MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-257H05
Chromosome	X (Build37)
Map Location	138,189,279 - 138,190,499
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Mid2, LOC619612, Tex13, LOC632685, Vsig1, Psmd10, Atg4a, LOC100038961, Col4a6, Col4a5, Irs4
Downstream gene	LOC633596, EG666488, LOC622901, EG436234, EG622956, Gucy2f, LOC623006, LOC100039023, Nxt2, EG434858, Kcne1l, Acsl4, Ppia-psx_1100.1, EG633736, EG245651, LOC100039086, EG436235, Tmem164
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mid2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:23947 MGI:1344333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC619612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:619612
definition	note : eukaryotic translation initiation factor 2C, 2 pseudogene pseudo : _no_value

name	Tex13 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83555 MGI:1890544
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632685 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 192 ESTs, 2 Proteins pseudo : _no_value

name	Vsig1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78789 MGI:1926039
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Psmd10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53380 MGI:1858898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Atg4a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666468 MGI:2147903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 6 Proteins

name	LOC100038961 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 4 Proteins

name	Col4a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:94216 MGI:2152695
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Col4a5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12830 MGI:88456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Irs4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16370 MGI:1338009
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC633596 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:633596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 345 ESTs, 7 Proteins

name	EG666488 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666488 MGI:3646868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins pseudo : _no_value

name	LOC622901 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 22 Proteins pseudo : _no_value

name	EG436234 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436234 MGI:3647840
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG622956 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622956 MGI:3647018
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Gucy2f (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245650 MGI:105119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623006 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 659 ESTs, 8 Proteins pseudo : _no_value

name	LOC100039023 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins pseudo : _no_value

name	Nxt2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237082 MGI:2147914
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434858 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434858 MGI:3642955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Kcne1l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66240 MGI:1913490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Acsl4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50790 MGI:1354713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Ppia-psx_1100.1 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:606537
definition	note : peptidylprolyl isomerase A pseudogene x_1100.1 pseudo : _no_value

name	EG633736 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:633736 MGI:3646446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 5 Proteins

name	EG245651 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245651 MGI:3643395
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins

name	LOC100039086 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins

name	EG436235 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436235 MGI:3647841
definition	note : predicted gene, EG436235 pseudo : _no_value

name	Tmem164 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209497 MGI:2148020
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mid2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:134023660 GeneID:23947 MGI:1344333
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : midline 2 transcript_id : NM_011845.2

name	Tex13 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475713 GeneID:83555 MGI:1890544
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 13 transcript_id : NM_031381.2

name	Vsig1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142346492 GeneID:78789 MGI:1926039
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : V-set and immunoglobulin domain containing 1 transcript_id : NM_030181.2

name	Psmd10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254368 GeneID:53380 MGI:1858898
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteosome (prosome, macropain) 26S subunit, non-ATPase, 10 transcript_id : NM_016883.3

name	Atg4a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:74136554 GeneID:666468 MGI:2147903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 6 Proteins product : autophagy-related 4A (yeast) transcript_id : NM_174875.3

name	LOC100038961 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272403 GeneID:100038961
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 36 ESTs, 4 Proteins product : similar to autophagin-2 transcript_id : XM_001471981.1

name	Col4a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:16716478 GeneID:94216 MGI:2152695
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type IV, alpha 6 transcript_id : NM_053185.1

name	Col4a5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348194 GeneID:12830 MGI:88456
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : procollagen, type IV, alpha 5 transcript_id : NM_007736.3

name	Irs4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58331137 GeneID:16370 MGI:1338009
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : insulin receptor substrate 4 transcript_id : NM_010572.2

name	LOC633596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272406 GeneID:633596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 2 Proteins product : similar to high mobility group nucleosomal binding domain 2, transcript variant 2 transcript_id : XM_001472120.1

name	LOC633596 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272408 GeneID:633596
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 345 ESTs, 6 Proteins product : similar to high mobility group nucleosomal binding domain 2, transcript variant 1 transcript_id : XM_001472085.1

name	Gucy2f (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56119097 GeneID:245650 MGI:105119
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanylate cyclase 2f transcript_id : NM_001007576.1

name	Nxt2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142378725 GeneID:237082 MGI:2147914
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear transport factor 2-like export factor 2 transcript_id : NM_172782.2

name	Kcne1l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:10946897 GeneID:66240 MGI:1913490
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium voltage-gated channel, Isk-related family, member 1-like transcript_id : NM_021487.1

