MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-260I03
Chromosome	X (Build37)
Map Location	98,555,871 - 98,765,265
singlet/doublet	doublet
Overlap gene	LOC100042407, Gjb1, Zmym3, Nono, Itgb1bp2, LOC620837, Taf1
Upstream gene	Eda, Dgat2l4, Otud6a, Igbp1, LOC668257, Dgat2l3, LOC620734, P2ry4, Arr3, Pdzd11, Kif4, Gdpd2, Dlg3, Tex11, LOC668271, LOC100042392, Slc7a3, Snx12, Mllt7, Gm614, Il2rg, Med12, Nlgn3
Downstream gene	Ogt, LOC620865, LOC668291, Cxcr3, LOC632454, LOC668302, EG212753, 8030474K03Rik, LOC668308, LOC100042465, H3f3a-ps1, EG621083, Rgag4, LOC100042480, LOC331476, Pin4, LOC670921, Ercc6l, LOC668318, Rps4x, LOC100043080, Cited1, Hdac8, Phka1
Link	Open Mouse BAC browser

Click to get alignment info.

name	Eda (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13607 MGI:1195272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dgat2l4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245532 MGI:3045345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Otud6a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:408193 MGI:3644685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins

name	Igbp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18518 MGI:1346500
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668257 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins

name	Dgat2l3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245533 MGI:3588200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620734 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620734
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	P2ry4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:57385 MGI:1926594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170735 MGI:2159617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pdzd11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72621 MGI:1919871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kif4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16571 MGI:108389
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gdpd2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71584 MGI:1918834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Dlg3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53310 MGI:1888986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tex11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83558 MGI:1933237
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668271 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 3 Proteins pseudo : _no_value

name	LOC100042392 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042392
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Slc7a3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11989 MGI:1100521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snx12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:55988 MGI:1919331
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mllt7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54601 MGI:1891915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm614 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245536 MGI:2685460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il2rg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16186 MGI:96551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Med12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59024 MGI:1926212
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nlgn3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245537 MGI:2444609
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042407 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Gjb1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14618 MGI:95719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zmym3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56364 MGI:1927231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nono (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:53610 MGI:1855692
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Itgb1bp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:26549 MGI:1353420
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	Taf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270627 MGI:1336878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ogt (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:108155 MGI:1339639
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC620865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:620865
definition	note : RNA binding protein pseudogene pseudo : _no_value

name	LOC668291 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668291
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Cxcr3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12766 MGI:1277207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC632454 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:632454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1509 ESTs, 7 Proteins pseudo : _no_value

name	LOC668302 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins pseudo : _no_value

name	EG212753 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:212753 MGI:3646776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs

name	8030474K03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382231 MGI:2685988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs

name	LOC668308 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins pseudo : _no_value

name	LOC100042465 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	H3f3a-ps1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15079 MGI:1101782
definition	note : H3 histone, family 3A, pseudogene 1 pseudo : _no_value

name	EG621083 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621083 MGI:3645090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST

name	Rgag4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331474 MGI:3045324
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042480 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs

name	LOC331476 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:331476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins

name	Pin4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69713 MGI:1916963
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC670921 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein pseudo : _no_value

name	Ercc6l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236930 MGI:2654144
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC668318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins pseudo : _no_value

name	Rps4x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20102 MGI:98158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043080 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins pseudo : _no_value

name	Cited1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12705 MGI:108023
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hdac8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70315 MGI:1917565
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Phka1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18679 MGI:97576
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Eda (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133893370 GeneID:13607 MGI:1195272
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ectodysplasin-A transcript_id : NM_010099.2

name	Dgat2l4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50355955 GeneID:245532 MGI:3045345
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 2-like 4 transcript_id : NM_177746.3

name	Otud6a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51772234 GeneID:408193 MGI:3644685
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 4 Proteins product : OTU domain containing 6A transcript_id : XM_486733.1

name	Igbp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51479180 GeneID:18518 MGI:1346500
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin (CD79A) binding protein 1 transcript_id : NM_008784.2

name	LOC668257 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94407683 GeneID:668257
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins product : similar to diacylglycerol O-acyltransferase 2-like 6 (Dgat2l6) transcript_id : XM_001000486.1

name	Dgat2l3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487272 GeneID:245533 MGI:3588200
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : diacylglycerol O-acyltransferase 2-like 3 transcript_id : NM_001081136.1

name	P2ry4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801981 GeneID:57385 MGI:1926594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : pyrimidinergic receptor P2Y, G-protein coupled, 4 transcript_id : NM_020621.3

name	Arr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131025 GeneID:170735 MGI:2159617
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : arrestin 3, retinal transcript_id : NM_133205.2

name	Pdzd11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348947 GeneID:72621 MGI:1919871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PDZ domain containing 11 transcript_id : NM_028303.2

