage-gated chloride channel activity [Evidence IEA]; GO:0005244 - voltage-gated ion channel activity [Evidence IEA] GO_process : GO:0006821 - chloride transport [Evidence IEA]; GO:0006897 - endocytosis [Evidence IMP]; GO:0006811 - ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : chloride channel 5 protein_id : NP_057900.2

name	Usp27x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29789092 GeneID:54651 MGI:1859645
definition	GO_function : GO:0008233 - peptidase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : ubiquitin specific protease 27, X chromosome protein_id : NP_062334.1

name	LOC668969 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668969
definition	number : 2 pseudo : _no_value

name	LOC668969 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668969
definition	number : 1 pseudo : _no_value

name	LOC668970 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668970
definition	number : 1 pseudo : _no_value

name	LOC668970 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668970
definition	number : 2 pseudo : _no_value

name	LOC627412 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270922 GeneID:627412
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 202 ESTs, 10 Proteins product : hypothetical LOC627412 pseudo : _no_value transcript_id : XR_031930.1

name	LOC668972 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270923 GeneID:668972
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 19 ESTs, 12 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_002276.2

name	2010204K13Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149270943 GeneID:68355 MGI:1922859
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : RIKEN cDNA 2010204K13 gene transcript_id : XR_035367.1

clone name	MSMg01-403I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-447B05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-302D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-543J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-188K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-261B21
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-145P14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-390G10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138P05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-291P05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-364H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-199P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-482F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-489D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-539B04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081C11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270J22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-475O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-076P21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-079C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-345A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057F11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503H18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-384H02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496I24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-532F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-528F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301O12
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-332P13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332P17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-190P11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179E06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-363P20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-179N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-204O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-142P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-262O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-006J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232O17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-320D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-203E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-126J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008C17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255O13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349N07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-099H19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235I24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043H22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-070P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-121A18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-122C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125A10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046N05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098N06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-062O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312I01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-103J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022M22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-255O13.b	B6Ng01-255O13.g
ACC	GA062002	GA062003
length	1,160	544
definition	B6Ng01-255O13.b	B6Ng01-255O13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(6,095,033 - 6,096,198)	(5,983,345 - 5,983,894)