name	Acsl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992924 GeneID:50790 MGI:1354713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase long-chain family member 4 transcript_id : NM_001033600.1

name	Acsl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992926 GeneID:50790 MGI:1354713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase long-chain family member 4 transcript_id : NM_019477.3

name	Acsl4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:75992923 GeneID:50790 MGI:1354713
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : acyl-CoA synthetase long-chain family member 4 transcript_id : NM_207625.2

name	EG633736 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272417 GeneID:633736 MGI:3646446
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 18 ESTs, 5 Proteins product : predicted gene, EG633736 transcript_id : XM_001472450.1

name	EG245651 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408385 GeneID:245651 MGI:3643395
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : predicted gene, EG245651 transcript_id : XM_142195.5

name	LOC100039086 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272412 GeneID:100039086
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 5 Proteins product : similar to HL23 ribosomal protein transcript_id : XM_001472223.1

name	Tmem164 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:54633299 GeneID:209497 MGI:2148020
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 164 transcript_id : NM_177592.3

name	Mid2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754694 GeneID:23947 MGI:1344333
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : midline 2 protein_id : NP_035975.1

name	Tex13 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878205 GeneID:83555 MGI:1890544
definition	codon_start : 1 product : testis expressed gene 13 protein_id : NP_113558.1

name	Vsig1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313488 CCDS:CCDS30443.1 GeneID:78789 MGI:1926039
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycoprotein A34 product : V-set and immunoglobulin domain containing 1 protein_id : NP_084457.1

name	Psmd10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980811 CCDS:CCDS30444.1 GeneID:53380 MGI:1858898
definition	GO_component : GO:0005829 - cytosol [Evidence IEA]; GO:0043234 - protein complex [Evidence IEA] codon_start : 1 note : gankyrin; proteosome subunit p28; proteasome (prosome, macropain) 26S subunit, non-ATPase, 10 product : proteosome (prosome, macropain) 26S subunit, non-ATPase, 10 protein_id : NP_058579.2

name	Atg4a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:74136555 GeneID:666468 MGI:2147903
definition	EC_number : 3.4.22.- codon_start : 1 exception : unclassified translation discrepancy note : autophagy-related cysteine endopeptidase 2; autophagy 4 homolog A; cysteine protease APG4A; autophagin 2; AUT-like 2, cysteine endopeptidase; APG4 (ATG4) autophagy-related homolog A product : autophagy-related 4A-like protein_id : NP_777364.3

name	LOC100038961 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272404 GeneID:100038961
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472031.1

name	Col4a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:16716479 GeneID:94216 MGI:2152695
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005581 - collagen [Evidence IEA]; GO:0005587 - collagen type IV [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IDA] GO_process : GO:0030198 - extracellular matrix organization and biogenesis [Evidence IDA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : procollagen, type IV, alpha 6 protein_id : NP_444415.1

name	Col4a5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677420 GeneID:12830 MGI:88456
definition	GO_component : GO:0005604 - basement membrane [Evidence IDA]; GO:0005581 - collagen [Evidence IEA]; GO:0005587 - collagen type IV [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0030020 - extracellular matrix structural constituent conferring tensile strength [Evidence IEA] GO_process : GO:0007155 - cell adhesion [Evidence IEA]; GO:0006817 - phosphate transport [Evidence IEA] codon_start : 1 note : collagen type IV alpha5 chain; procollagen type IV alpha 5 product : procollagen, type IV, alpha 5 protein_id : NP_031762.2

name	Irs4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58331138 CCDS:CCDS30445.1 GeneID:16370 MGI:1338009
definition	GO_function : GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : insulin receptor substrate 4 protein_id : NP_034702.2

name	LOC633596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272407 GeneID:633596
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001472170.1

name	LOC633596 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272409 GeneID:633596
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472135.1

name	Gucy2f (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56119098 CCDS:CCDS30446.1 GeneID:245650 MGI:105119
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004383 - guanylate cyclase activity [Evidence ISS]; GO:0016849 - phosphorus-oxygen lyase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IEA] GO_process : GO:0009190 - cyclic nucleotide biosynthesis [Evidence IEA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence IEA] codon_start : 1 product : guanylate cyclase 2f protein_id : NP_001007577.1

name	Nxt2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370162 GeneID:237082 MGI:2147914
definition	GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation product : nuclear transport factor 2-like export factor 2 protein_id : NP_766370.1