name	Kif4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680567 GeneID:16571 MGI:108389
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : kinesin family member 4 transcript_id : NM_008446.1

name	Gdpd2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980660 GeneID:71584 MGI:1918834
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerophosphodiester phosphodiesterase domain containing 2 transcript_id : NM_023608.2

name	Dlg3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131177 GeneID:53310 MGI:1888986
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : discs, large homolog 3 (Drosophila) transcript_id : NM_016747.2

name	Tex11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878210 GeneID:83558 MGI:1933237
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : testis expressed gene 11 transcript_id : NM_031384.1

name	Slc7a3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131076 GeneID:11989 MGI:1100521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 transcript_id : NM_007515.2

name	Snx12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9256639 GeneID:55988 MGI:1919331
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : sorting nexin 12 transcript_id : NM_018875.1

name	Mllt7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9055157 GeneID:54601 MGI:1891915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : myeloid/lymphoid or mixed lineage-leukemia translocation to 7 homolog (Drosophila) transcript_id : NM_018789.1

name	Gm614 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370864 GeneID:245536 MGI:2685460
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 614, (NCBI) transcript_id : NM_001033362.2

name	Il2rg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129799 GeneID:16186 MGI:96551
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 2 receptor, gamma chain transcript_id : NM_013563.3

name	Med12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125628661 GeneID:59024 MGI:1926212
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mediator of RNA polymerase II transcription, subunit 12 homolog (yeast) transcript_id : NM_021521.2

name	Nlgn3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142384121 GeneID:245537 MGI:2444609
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : neuroligin 3 transcript_id : NM_172932.2

name	LOC100042407 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271799 GeneID:100042407
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : hypothetical protein LOC100042407 transcript_id : XM_001478124.1

name	Gjb1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22165405 GeneID:14618 MGI:95719
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gap junction membrane channel protein beta 1 transcript_id : NM_008124.2

name	Zmym3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130614 GeneID:56364 MGI:1927231
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, MYM-type 3 transcript_id : NM_019831.2

name	Nono (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963530 GeneID:53610 MGI:1855692
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : non-POU-domain-containing, octamer binding protein transcript_id : NM_023144.1

name	Itgb1bp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842407 GeneID:26549 MGI:1353420
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : integrin beta 1 binding protein 2 transcript_id : NM_013712.2

name	Taf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124486595 GeneID:270627 MGI:1336878
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_001081008.1

name	Ogt (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46909606 GeneID:108155 MGI:1339639
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase) transcript_id : NM_139144.2

name	Cxcr3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118129823 GeneID:12766 MGI:1277207
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : chemokine (C-X-C motif) receptor 3 transcript_id : NM_009910.2

name	EG212753 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407689 GeneID:212753 MGI:3646776
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs product : predicted gene, EG212753 transcript_id : XM_136015.7

name	8030474K03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271836 GeneID:382231 MGI:2685988
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 8 ESTs product : RIKEN cDNA 8030474K03 gene transcript_id : XM_001000772.2

name	LOC100042465 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271805 GeneID:100042465
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100042465 transcript_id : XM_001478268.1

name	EG621083 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407693 GeneID:621083 MGI:3645090
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST product : predicted gene, EG621083 transcript_id : XM_896183.2

name	Rgag4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142387815 GeneID:331474 MGI:3045324
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : retrotransposon gag domain containing 4 transcript_id : NM_183318.2

name	LOC100042480 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271807 GeneID:100042480
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs product : similar to novel similar to human Nance-Horan syndrome protein (RP11-262D11.5) transcript_id : XM_001478287.1

name	LOC331476 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271809 GeneID:331476
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to SUMO-1-specific protease transcript_id : XM_001478302.1

name	Pin4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:113931155 GeneID:69713 MGI:1916963
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) transcript_id : NM_027181.1

name	Ercc6l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27414500 GeneID:236930 MGI:2654144
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : excision repair cross-complementing rodent repair deficiency complementation group 6 - like transcript_id : NM_146235.2

name	Rps4x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6677804 GeneID:20102 MGI:98158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein S4, X-linked transcript_id : NM_009094.1

name	Cited1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:42476051 GeneID:12705 MGI:108023
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 transcript_id : NM_007709.3

name	Hdac8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141801693 GeneID:70315 MGI:1917565
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : histone deacetylase 8 transcript_id : NM_027382.2

name	Phka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142355008 GeneID:18679 MGI:97576
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 1 transcript_id : NM_173021.2

name	Phka1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679300 GeneID:18679 MGI:97576
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : phosphorylase kinase alpha 1 transcript_id : NM_008832.1