sequence	gaattctggctctactactttctagctgtgagatcctgagaaggttacct aacactggtggcatcaaatttccttgtatgcatactgtagagagcaaaag cacccacctcgcctgattgtttcatcacccgtttgagggctctgggttct tttttttttttttttttttttccattttatccttttattttttttcccat tttttattaggtatttagctcatttacatttccaatgctataccaaaagt cccccataggttcttaactcagtatgacttctgattattataacaaggag gttggtgctgaaaacctgaatgatggcttccagctcaaaattctgtaatc agcatccctaattttaaacatatgaagtaagtacaaagtatattatcttc atctcttcaacacattcctagcatactacttgccaatgggcattctgcaa aagctaggaatgtgtttactaatctagcacaatgtaaacattcccttcga gcagggtaatcttggcagaagacgttttcaggctggggaactctggaaaa aacaaaactaggaggaagagccactaggataggcaaagcaaagcagggcc ctgaagacctggctttctagtgaattttgtacataatgttctacttagca cagaagtgggttccacctgttagagtattaattccatctagagtaatggg gacatctcatccatcgttaacctattccccaagcacttaatgtactttag tatgcacagaacaataaacacactaagtggcagagatacacaaattaaaa aagctctcagctcccagccccagaggggaattattgtctaaagtttatat gcccactgagagatctggttaaataaaatccagcccacccgcattaagtg tctagggaatatgggaagtaagaatgattaaatgatagactcttagggga tagaagtctctaagtggagatcactaggggctgacttttaccgtggctat gtttatactctttccttttacttttccctcagtttttttatcacaggcct ctgactggtgcccacaccagttgagaataactgctttaggtggctcagct tgagactgtcagttaggagagatcctttggagttgaagaaaatatattaa tttcaggatt	actacatcttgtccattgttctctctcctcccctcccctctcctcttcaa atttctggtgctcaagatcaaacctagggcagtagacaagtgttctacta ctgagctaaacgtccctattccttggggctctcttaagttatggagtcca tacacaatatagccatctcctggaggcagttatgaaaattaagtgagacc tttttttttgtgctgagaattgttatctagctacagaccattcttttaaa aacatatatctgaagggggctggctcagtagttaaaagggcttatagctc ttgcagatgaccgtggtttgattcccattatccacatagcaacaaatcca tatcacaggtccagatctgttgcccttcttttgacctcatcaggctcctg tatatacatgtgttcatgtgcatgctcatacacactcatgtgattttttt tggtagcaatgtcataagacactgtctctgtgtcctttaagtaagcactg aggaaagtcatatgatgaagtgtgtgtgtgtgtgtgtgtgtgtg
quality values	Open. Hide. 47 15 30 31 62 62 47 62 49 62 62 62 54 56 54 47 51 62 62 62 62 62 47 44 62 62 62 62 59 45 20 21 19 21 28 23 28 32 27 23 62 62 62 59 59 62 62 59 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 56 59 39 34 28 32 32 25 56 51 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 56 46 31 43 54 59 51 46 32 43 48 54 50 50 49 43 50 56 56 62 59 56 48 50 59 56 56 49 56 62 62 51 50 43 39 45 36 43 34 56 40 43 51 51 56 59 34 36 36 46 39 56 56 50 40 46 34 48 43 43 50 49 39 49 50 59 34 36 23 34 30 40 46 51 59 48 45 43 56 51 56 56 43 48 39 50 50 49 59 49 49 51 46 45 38 40 43 36 38 27 23 28 38 46 50 56 56 49 49 46 37 50 49 49 43 43 49 43 43 43 43 46 49 39 39 41 49 34 39 51 49 46 46 43 24 38 34 50 46 56 50 50 56 59 56 51 51 51 49 49 56 51 43 56 59 51 56 56 59 56 49 30 36 36 43 41 43 59 49 49 50 36 35 50 49 51 51 56 59 43 39 51 43 51 56 59 59 51 59 59 59 59 62 59 46 59 56 50 43 50 43 51 51 56 59 51 51 56 56 56 59 51 59 50 56 51 45 39 37 39 39 36 28 38 38 45 43 43 43 30 38 38 31 38 38 38 56 42 51 51 42 51 38 56 56 56 56 56 56 42 51 38 50 51 56 51 56 56 56 56 56 56 39 33 42 38 56 56 56 51 42 56 50 51 42 51 56 51 56 56 56 51 56 46 43 38 56 56 39 39 50 27 38 38 50 56 56 56 43 43 43 50 56 46 46 33 56 56 43 43 34 43 52 39 48 52 52 52 43 54 52 52 52 52 52 43 52 42 54 52 52 48 39 62 62 43 43 46 42 50 46 42 44 33 22 22 21 52 33 22 41 39 39 51 52 54 54 54 42 42 54 47 50 52 52 52 52 52 48 39 52 41 42 52 54 58 54 52 41 31 31 52 40 41 30 41 52 52 42 50 47 39 30 39 47 47 25 54 37 41 42 27 43 41 46 47 51 42 40 53 49 44 47 54 58 58 47 47 47 58 54 41 47 50 49 58 52 40 51 51 52 49 54 51 28 39 32 54 50 58 46 53 54 58 53 40 50 53 52 40 48 50 48 19 41 43 48 49 40 30 42 39 33 50 50 40 51 39 50 53 42 40 46 43 51 53 39 53 32 41 42 37 53 52 34 38 58 58 38 49 32 39 53 26 50 50 43 54 42 44 40 28 52 25 39 32 24 25 35 30 32 51 31 47 28 50 40 52 40 31 42 45 37 29 34 26 54 41 54 53 39 24 31 44 44 41 37 31 35 40 44 18 44 41 40 54 35 25 35 29 35 32 32 37 42 41 54 54 44 32 53 42 40 27 37 28 31 24 32 40 46 34 23 33 47 47 41 31 32 35 26 30 32 35 31 40 32 39 45 53 32 20 30 40 31 49 32 40 29 42 23 33 28 25 32 32 31 46 31 29 36 22 38 10 30 18 18 31 22 30 28 51 31 34 31 31 51 51 51 51 46 31 35 36 36 34 31 24 26 38 38 31 46 30 21 30 46 32 32 28 16 20 18 6 36 48 24 38 31 32 32 26 25 32 30 16 31 26 31 46 33 30 29 47 28 21 22 26 25 27 28 48 42 16 30 31 33 34 24 31 13 30 24 21 26 31 28 15 27 28 48 32 34 42 48 46 36 30 32 34 18 19 36 46 29 22 35 46 30 19 28 17 29 28 21 28 24 23 17 12 5 17 15 19 43 14 31 16 14 18 18 26 44 26 15 24 20 16 26 13 8 27 28 25 21 19 9 17 11 38 22 20 29 25 18 21 9 23 7 22 24 10 22 20 22 48 48 22 13 7 12 9 9 30 14 21 14 18 27 27 17 32 6 5 5 13 24 14 28 32 19 16 25 28 21 24 48 48 25 23 15 18 22 13 23 48 48 33 22 23 32 6 5 23 34 25 10 9 6 3 10 20 7 5 9 19 14 20 3 8 30 18 6 9 8 34 34 21 28 14 3 22 32 11 9 28 10 12 17 20 11 5 5 6 10 16 34 11 24 10 24 9 17 13 6 9 32 7 6 6 10 11 24 22 6 14 10 6 16 26 32 7 7 11 10 8 23 14 13 19 9 4 12 5 6 16 5 4 5 3 5 22 16 11 22 11 16 24 5 21 8 20 16 9 7 7 10 9 18 18 10 6 4 11 5 8 11 4 7 8 7 10 10 12 22 6 23 10 6 18 12 10 5 5 14 28 25 9 5 14 5 13 17 4 13 14 10 19 28 22 6 8 9 6 5 19 12 7 19 9 16 21 5 5 9 20 4 3 3	Open. Hide. 62 59 59 62 59 59 56 38 45 34 38 46 45 31 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 59 62 59 59 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 54 54 54 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 34 46 58 49 58 58 58 58 58 58 58 58 58 58 58 58 49 58 49 49 49 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 58 48 58 27 30 17 9