name	Kcne1l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946898 CCDS:CCDS30447.1 GeneID:66240 MGI:1913490
definition	GO_component : GO:0016020 - membrane [Evidence IEA] codon_start : 1 note : minK-like protein product : potassium voltage-gated channel, Isk-related family, member 1-like protein_id : NP_067462.1

name	Acsl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46518528 CCDS:CCDS30448.1 GeneID:50790 MGI:1354713
definition	EC_number : 6.2.1.3 GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence IEA] [Evidence ISS]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0019217 - regulation of fatty acid metabolism [Evidence TAS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; fatty acid-Coenzyme A ligase, long chain 4 product : acyl-CoA synthetase long-chain family member 4 isoform 1 protein_id : NP_997508.1

name	Acsl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75992925 GeneID:50790 MGI:1354713
definition	EC_number : 6.2.1.3 GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence IEA] [Evidence ISS]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0019217 - regulation of fatty acid metabolism [Evidence TAS] codon_start : 1 note : isoform 2 is encoded by transcript variant 3; fatty acid-Coenzyme A ligase, long chain 4 product : acyl-CoA synthetase long-chain family member 4 isoform 2 protein_id : NP_001028772.1

name	Acsl4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75992927 GeneID:50790 MGI:1354713
definition	EC_number : 6.2.1.3 GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005777 - peroxisome [Evidence IEA] GO_function : GO:0003824 - catalytic activity [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004467 - long-chain-fatty-acid-CoA ligase activity [Evidence IEA] [Evidence ISS]; GO:0000287 - magnesium ion binding [Evidence IEA] GO_process : GO:0006631 - fatty acid metabolism [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA]; GO:0019217 - regulation of fatty acid metabolism [Evidence TAS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; fatty acid-Coenzyme A ligase, long chain 4 product : acyl-CoA synthetase long-chain family member 4 isoform 2 protein_id : NP_062350.3

name	EG633736 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272418 GeneID:633736 MGI:3646446
definition	codon_start : 1 product : similar to 60S ribosomal protein L38 protein_id : XP_001472500.1

name	EG245651 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086823 GeneID:245651 MGI:3643395
definition	codon_start : 1 product : similar to Coiled-coil-helix-coiled-coil-helix domain containing 2 protein_id : XP_142195.3

name	LOC100039086 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272413 GeneID:100039086
definition	codon_start : 1 product : similar to HL23 ribosomal protein protein_id : XP_001472273.1

name	Tmem164 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:54633300 CCDS:CCDS30451.1 GeneID:209497 MGI:2148020
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] codon_start : 1 product : hypothetical protein LOC209497 protein_id : NP_808260.2

name	EG436234 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436234
definition	number : 1 pseudo : _no_value

name	EG622956 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:622956
definition	number : 1 pseudo : _no_value

name	LOC632685 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272291 GeneID:632685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 192 ESTs, 2 Proteins product : similar to ribosomal protein S7 pseudo : _no_value transcript_id : XR_032787.1

name	EG666488 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272405 GeneID:666488 MGI:3646868
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 4 Proteins product : predicted gene, EG666488 pseudo : _no_value transcript_id : XR_035647.1

name	LOC622901 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272411 GeneID:622901
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 22 Proteins product : similar to heat shock protein 1, beta pseudo : _no_value transcript_id : XR_030584.1

name	LOC623006 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272414 GeneID:623006
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 659 ESTs, 8 Proteins product : similar to retinoblastoma-binding protein mRbAp46 pseudo : _no_value transcript_id : XR_030613.1

name	LOC100039023 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272410 GeneID:100039023
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 4 Proteins product : similar to 60S ribosomal protein pseudo : _no_value transcript_id : XR_030569.1

name	EG434858 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:85060509 GeneID:434858 MGI:3642955
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434858 pseudo : _no_value transcript_id : NR_002883.1