name	Eda (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753712 CCDS:CCDS30299.1 GeneID:13607 MGI:1195272
definition	GO_component : GO:0045177 - apical part of cell [Evidence IDA]; GO:0005737 - cytoplasm [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0005887 - integral to plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007160 - cell-matrix adhesion [Evidence IDA]; GO:0007275 - development [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0042475 - odontogenesis (sensu Vertebrata) [Evidence IMP]; GO:0006817 - phosphate transport [Evidence IEA]; GO:0043473 - pigmentation [Evidence IMP]; GO:0042346 - positive regulation of NF-kappaB import into nucleus [Evidence IDA]; GO:0007431 - salivary gland development [Evidence IDA] codon_start : 1 product : ectodysplasin-A protein_id : NP_034229.1

name	Dgat2l4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50355956 CCDS:CCDS30300.1 GeneID:245532 MGI:3045345
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IEA]; GO:0005789 - endoplasmic reticulum membrane [Evidence IDA]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0008415 - acyltransferase activity [Evidence IEA]; GO:0047196 - long-chain-alcohol O-fatty-acyltransferase activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0008610 - lipid biosynthesis [Evidence IEA]; GO:0006629 - lipid metabolism [Evidence IEA]; GO:0010025 - wax biosynthesis [Evidence IDA] codon_start : 1 product : wax synthase protein_id : NP_808414.2

name	Otud6a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772235 GeneID:408193 MGI:3644685
definition	codon_start : 1 product : Hin-6 protease protein_id : XP_486733.1

name	Igbp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51479181 CCDS:CCDS30302.1 GeneID:18518 MGI:1346500
definition	GO_process : GO:0042113 - B cell activation [Evidence IEA]; GO:0009966 - regulation of signal transduction [Evidence IEA]; GO:0009607 - response to biotic stimulus [Evidence IEA] codon_start : 1 exception : mismatches in translation note : phosphoprotein, component, 52 kDa; alpha 4 product : immunoglobulin (CD79A) binding protein 1 protein_id : NP_032810.2

name	LOC668257 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407684 GeneID:668257
definition	codon_start : 1 product : similar to diacylglycerol O-acyltransferase 2-like 6 (Dgat2l6) protein_id : XP_001000486.1

name	Dgat2l3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487273 GeneID:245533 MGI:3588200
definition	codon_start : 1 product : diacylglycerol O-acyltransferase 2-like 3 protein_id : NP_001074605.1

name	P2ry4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10181172 CCDS:CCDS30303.1 GeneID:57385 MGI:1926594
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0019103 - pyrimidine nucleotide binding [Evidence IC]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA]; GO:0045030 - UTP-activated nucleotide receptor activity [Evidence IDA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0030321 - transepithelial chloride transport [Evidence IDA] codon_start : 1 note : P2Y4 receptor; pyrimidinergic receptor P2Y, G-protein coupled, 4 (P2ry4) product : purinergic receptor P2Y, G-protein coupled, 4 protein_id : NP_065646.1

name	Arr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875352 GeneID:170735 MGI:2159617
definition	GO_component : GO:0001750 - photoreceptor outer segment [Evidence IDA]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0002046 - opsin binding [Evidence IDA]; GO:0051219 - phosphoprotein binding [Evidence IDA] GO_process : GO:0006897 - endocytosis [Evidence IDA]; GO:0001932 - regulation of protein amino acid phosphorylation [Evidence IDA] [Evidence IGI]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007600 - sensory perception [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA]; GO:0007601 - visual perception [Evidence IEA] codon_start : 1 note : retinal cone arrestin 3 product : arrestin 3, retinal protein_id : NP_573468.1

name	Pdzd11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312244 CCDS:CCDS30304.1 GeneID:72621 MGI:1919871
definition	GO_function : GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : PDZ domain containing 11 protein_id : NP_082579.1

name	Kif4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680568 CCDS:CCDS30305.1 GeneID:16571 MGI:108389
definition	GO_component : GO:0005871 - kinesin complex [Evidence IEA]; GO:0005874 - microtubule [Evidence IEA]; GO:0005875 - microtubule associated complex [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0003777 - microtubule motor activity [Evidence IEA]; GO:0003774 - motor activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007018 - microtubule-based movement [Evidence IEA]; GO:0007017 - microtubule-based process [Evidence IEA] codon_start : 1 exception : mismatches in translation note : kinesin heavy chain member 4; N-5 kinesin product : kinesin family member 4 protein_id : NP_032472.1

name	Gdpd2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963749 CCDS:CCDS30306.1 GeneID:71584 MGI:1918834
definition	codon_start : 1 note : osteoblast differentiation promoting factor; glycerophosphodiester phosphodiesterase 3 product : osteoblast differentiation promoting factor protein protein_id : NP_076097.1

name	Dlg3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7949129 CCDS:CCDS30307.1 GeneID:53310 MGI:1888986
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0005515 - protein binding [Evidence IPI] codon_start : 1 note : discs large homolog 3 product : synapse-associated protein 102 protein_id : NP_058027.1