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_6095033_6096198
seq2: B6Ng01-255O13.b_47_1206 (reverse)

seq1  AATCCTG-AATTAATATATTTTTTCTTTCAACT-CAAAAGATCCTTCCTA  48
      ||||||| ||||||||||||||    ||||||| |||| ||||  |||||
seq2  AATCCTGAAATTAATATATTTT---CTTCAACTCCAAAGGATCTCTCCTA  47

seq1  ACTGACAGTTCTCAAAAGCTGAGCAACCTAAAGCAG-TATTCT-AACTGG  96
      |||||||| ||||  ||||||||| ||||||||||| |||||| ||||||
seq2  ACTGACAG-TCTC--AAGCTGAGCCACCTAAAGCAGTTATTCTCAACTGG  94

seq1  TGTGGGCACAGGTTCAGAGG-CTGTGAT-AAAAGACTGAGGGAAAAGGTT  144
      |||||||||  | ||||||| ||||||| |||| |||||||||||||  |
seq2  TGTGGGCACCAG-TCAGAGGCCTGTGATAAAAAAACTGAGGGAAAAG--T  141

seq1  AAAAGGAAAGAAGTATAAACATAGCCACGGTAAAAGTCAGCCCCTAGTGA  194
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  AAAAGGAAAG-AGTATAAACATAGCCACGGTAAAAGTCAGCCCCTAGTGA  190