clone name	MSMg01-327L11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-470C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-265O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153B19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-388N19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460M09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-266I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260C05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-107J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-387B20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-495J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-146E22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-341P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-355E05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-306H20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321O24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529K22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-173L21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117L06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-271M03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117P22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-072B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-499I10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-333O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-378K11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-064P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-067A06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-465A02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497D22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160B24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-045F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-333C14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-323C08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-308C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011K07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-105P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089F24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-299E04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-314M08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-335O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-158B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146A18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150K18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-244C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-252G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-234I11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-350N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257H05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182F03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142O14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247H06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158B21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-058G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-023C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-242E07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200C11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184E02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224M04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-122N14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-016B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-349P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-068P12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-041L07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042N24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186C08
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-257H05.b	B6Ng01-257H05.g
ACC	GA063147	GA063148
length	1,208	1,214
definition	B6Ng01-257H05.b	B6Ng01-257H05.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggccaatacctaaacatgataaaagcaatctacagcaaacca gtagccaacatcaaagtaaatggagagaagctggaagcaatcccactaaa atcagggactagacaaggctgcccactttctccctaccttttcaacatag tacttgaagtattagccagagcaattcgacaacaaaaggagatcaagggg atacaaattggaaaagaggaagtcaaaatatcactttttgcagatgatat gatagtatatataagtgaccctaaaaattccaacagagaactcctaaacc tgataaacagcttcggtgaagtagctggatataaaattaactcaaacaag tcaatggcctttctctacacaaagaataaacaggctgagaaagaaattag ggaaacaacacccttctcaatagccacaaataatataaaatatctcggcg tgactctaacgaaggaagtgaaagatctgtatgataaaaacttcaagtcc ctgaagaaagaaattaaagaagatctcagaagatggaaagatctcccatg ctcatggattggcaggaccaacattataaaaatggctatcttgccaaaag caatctacagattcaatgcaatccccattaaaattccaactcaattcttc aacgaattagaaggagcaatttgcaaattcatctggaataacaaaaaacc gaggatagcaaaaactcttctcaaggataaaagaacctctggtggaatca ccatgcctgacctaaagctttactacagagcaattgtgataaaaactgca tggtactggtatagagacagacaagtggaccaatggaatagaattgaaga cccagaaatgaacccacacacctatggtcacttgatcttcgacaagggag ccaaaaccatccagtggaagaaagacagcattttcaacaattggtgctgg cacaactgggttgttatcatgtagaagaatgcgaatcgatccatacttat ctccttgtactaagtcaaatctagtggatcagacttcacataaaccagag acactgaaactatagaggagaaagtggggaaagcttgagattgggcacag ggaaaattcctgaacagaacagccattgcctggtactgtaatccgagatt gacattgacctatgaactcaaggtttctgcaggcaaagaaccactggttc ttttagga	gaattccaggatatccagggctgttacgcagagaaaccttgtcccagaaa aaacaaaaacaaacaaacaaacaaaacaaaaaataaaacaaaaatagcac aaaacaataaaataaaaactgaagtgaacacattataaattgtacggtag gcctatgagtagctataataaatactttcaatgttttcaaagtgaccata tatttttacctctcccaaatgtgttctaaggaagttactggtctttcata tctttctcaacaattattactgtcaatatctttaattagatccaatccac tgggtgctttctcatacttggattaatgtatacttcactgagtctaccag