name	Tex11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878211 CCDS:CCDS30308.1 GeneID:83558 MGI:1933237
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : testis expressed gene 11 protein_id : NP_113561.1

name	Slc7a3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671600 CCDS:CCDS30309.1 GeneID:11989 MGI:1100521
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS] GO_function : GO:0015171 - amino acid transporter activity [Evidence IEA]; GO:0015326 - cationic amino acid transporter activity [Evidence IDA]; GO:0015181 - L-arginine transporter activity [Evidence IDA]; GO:0015189 - L-lysine transporter activity [Evidence IDA] GO_process : GO:0015809 - arginine transport [Evidence IDA]; GO:0015819 - lysine transport [Evidence IDA] codon_start : 1 note : amino acid transporter, cationic 3 product : solute carrier family 7 (cationic amino acid transporter, y+ system), member 3 protein_id : NP_031541.1

name	Snx12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9256640 GeneID:55988 MGI:1919331
definition	GO_function : GO:0035091 - phosphoinositide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : sorting nexin 12 protein_id : NP_061363.1

name	Mllt7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9055158 GeneID:54601 MGI:1891915
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0019899 - enzyme binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence ISS] [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence ISS]; GO:0016563 - transcriptional activator activity [Evidence IDA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0007050 - cell cycle arrest [Evidence ISS]; GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA]; GO:0000080 - G1 phase of mitotic cell cycle [Evidence ISS]; GO:0008286 - insulin receptor signaling pathway [Evidence ISS]; GO:0007095 - mitotic G2 checkpoint [Evidence IDA]; GO:0016525 - negative regulation of angiogenesis [Evidence ISS]; GO:0008285 - negative regulation of cell proliferation [Evidence ISS] [Evidence IDA]; GO:0051151 - negative regulation of smooth muscle cell differentiation [Evidence ISS]; GO:0045941 - positive regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence ISS] [Evidence IEA]; GO:0007519 - striated muscle development [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006366 - transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : forkhead protein product : myeloid/lymphoid or mixed lineage-leukemia translocation to 7 homolog protein_id : NP_061259.1

name	Gm614 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701852 CCDS:CCDS30311.1 GeneID:245536 MGI:2685460
definition	codon_start : 1 note : interleukin 2 receptor, gamma chain product : hypothetical protein LOC245536 protein_id : NP_001028534.1

name	Il2rg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305181 CCDS:CCDS30312.1 GeneID:16186 MGI:96551
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004896 - hematopoietin/interferon-class (D200-domain) cytokine receptor activity [Evidence IEA]; GO:0019976 - interleukin-2 binding [Evidence IPI]; GO:0005515 - protein binding [Evidence IPI]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : gamma C receptor; common gamma chain; common cytokine receptor gamma chain product : interleukin 2 receptor, gamma chain protein_id : NP_038591.1

name	Med12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125628662 GeneID:59024 MGI:1926212
definition	GO_component : GO:0000119 - mediator complex [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence ISS]; GO:0003713 - transcription coactivator activity [Evidence ISS] GO_process : GO:0045944 - positive regulation of transcription from RNA polymerase II promoter [Evidence ISS] codon_start : 1 note : OPA-containing protein 1; trinucleotide repeat containing 11 (THR-associated protein, 230 kDa subunit); trinucleotide repeat containing 11 (THR-associated protein) product : mediator of RNA polymerase II transcription, subunit 12 homolog protein_id : NP_067496.2

name	Nlgn3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370440 CCDS:CCDS30313.1 GeneID:245537 MGI:2444609
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0045202 - synapse [Evidence ISS] GO_function : GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0050808 - synapse organization and biogenesis [Evidence ISS] codon_start : 1 exception : mismatches in translation note : neuroligin 3 protein product : neuroligin 3 protein_id : NP_766520.1

name	LOC100042407 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271800 GeneID:100042407
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478174.1

name	Gjb1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22165406 CCDS:CCDS30314.1 GeneID:14618 MGI:95719
definition	GO_component : GO:0005922 - connexon complex [Evidence IEA]; GO:0005921 - gap junction [Evidence IEA]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0015285 - connexon channel activity [Evidence IEA]; GO:0005243 - gap-junction forming channel activity [Evidence IEA] GO_process : GO:0007154 - cell communication [Evidence IEA]; GO:0007267 - cell-cell signaling [Evidence IEA] codon_start : 1 note : connexin 32; connexin-32; connexin-43 product : gap junction protein, beta 1, 32kDa protein_id : NP_032150.2

name	Zmym3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790027 CCDS:CCDS30315.1 GeneID:56364 MGI:1927231
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : DXHXS6673E product : zinc finger protein 261 protein_id : NP_062805.1