seq1  TCT-CACTTAGAGACTTCTATCCCCTAAGAGTTCTATCATTTAATCATTC  243
      ||| ||||||||||||||||||||||||||| ||||||||||||||||||
seq2  TCTCCACTTAGAGACTTCTATCCCCTAAGAG-TCTATCATTTAATCATTC  239

seq1  TTACTTCCCATATTCCCTAGAACACTTAATGCGGGTGGGCTGGATTTTTA  293
      |||||||||||||||||||| ||||||||||||||||||||||| |||||
seq2  TTACTTCCCATATTCCCTAG-ACACTTAATGCGGGTGGGCTGGA-TTTTA  287

seq1  TTTAACCAGATCTCTCAGTGGGCATATAAACTTTAGACAATAATTCCCTT  343
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  TTTAACCAGATCTCTCAGTGGGCATATAAACTTTAGACAATAATTCCCCT  337

seq1  CTGGGGCTGGGAGCTGAGAGCTTTTTTAATTTGTGTATCTCTGCCACTTA  393
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGGGCTGGGAGCTGAGAGCTTTTTTAATTTGTGTATCTCTGCCACTTA  387

seq1  GTGTGTTTATTGTTCTGTGCATACTAAAGTACATTAAGTGCTTGGGGAAT  443
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTGTTTATTGTTCTGTGCATACTAAAGTACATTAAGTGCTTGGGGAAT  437

seq1  AGGTTAACGATGGATGAGATGTCCCCATTACTCTAGATGGAATTAATACT  493
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTTAACGATGGATGAGATGTCCCCATTACTCTAGATGGAATTAATACT  487

seq1  CTAACAGGTGGAACCCACTTCTGTGCTAAGTAGAACATTATGTACAAAAT  543
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAACAGGTGGAACCCACTTCTGTGCTAAGTAGAACATTATGTACAAAAT  537

seq1  TCACTAGAAAGCCAGGTCTTCAGGGCCCTGCTTTGCTTTGCCTATCCTAG  593
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACTAGAAAGCCAGGTCTTCAGGGCCCTGCTTTGCTTTGCCTATCCTAG  587

seq1  TGGCTCTTCCTCCTAGTTTTGTTTTTTCCAGAGTTCCCCAGCCTGAAAAC  643
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCTCTTCCTCCTAGTTTTGTTTTTTCCAGAGTTCCCCAGCCTGAAAAC  637

seq1  GTCTTCTGCCAAGATTACCCTGCTCGAAGGGAATGTTTACATTGTGCTAG  693
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCTTCTGCCAAGATTACCCTGCTCGAAGGGAATGTTTACATTGTGCTAG  687

seq1  ATTAGTAAACACATTCCTAGCTTTTGCAGAATGCCCATTGGCAAGTAGTA  743
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGTAAACACATTCCTAGCTTTTGCAGAATGCCCATTGGCAAGTAGTA  737

seq1  TGCTAGGAATGTGTTGAAGAGATGAAGATAATATACTTTGTACTTACTTC  793
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTAGGAATGTGTTGAAGAGATGAAGATAATATACTTTGTACTTACTTC  787

seq1  ATATGTTTAAAATTAGGGATGCTGATTACAGAATTTTGAGCTGGAAGCCA  843
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATGTTTAAAATTAGGGATGCTGATTACAGAATTTTGAGCTGGAAGCCA  837

seq1  TCATTCAGGTTTTCAGCACCAACCTCCTTGTTATAATAATCAGAAGTCAT  893
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCATTCAGGTTTTCAGCACCAACCTCCTTGTTATAATAATCAGAAGTCAT  887

seq1  ACTGAGTTAAGAACCTATGGGGGACTTTTGGTATAGCATTGGAAATGTAA  943
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGAGTTAAGAACCTATGGGGGACTTTTGGTATAGCATTGGAAATGTAA  937