ttgataagaacctcttctccatatactgatgaaatttcttttgtaaaact ctcttcatccagccttggtgactctggctggcatgtgcttaccagggagg ctgaagaaggaatattacattaaattcattgcctacttgggctatatttt tttatagacagactgatcaatttcgtgaggtctagcctcaaaaatcaaga ctaaagaggggcttggaatatagttcagtagcagatcactaacatatgca agaaccttagttcaatccccaagtgtcacaaaaagccattcttcaattta tgtgttttatttttatttttgttactaacctgaaggttttctttgtatat ttgatatacatatatacattgcacatatatacattgtatatatatatata tatatatcacatatatacattgcagctatacttcacattcttatcgcttg ctttataatcaatgacttattttttagaatagccttattgagaaataatt catttccatcacaatttgaaaataacatttaatatctttttaaagtttag tatcattactataaatttcatcatcacagagaaaagaaaacctttcccac tagcaaatacttccattatctcctaatgcttactaatctccttcctgtct ctataatttgcctgttgtgataattttatataaatacaatcataccaaat tcaatcttctgactctgtttcttcacttacaataaacaagacttattcat gttacgaagttgtcagtattcatactattatgactgactaatattctttg ggttaacaattcacgttgatgtccaattctcatgaatcatgtttccctct atattagtctctag
quality values	Open. Hide. 62 31 22 38 62 37 21 32 62 62 62 41 30 62 62 62 62 62 62 62 62 62 59 46 59 62 59 62 62 62 62 62 49 59 43 32 43 56 33 45 51 59 62 59 62 62 62 62 54 59 62 62 62 54 62 59 62 62 62 62 62 54 62 62 54 62 62 62 62 62 54 62 54 54 54 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 62 62 59 59 59 62 62 62 59 62 62 62 62 62 62 54 54 62 62 62 56 54 49 49 54 49 42 62 62 62 59 62 62 62 62 62 62 62 62 59 56 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 54 54 62 62 62 62 59 62 62 54 54 62 54 62 62 62 62 62 62 59 59 62 43 49 48 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 54 58 41 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 36 45 58 58 49 52 58 58 58 54 42 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 54 58 58 58 58 58 58 45 40 58 58 58 58 58 58 58 54 58 58 58 58 53 58 58 53 58 58 46 58 58 58 58 49 53 58 58 58 58 53 53 58 51 54 58 58 49 51 58 52 47 41 58 58 58 53 46 58 54 58 54 53 58 58 52 58 58 51 58 51 51 58 51 45 58 49 47 58 54 37 51 50 50 54 58 58 58 52 51 58 50 51 54 52 41 58 51 58 58 51 49 52 42 41 47 52 50 58 58 58 58 46 32 58 51 53 26 54 32 27 51 50 49 35 17 36 49 54 53 54 53 39 44 49 42 49 28 49 52 54 39 29 42 54 54 54 37 51 37 40 54 53 54 37 54 54 40 54 41 40 40 38 53 37 42 52 37 47 51 49 47 41 51 37 28 46 28 28 54 41 40 45 53 54 45 32 42 40 42 53 35 32 46 26 53 32 34 33 53 52 40 40 39 32 35 52 49 51 52 40 34 52 36 39 36 42 52 28 31 34 32 46 45 31 43 42 36 38 51 45 30 30 30 45 37 31 31 46 31 30 45 33 29 21 41 33 30 32 45 42 43 39 43 36 33 42 25 24 46 32 32 36 30 31 13 48 31 21 31 46 47 26 31 32 31 32 31 48 43 24 42 32 42 31 21 26 31 31 30 27 44 31 37 24 31 30 37 30 22 31 31 31 39 31 24 32 22 22 10 24 47 19 29 19 41 37 24 46 41 31 26 29 23 30 31 42 32 31 25 44 26 27 27 11 29 44 25 16 21 18 25 29 30 29 31 44 48 32 35 21 21 36 29 23 26 29 25 31 21 31 32 38 28 31 24 24 34 14 13 32 17 13 43 10 28 12 20 22 23 19 31 32 27 27 28 14 22 21 34 31 21 31 34 18 29 18 15 30 21 23 29 21 28 34 19 24 13 25 32 23 33 16 14 18 18 17 9 24 13 11 26 8 16 28 19 10 3 3 5 28 27 40 21 22 23 13 18 13 16 24 18 10 26 9 3 5 3 5 9 21 16 7 15 16 20 9 19 10 4 18 17 15 14 7 7 10 10 28 24 13 15 34 14 11 27 7 7 5 13 23 6 14 8 8 10 30 20 12 5 18 24 17 7 3 18 13 5 9 3 8 6 11 3 9 5 4 7 25 17 8 4 13 4 4 3 9 9 20 28 16 7 13 7 14 8 8 15 7 8 5 12 16 14 7 4 12 9 5 25 5 8 14 6 5 19 4 10 9 16 20 6 13 6 3 3 4 7 8 5 10 4 3 2 2 4 2 2 3 1 3 3 2 2 5 7 3 1 6 16 17 4 5 10 4 8 5 4 17 9 10 4 4 6 16 21 17 12 8 7 17 8 7 5 9 4 4 4 14 4 6 4 5 5 5 6 11 16 5 6 3 1 2	Open. Hide. 62 47 51 47 62 62 47 43 62 62 59 44 59 59 62 59 43 48 37 54 59 62 62 62 59 62 59 62 62 62 62 59 59 59 62 62 59 62 62 62 62 59 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 58 58 52 48 58 54 54 58 58 58 58 58 54 58 58 58 54 46 58 58 58 58 54 54 58 58 58 58 48 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 52 54 51 58 58 58 58 49 58 58 58 58 54 58 58 54 58 52 58 58 52 58 54 58 54 54 54 54 58 58 58 51 58 54 58 48 54 54 58 51 58 49 58 51 51 49 51 54 51 58 58 43 50 58 58 58 58 52 51 48 50 52 58 58 58 58 50 49 51 50 51 58 58 49 51 49 46 58 54 58 35 47 49 46 45 58 50 58 58 50 53 39 58 58 58 53 53 41 58 58 58 58 39 32 41 46 49 42 54 49 50 58 49 51 44 49 24 39 15 58 58 51 51 39 58 58 53 41 53 52 53 41 58 58 41 53 34 50 53 42 53 43 53 53 52 51 51 53 53 37 58 41 54 41 42 42 34 52 53 53 53 53 45 52 35 54 28 51 44 50 52 54 49 54 41 54 52 53 53 54 45 51 50 51 51 53 53 42 53 52 45 53 53 52 47 49 49 52 39 51 15 35 32 47 31 39 34 53 52 40 42 24 45 40 53 40 39 42 32 52 54 46 39 32 37 40 32 32 32 40 23 40 32 43 53 45 34 31 40 52 31 34 16 40 32 53 33 20 52 13 33 34 53 53 53 52 52 52 24 39 33 27 29 23 27 25 23 31 29 30 46 28 30 32 42 51 31 29 34 31 21 31 31 28 30 46 26 25 19 17 35 39 29 30 24 30 32 47 31 22 21 48 48 35 28 29 27 30 29 31 47 12 24 32 32 30 31 36 26 48 48 46 33 26 46 31 35 34 48 25 37 32 31 30 31 32 30 31 32 25 32 33 31 31 25 48 32 32 47 33 33 33 32 43 23 22 25 21 31 35 20 31 12 36 47 46 29 13 31 46 46 25 16 21 32 48 32 24 36 13 9 16 20 34 24 18 26 48 38 22 31 31 15 24 8 31 26 30 20 36 24 32 24 18 30 17 24 33 16 42 28 19 23 22 16 20 26 26 17 34 23 27 30 16 11 19 30 22 33 11 20 12 21 15 17 34 14 19 11 43 18 30 22 29 19 34 7 12 29 7 19 32 6 9 25 25 39 43 6 12 7 12 5 23 38 22 16 25 16 9 27 19 19 12 13 17 9 18 7 21 20 5 19 6 5 21 10 7 6 9 12 15 20 28 19 20 13 7 3 3 18 12 16 15 23 4 6 7 9 21 20 24 28 7 13 20 47 14 9 7 29 12 11 5 3 7 8 18 17 13 16 9 21 16 23 10 6 3 6 19 4 13 4 15 10 23 16 13 8 15 25 24 16 15 24 9 6 8 9 8 23 19 16 11 9 5 10 15 22 8 13 10 7 4 4 4 4 3 4 26 21 4 12 24 5 5 16 7 8 4 4 4 5 4 6 3 1 2 3 3 2 1 3 8 5 6 14 11 10 9 13 5 7 20 9 10 22 17 3 3 10 6 14 5 18 4 18 20 14 4 4 4 5 5 8 10 11 2 2 3 2 7 6 8 13 6