name	Nono (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963531 CCDS:CCDS30316.1 GeneID:53610 MGI:1855692
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006310 - DNA recombination [Evidence IEA]; GO:0006281 - DNA repair [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : non-POU-domain-containing, octamer-binding protein product : non-POU-domain-containing, octamer binding protein protein_id : NP_075633.1

name	Itgb1bp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305191 GeneID:26549 MGI:1353420
definition	GO_component : GO:0030018 - Z disc [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IDA]; GO:0008270 - zinc ion binding [Evidence IDA] codon_start : 1 note : melusin product : integrin beta 1 binding protein 2 protein_id : NP_038740.1

name	Taf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124486596 GeneID:270627 MGI:1336878
definition	GO_component : GO:0005669 - transcription factor TFIID complex [Evidence ISS] [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006352 - transcription initiation [Evidence IEA] codon_start : 1 note : cell cycle, G1 phase defect product : TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_001074477.1

name	Ogt (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909607 CCDS:CCDS30318.1 GeneID:108155 MGI:1339639
definition	GO_component : GO:0005829 - cytosol [Evidence ISS]; GO:0005622 - intracellular [Evidence TAS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0008375 - acetylglucosaminyltransferase activity [Evidence ISS]; GO:0008080 - N-acetyltransferase activity [Evidence TAS]; GO:0005515 - protein binding [Evidence ISS]; GO:0016262 - protein N-acetylglucosaminyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0006493 - protein amino acid O-linked glycosylation [Evidence TAS] [Evidence ISS]; GO:0007584 - response to nutrient [Evidence ISS]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 note : UDP-N-acetylglucosaminyltransferase; O-linked GlcNAc transferase product : O-linked N-acetylglucosamine transferase protein_id : NP_631883.2

name	Cxcr3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753458 CCDS:CCDS30319.1 GeneID:12766 MGI:1277207
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0016493 - C-C chemokine receptor activity [Evidence IEA]; GO:0016494 - C-X-C chemokine receptor activity [Evidence IEA]; GO:0004950 - chemokine receptor activity [Evidence IEA]; GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0006935 - chemotaxis [Evidence IEA]; GO:0006952 - defense response [Evidence IEA]; GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : chemokine (C-X-C) receptor 3 product : chemokine (C-X-C motif) receptor 3 protein_id : NP_034040.1

name	EG212753 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407690 GeneID:212753 MGI:3646776
definition	codon_start : 1 product : hypothetical protein protein_id : XP_136015.7

name	8030474K03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407692 GeneID:382231 MGI:2685988
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001000772.1

name	LOC100042465 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271806 GeneID:100042465
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478318.1

name	EG621083 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83003083 GeneID:621083 MGI:3645090
definition	codon_start : 1 product : similar to novel similar to human Nance-Horan syndrome protein (RP11-262D11.5) protein_id : XP_901276.1

name	Rgag4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304005 CCDS:CCDS30320.1 GeneID:331474 MGI:3045324
definition	codon_start : 1 note : gag-like protein product : retrotransposon gag domain containing 4 protein_id : NP_899141.1

name	LOC100042480 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271808 GeneID:100042480
definition	codon_start : 1 product : similar to novel similar to human Nance-Horan syndrome protein (RP11-262D11.5) protein_id : XP_001478337.1

name	LOC331476 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271810 GeneID:331476
definition	codon_start : 1 product : similar to SUMO-1-specific protease protein_id : XP_001478352.1

name	Pin4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:113931156 GeneID:69713 MGI:1916963
definition	GO_function : GO:0016853 - isomerase activity [Evidence IEA]; GO:0003755 - peptidyl-prolyl cis-trans isomerase activity [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA] codon_start : 1 product : protein (peptidyl-prolyl cis/trans isomerase) NIMA-interacting, 4 (parvulin) protein_id : NP_081457.1

name	Ercc6l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27414501 CCDS:CCDS30321.1 GeneID:236930 MGI:2654144
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence IEA]; GO:0004386 - helicase activity [Evidence IEA] codon_start : 1 note : SNF2/RAD54 family protein; excision repair cross-complementing rodent repair deficiency complementation group 6-like product : excision repair cross-complementing rodent repair deficiency complementation group 6 - like protein_id : NP_666347.2

name	Rps4x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6677805 GeneID:20102 MGI:98158
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA]; GO:0005840 - ribosome [Evidence ISS] GO_function : GO:0019843 - rRNA binding [Evidence IEA]; GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0006412 - protein biosynthesis [Evidence ISS]; GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : ribosomal protein S4 X-linked product : ribosomal protein S4, X-linked protein_id : NP_033120.1