seq1  ATGAGCTAAATACCTAATAAAAAATGGGAAAAAAAATAAAAGGATAAAAT  993
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGCTAAATACCTAATAAAAAATGGGAAAAAAAATAAAAGGATAAAAT  987

seq1  GGAAAAAAAAAAAAAAAAAAAAAAGAACCCAGAGCCCTCAAACGGGTGAT  1043
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAAAAAAAAAAAAAAAAAAAAAGAACCCAGAGCCCTCAAACGGGTGAT  1037

seq1  GAAACAATCAGGCGAGGTGGGTGCTTTTGCTCTCTACAGTATGCATACAA  1093
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACAATCAGGCGAGGTGGGTGCTTTTGCTCTCTACAGTATGCATACAA  1087

seq1  GGAAATTTGATGCCACCAGTGTTAGGTAACCTTCTCAGGATCTCACAGCT  1143
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGAAATTTGATGCCACCAGTGTTAGGTAACCTTCTCAGGATCTCACAGCT  1137

seq1  AGAAAGTAGTAGAGCCAGAATTC  1166
      |||||||||||||||||||||||
seq2  AGAAAGTAGTAGAGCCAGAATTC  1160

seq1: chrX_5983345_5983894
seq2: B6Ng01-255O13.g_68_617

seq1  GAATTCACTACATCTTGTCCATTGTTCTCTCTCCTCCCCTCCCCTCTCCT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTACATCTTGTCCATTGTTCTCTCTCCTCCCCTCCCCTCTCCT  50

seq1  CTTCAAATTTCTGGTGCTCAAGATCAAACCTAGGGCAGTAGACAAGTGTT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAATTTCTGGTGCTCAAGATCAAACCTAGGGCAGTAGACAAGTGTT  100

seq1  CTACTACTGAGCTAAACGTCCCTATTCCTTGGGGCTCTCTTAAGTTATGG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTACTGAGCTAAACGTCCCTATTCCTTGGGGCTCTCTTAAGTTATGG  150

seq1  AGTCCATACACAATATAGCCATCTCCTGGAGGCAGTTATGAAAATTAAGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCATACACAATATAGCCATCTCCTGGAGGCAGTTATGAAAATTAAGT  200

seq1  GAGACCTTTTTTTTTGTGCTGAGAATTGTTATCTAGCTACAGACCATTCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGACCTTTTTTTTTGTGCTGAGAATTGTTATCTAGCTACAGACCATTCT  250

seq1  TTTAAAAACATATATCTGAAGGGGGCTGGCTCAGTAGTTAAAAGGGCTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAAAACATATATCTGAAGGGGGCTGGCTCAGTAGTTAAAAGGGCTTA  300

seq1  TAGCTCTTGCAGATGACCGTGGTTTGATTCCCATTATCCACATAGCAACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCTCTTGCAGATGACCGTGGTTTGATTCCCATTATCCACATAGCAACA  350

seq1  AATCCATATCACAGGTCCAGATCTGTTGCCCTTCTTTTGACCTCATCAGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCCATATCACAGGTCCAGATCTGTTGCCCTTCTTTTGACCTCATCAGG  400

seq1  CTCCTGTATATACATGTGTTCATGTGCATGCTCATACACACTCATGTGAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCCTGTATATACATGTGTTCATGTGCATGCTCATACACACTCATGTGAT  450

seq1  TTTTTTTGGTAGCAATGTCATAAGACACTGTCTCTGTGTCCTTTAAGTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTGGTAGCAATGTCATAAGACACTGTCTCTGTGTCCTTTAAGTAA  500

seq1  GCACTGAGGAAAGTCATATGATGAAGTGTGTGTGTGTGTGTGTGTGTGTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACTGAGGAAAGTCATATGATGAAGTGTGTGTGTGTGTGTGTGTGTGTG  550

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information