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_138189279_138190499
seq2: B6Ng01-257H05.g_65_1278

seq1  GAATTCCAGGATATCCAGGGCTGTTACGCAGAGAAACCTTGTCCCAGAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGATATCCAGGGCTGTTACGCAGAGAAACCTTGTCCCAGAAA  50

seq1  AAACAAAAACAAACAAACAAACAAAACAAAAAATAAAACAAAAATAGCAC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACAAAAACAAACAAACAAACAAAACAAAAAATAAAACAAAAATAGCAC  100

seq1  AAAACAATAAAATAAAAACTGAAGTGAACACATTATAAATTGTACGGTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAATAAAATAAAAACTGAAGTGAACACATTATAAATTGTACGGTAG  150

seq1  GCCTATGAGTAGCTATAATAAATACTTTCAATGTTTTCAAAGTGACCATA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTATGAGTAGCTATAATAAATACTTTCAATGTTTTCAAAGTGACCATA  200

seq1  TATTTTTACCTCTCCCAAATGTGTTCTAAGGAAGTTACTGGTCTTTCATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATTTTTACCTCTCCCAAATGTGTTCTAAGGAAGTTACTGGTCTTTCATA  250

seq1  TCTTTCTCAACAATTATTACTGTCAATATCTTTAATTAGATCCAATCCAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTCAACAATTATTACTGTCAATATCTTTAATTAGATCCAATCCAC  300

seq1  TGGGTGCTTTCTCATACTTGGATTAATGTATACTTCACTGAGTCTACCAG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGTGCTTTCTCATACTTGGATTAATGTATACTTCACTGAGTCTACCAG  350