name	Cited1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671760 CCDS:CCDS30322.1 GeneID:12705 MGI:108023
definition	GO_component : GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003700 - transcription factor activity [Evidence NAS]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0001892 - embryonic placenta development [Evidence IMP]; GO:0030318 - melanocyte differentiation [Evidence IMP]; GO:0043473 - pigmentation [Evidence IMP]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0001570 - vasculogenesis [Evidence IMP] codon_start : 1 product : Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1 protein_id : NP_031735.1

name	Hdac8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037203 GeneID:70315 MGI:1917565
definition	GO_component : GO:0005737 - cytoplasm [Evidence TAS]; GO:0000118 - histone deacetylase complex [Evidence TAS]; GO:0005634 - nucleus [Evidence TAS] [Evidence IEA] GO_function : GO:0004407 - histone deacetylase activity [Evidence IEA] [Evidence TAS]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008134 - transcription factor binding [Evidence TAS] GO_process : GO:0016568 - chromatin modification [Evidence TAS] [Evidence IEA]; GO:0016575 - histone deacetylation [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : histone deacetylase 8 protein_id : NP_081658.1

name	Phka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27819665 CCDS:CCDS30324.1 GeneID:18679 MGI:97576
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 2 is encoded by transcript variant 2 product : phosphorylase kinase alpha 1 isoform 2 protein_id : NP_766609.1

name	Phka1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679301 CCDS:CCDS30323.1 GeneID:18679 MGI:97576
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005516 - calmodulin binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0004689 - phosphorylase kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0005977 - glycogen metabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation note : isoform 1 is encoded by transcript variant 1 product : phosphorylase kinase alpha 1 isoform 1 protein_id : NP_032858.1

name	LOC620734 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620734
definition	number : 1 pseudo : _no_value

name	LOC620734 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620734
definition	number : 2 pseudo : _no_value

name	LOC620734 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:620734
definition	number : 3 pseudo : _no_value

name	LOC100042392 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042392
definition	number : 2 pseudo : _no_value

name	LOC100042392 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042392
definition	number : 1 pseudo : _no_value

name	LOC668291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668291
definition	number : 2 pseudo : _no_value

name	LOC668291 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:668291
definition	number : 1 pseudo : _no_value

name	LOC668271 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271798 GeneID:668271
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 25 ESTs, 3 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_033538.1

name	LOC620837 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271835 GeneID:620837
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Rnf26 protein pseudo : _no_value transcript_id : XR_034095.1

name	LOC632454 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271802 GeneID:632454
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 1509 ESTs, 7 Proteins product : similar to tumor protein, translationally-controlled 1 pseudo : _no_value transcript_id : XR_033588.1

name	LOC668302 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271803 GeneID:668302
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : similar to hCG1984468 pseudo : _no_value transcript_id : XR_033602.1

name	LOC668308 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271804 GeneID:668308
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 9 Proteins product : similar to hCG1984468 pseudo : _no_value transcript_id : XR_033611.1

name	LOC670921 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271837 GeneID:670921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Hmgb1 protein pseudo : _no_value transcript_id : XR_034127.1

name	LOC668318 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271811 GeneID:668318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 4 Proteins product : similar to PNG protein pseudo : _no_value transcript_id : XR_033639.1

name	LOC100043080 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271838 GeneID:100043080
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 3 Proteins product : similar to 60S ribosomal protein L34 pseudo : _no_value transcript_id : XR_034133.1