seq1  TTGATAAGAACCTCTTCTCCATATACTGATGAAATTTCTTTTGTAAAACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATAAGAACCTCTTCTCCATATACTGATGAAATTTCTTTTGTAAAACT  400

seq1  CTCTTCATCCAGCCTTGGTGACTCTGGCTGGCATGTGCTTACCAGGGAGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTCATCCAGCCTTGGTGACTCTGGCTGGCATGTGCTTACCAGGGAGG  450

seq1  CTGAAGAAGGAATATTACATTAAATTCATTGCCTACTTGGGCTATATTTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAAGAAGGAATATTACATTAAATTCATTGCCTACTTGGGCTATATTTT  500

seq1  TTTATAGACAGACTGATCAATTTCGTGAGGTCTAGCCTCAAAAATCAAGA  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATAGACAGACTGATCAATTTCGTGAGGTCTAGCCTCAAAAATCAAGA  550

seq1  CTAAAGAGGGGCTTGGAATATAGTTCAGTAGCAGATCACTAACATATGCA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAAGAGGGGCTTGGAATATAGTTCAGTAGCAGATCACTAACATATGCA  600

seq1  AGAACCTTAGTTCAATCCCCAAGTGTCACAAAAAGCCATTCTTCAATTTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAACCTTAGTTCAATCCCCAAGTGTCACAAAAAGCCATTCTTCAATTTA  650

seq1  TGTGTTTTATTTTTATTTTTGTTACTAACCTGAAGGTTTTCTTTGTATAT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTGTTTTATTTTTATTTTTGTTACTAACCTGAAGGTTTTCTTTGTATAT  700

seq1  TTGATATACATATATACATTGCACATATATACATTGTATATATATATATA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGATATACATATATACATTGCACATATATACATTGTATATATATATATA  750

seq1  TATATATCACATATATACATTGCAGCTATACTTCACATTCTTATCGCTTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATATATCACATATATACATTGCAGCTATACTTCACATTCTTATCGCTTG  800

seq1  CTTTATAATCAATGACTTATTTTTTAGAATAGCCTTATTGAGAAATAATT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTATAATCAATGACTTATTTTTTAGAATAGCCTTATTGAGAAATAATT  850

seq1  CATTTCCATCACAATTTGAAAATAACATTTAATATCTTTTTAAAGTTTAG  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTCCATCACAATTTGAAAATAACATTTAATATCTTTTTAAAGTTTAG  900

seq1  TATCATTACTATAAATTTCATCATCACAGAGAAAAGAAAACCTTTCCCAC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCATTACTATAAATTTCATCATCACAGAGAAAAGAAAACCTTTCCCAC  950

seq1  TAGCAAATACTTCCATTATCTCCTAATGCTTACTAATCTCCTTCCTGTCT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGCAAATACTTCCATTATCTCCTAATGCTTACTAATCTCCTTCCTGTCT  1000

seq1  CTATTAATTTGCCTGTTGTGATAATTTTATATAAATACAATCATACCAAA  1050
      ||| ||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTA-TAATTTGCCTGTTGTGATAATTTTATATAAATACAATCATACCAAA  1049

seq1  TTCAATCTTCTGACTCTGGTTTCTTTCACTTACAATAAACAAGACCTATT  1100
      ||||||||||||||||| ||||| ||||||||||||||||||||| ||||
seq2  TTCAATCTTCTGACTCT-GTTTC-TTCACTTACAATAAACAAGACTTATT  1097

seq1  CATGTTACAGAGTTTGTCAGTATTTCATTACTTATTATGACTGACTAATA  1150
      |||||||| ||  ||||||||| |||| ||| ||||||||||||||||||
seq2  CATGTTAC-GAAGTTGTCAGTA-TTCA-TAC-TATTATGACTGACTAATA  1143

seq1  TTCCTTTGGGTAAACATATCACTTTGGAATGTC--AATCTCATGAAATCA  1198
      || |||||||| ||||  |||| |||  |||||  | ||||||| |||||
seq2  TT-CTTTGGGTTAACAATTCACGTTG--ATGTCCAATTCTCATG-AATCA  1189

seq1  TGTTT-CCTCTAT-TTAGTTTCTAG  1221
      ||||| ||||||| ||||| |||||
seq2  TGTTTCCCTCTATATTAGTCTCTAG  1214

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information