clone name	MSMg01-152B10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-489B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166D18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187D23
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-276H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-187H04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-400L19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-523C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-078L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-317N05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360I19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346C12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-505D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-127O16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-437K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-391O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546H03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-209E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168P18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-383M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100D24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476L23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-051J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-168J11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-262B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-545O03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330B17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-153M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538I20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-346B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295J14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109C14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-183L14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341A02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229O23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334E17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-074N23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-315L06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-223E04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-339F01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-347M07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-258I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017D06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-323J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-190K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260I03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316J16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-101H14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167H06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-095C19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-201F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263D24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276I12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062D05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246M24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-154N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158I08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212N15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-132K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296C12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-221K05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237E12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-208E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-164O10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-297K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-225I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-224J01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-031F09
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-260I03.b	B6Ng01-260I03.g
ACC	GA065413	GA065414
length	343	966
definition	B6Ng01-260I03.b	B6Ng01-260I03.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(98,764,918 - 98,765,265)	(98,555,871 - 98,556,530)
sequence	ttcccgagacggataaaggcgtttgcgcacgttttcacggagtgtctgta gatccattggtcgagtgatgattttatagtaatcctttacaacctttgca ttaactggagtatggaaagggtatgtctgggaaaacaagagtcagcaccg tttgtgagcaagaacacttgacacagccaattatatcttactggtttacc aactctcaagggctttttcagatgtagtaattctgtttcttgcattaaac cactttttcttctctctctctctctctctctctctctctctctctctctc actctctttctcgtgctcccccacacaccctccctccctccct	gaattcagtaagaatgttatacctatttagtaacattcaaatttacttct agtagagatggtgaaactaattaggcattacgaagaacgaagaacggagc tagaatagctcagggctagtatgcagagtgattacttaggacagtagcca gtctcacccaaacaaggggatacacaatggcctagctaataggtgggttt accatgaaagagttagggaattctactgagacagggatcttcactacagc caggtagagcaggctatattgcatattagaaacaagttggtgaattcttc tgacaaatggagattcaccacagatacttaaaagaacagctaagttacac tcatacaagaatttatcaaggcctaggaaatagggggtttgtggtattgc attattcatgagaaggtctgctagagcagaaacccctggttctagctttc acaaggctcaaaggagtagcacaaattgtgactagggtatgaaatcctta cctgtcattagctgaccctaggcagggctgttttatctttactgtaaata ttacctggttcctgtaagtccttttgaagtcattcctttgttttgtgtca ggtaacttcacaggtactttgcctgctgtgacatcctacccctttgtttt ctgtattatgtgactggtgttcactttgtgataatacattcagattctac ataatctctcgtgttgatctgtctgtcattcattcgccgactccttgtcc acctgcaaccagagacccgttctacacagacagggaccaaaaaggtctgc ggcagttctgtgctgcatgggggagggcagagaacagcttgtagaaatcg actctctcctttcatcatatgtgctctgggattcagactcagcaagggtc cctcctgctgggccatgtcactgttctgccacaaccatttctctctctct ctctctctctctctct
quality values	Open. Hide. 62 34 62 62 54 62 62 47 41 39 62 62 38 32 62 62 62 62 59 59 59 62 62 62 62 59 59 62 51 59 62 62 62 62 54 59 39 59 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 54 54 54 54 62 62 62 62 62 62 62 62 62 62 62 54 49 54 62 62 62 54 54 56 56 36 28 23 34 13 20 8 18 11 12 16 13 16 13 11 10 8 11 13 13 15 14 11 11 11 12 9 8 8 9 11 12 8 13 17 19 19 13 13 8 7 8 9 11 13 9 9 7 8	Open. Hide. 62 47 51 59 62 59 43 62 62 62 62 59 62 62 26 33 62 62 59 62 62 62 62 59 62 62 62 59 59 62 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 59 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 46 62 62 62 62 46 62 62 62 62 62 62 62 62 62 54 58 58 48 58 54 58 54 58 58 54 54 58 58 58 58 58 58 52 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 52 58 54 49 45 58 48 43 58 58 58 54 58 58 58 58 58 52 58 54 58 52 42 49 43 54 54 48 58 58 58 49 51 53 46 58 51 50 58 58 58 51 51 58 58 58 58 58 58 58 51 58 42 50 50 58 58 53 53 51 44 47 48 58 58 58 50 58 49 58 58 53 42 51 54 46 50 53 41 54 47 58 52 58 48 32 51 58 58 34 58 50 50 46 46 42 58 49 41 52 52 51 51 32 37 49 53 50 50 42 47 54 52 42 37 44 32 50 52 50 50 50 41 42 48 53 52 58 53 53 54 54 53 25 51 40 44 42 39 39 52 52 54 38 53 49 54 49 39 42 51 53 31 32 52 51 39 32 54 53 37 46 29 39 37 52 37 53 53 40 33 45 31 47 54 47 52 47 34 37 40 33 24 32 49 21 22 9 33 44 39 53 52 45 37 38 32 30 36 31 34 41 31 31 30 49 25 19 17 32 29 52 51 52 36 25 25 16 47 45 45 34 31 46 24 32 33 41 46 43 36 42 37 40 31 36 39 31 29 35 34 51 51 46 33 41 16 46 29 27 31 20 48 17 51 41 34 29 29 31 30 41 43 38 42 18 46 48 21 30 34 25 30 31 33 32 36 41 31 21 42 13 46 12 46 18 32 28 25 30 30 29 31 31 31 34 36 31 32 31 47 16 31 25 16 32 30 14 41 18 31 32 31 16 36 29 20 31 47 39 13 10 41 31 29 27 31 27 43 24 31 36 44 31 13 16 34 18 20 29 31 32 24 24 12 26 7 19 27 32 44 29 6 7 15 27 21 31 14 10 36 25 12 17 19 13 16 26 31 23 15 31 24 15 16 31 32 20 29 19 18 10 14 25 30 13 11 5

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_98764918_98765265
seq2: B6Ng01-260I03.b_46_394 (reverse)

seq1  AGGGAGGGAGGGAGGAAG-GAAGGGGAGAGAGAGAGAGAGAGAGAGAGAG  49
      |||||||||||||||  | |  ||||||   |||| |||||| |||||||
seq2  AGGGAGGGAGGGAGGGTGTGTGGGGGAGCACGAGAAAGAGAGTGAGAGAG  50

seq1  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAAAAAGTGGTTTAAT  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAAGAAAAAGTGGTTTAAT  100

seq1  GCAAGAAACAGAATTACTACATCTGAAAAAGCCCTTGAGAGTTGGTAAAC  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAAGAAACAGAATTACTACATCTGAAAAAGCCCTTGAGAGTTGGTAAAC  150

seq1  CAGTAAGATATAATTGGCTGTGTCAAGTGTTCTTGCTCACAAACGGTGCT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAAGATATAATTGGCTGTGTCAAGTGTTCTTGCTCACAAACGGTGCT  200

seq1  GACTCTTGTTTTCCCAGACATACCCTTTCCATACTCCAGTTAATGCAAAG  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTCTTGTTTTCCCAGACATACCCTTTCCATACTCCAGTTAATGCAAAG  250

seq1  GTTGTAAAGGATTACTATAAAATCATCACTCGACCAATGGATCTACAGAC  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGTAAAGGATTACTATAAAATCATCACTCGACCAATGGATCTACAGAC  300

seq1  ACTCCGTGAAAACGTGCGCAAACGCCTTTATCCGTCTCGGGAAGAATTC  348
      |||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCCGTGAAAACGTGCGCAAACGCCTTTATCCGTCTCGGGAAGAATTC  349

seq1: chrX_98555871_98556530
seq2: B6Ng01-260I03.g_374_1032

seq1  TGGAGATTCACCACAGATACTTAAAAGAACAGCTAAGTTACACTCATACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGATTCACCACAGATACTTAAAAGAACAGCTAAGTTACACTCATACA  50

seq1  AGAATTTATCAAGGCCTAGGAAATAGGGGGTTTGTGGTATTGCATTATTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAATTTATCAAGGCCTAGGAAATAGGGGGTTTGTGGTATTGCATTATTC  100

seq1  ATGAGAAGGTCTGCTAGAGCAGAAACCCCTGGTTCTAGCTTTCACAAGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAGAAGGTCTGCTAGAGCAGAAACCCCTGGTTCTAGCTTTCACAAGGC  150

seq1  TCAAAGGAGTAGCACAAATTGTGACTAGGGTATGAAATCCTTACCTGTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAAAGGAGTAGCACAAATTGTGACTAGGGTATGAAATCCTTACCTGTCA  200

seq1  TTAGCTGACCCTAGGCAGGGCTGTTTTATCTTTACTGTAAATATTACCTG  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGCTGACCCTAGGCAGGGCTGTTTTATCTTTACTGTAAATATTACCTG  250

seq1  GTTCCTGTAAGTCCTTTTGAAGTCATTCCTTTGTTTTGTGTCAGGTAACT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCCTGTAAGTCCTTTTGAAGTCATTCCTTTGTTTTGTGTCAGGTAACT  300

seq1  TCACAGGTACTTTGCCTGCTGTGACATCCTACCCCTTTGTTTTCTGTATT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACAGGTACTTTGCCTGCTGTGACATCCTACCCCTTTGTTTTCTGTATT  350

seq1  ATGTGACTGGTGTTCACTTTGTGATAATACATTCAGATTCTACATAATCT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTGACTGGTGTTCACTTTGTGATAATACATTCAGATTCTACATAATCT  400

seq1  CTCGTGTTGATCTGTCTGTCATTCATTCGCCGACTCCTTGTCCACCTGCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCGTGTTGATCTGTCTGTCATTCATTCGCCGACTCCTTGTCCACCTGCA  450

seq1  ACCAGAGACCCGTTCTACACAGACAGGGACCAAAAAGGTCTGCGGCAGTT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCAGAGACCCGTTCTACACAGACAGGGACCAAAAAGGTCTGCGGCAGTT  500

seq1  CTGTGCTGCATGGGGGAGGGCAGAGAACAGCTTGTAGAAATCGACTCTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGCTGCATGGGGGAGGGCAGAGAACAGCTTGTAGAAATCGACTCTCT  550

seq1  CCTTCCATCATATGTGCTCTGGGATTCAGACTCAGCAAGGGTCCCTCCTG  600
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTCATCATATGTGCTCTGGGATTCAGACTCAGCAAGGGTCCCTCCTG  600

seq1  CTGGGCCATGTCACTGTTCTGCCCACAACCATTTCTCTCTCTCTCTCTCT  650
      ||||||||||||||||||||| ||||||||||||||||||||||||||||
seq2  CTGGGCCATGTCACTGTTCTG-CCACAACCATTTCTCTCTCTCTCTCTCT  649

seq1  CTCTCTCTCT  660
      ||||||||||
seq2  CTCTCTCTCT  659

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information