MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-271F14
Chromosome	X (Build37)
Map Location	53,724,326 - 53,921,580
singlet/doublet	doublet
Overlap gene	Ddx26b, Gm648, Tmem32, Slc9a6
Upstream gene	LOC100039055, LOC100039066, LOC676623, EG626315, LOC666268, LOC666097, LOC666107, LOC626348, LOC100039146, LOC100039160, EG630825, LOC100039187, LOC673263, 3830403N18Rik, LOC626439, Gm773, LOC100039254, LOC100039266, LOC100039276, 1600025M17Rik, Zfp449, LOC100039317, 6330419J24Rik, 6530403M18Rik, LOC100039346
Downstream gene	LOC100039342, Fhl1, Mtap7d3, Gpr112, Brs3, Htatsf1, Vgll1, Cd40lg, Arhgef6, Rbmx, Snord61, Gm364, Gpr101, Aldoa-ps
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039055 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC100039066 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs

name	LOC676623 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:676623
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG626315 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626315 MGI:3646403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 5 ESTs, 1 Protein

name	LOC666268 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666268
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC666097 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666097
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC666107 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666107
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC626348 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626348
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039146 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039146
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039160 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039160
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	EG630825 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:630825 MGI:3644064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100039187 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039187
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC673263 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:673263
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	3830403N18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70691 MGI:1917941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC626439 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:626439
definition	note : splicing factor, arginine/serine-rich 10-like pseudo : _no_value

name	Gm773 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331416 MGI:2685619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039254 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039254
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100039266 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039266
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC100039276 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	1600025M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72030 MGI:1919280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins

name	Zfp449 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78619 MGI:1925869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039317 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	6330419J24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320237 MGI:2443645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	6530403M18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76212 MGI:1923462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039346 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 104 ESTs, 3 Proteins

name	Ddx26b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236790 MGI:2442593
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm648 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:270599 MGI:2685494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tmem32 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236792 MGI:2384305
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Slc9a6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236794 MGI:2443511
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039342 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Fhl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14199 MGI:1298387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Mtap7d3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320923 MGI:2445051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236798 MGI:2685213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Brs3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12209 MGI:1100501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htatsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72459 MGI:1919709
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Vgll1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170828 MGI:2655768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cd40lg (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21947 MGI:88337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arhgef6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73341 MGI:1920591
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rbmx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19655 MGI:1343044
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Snord61 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:353374 MGI:2148805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm364 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245423 MGI:2685210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 10 Proteins

name	Gpr101 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245424 MGI:2685211
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Aldoa-ps (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385362
definition	note : aldolase A pseudogene pseudo : _no_value

name	LOC100039066 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271626 GeneID:100039066
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs product : hypothetical protein LOC100039066 transcript_id : XM_001472118.1

name	EG626315 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407450 GeneID:626315 MGI:3646403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 1 Protein product : predicted gene, EG626315, transcript variant 2 transcript_id : XM_890908.2

name	EG626315 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271628 GeneID:626315 MGI:3646403
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : predicted gene, EG626315, transcript variant 1 transcript_id : XM_001472153.1

name	EG630825 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271630 GeneID:630825 MGI:3644064
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG630825 transcript_id : XM_001472389.1

name	3830403N18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803393 GeneID:70691 MGI:1917941
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 3830403N18 gene transcript_id : NM_027510.2

name	Gm773 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344171 GeneID:331416 MGI:2685619
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 773, (NCBI) transcript_id : NM_001033423.2

name	LOC100039276 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271632 GeneID:100039276
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to ZFP206 transcript_id : XM_001472597.1

name	1600025M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407458 GeneID:72030 MGI:1919280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 2 Proteins product : RIKEN cDNA 1600025M17 gene transcript_id : XM_983040.1

name	Zfp449 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130694 GeneID:78619 MGI:1925869
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger protein 449 transcript_id : NM_030139.3

name	LOC100039317 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271636 GeneID:100039317
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100039317 transcript_id : XM_001472449.1

name	6330419J24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271634 GeneID:320237 MGI:2443645
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6330419J24 gene transcript_id : XM_001472650.1

name	LOC100039346 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271639 GeneID:100039346
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 104 ESTs, 3 Proteins product : hypothetical protein LOC100039346 transcript_id : XM_001472500.1

name	Ddx26b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376260 GeneID:236790 MGI:2442593
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B transcript_id : NM_172779.2

name	Gm648 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803341 GeneID:270599 MGI:2685494
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : gene model 648, (NCBI) transcript_id : NM_001033372.2

name	Tmem32 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803324 GeneID:236792 MGI:2384305
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 32 transcript_id : NM_146234.3

name	Slc9a6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802040 GeneID:236794 MGI:2443511
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 6 transcript_id : NM_172780.2

name	Fhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517333 GeneID:14199 MGI:1298387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : four and a half LIM domains 1 transcript_id : NM_010211.2

name	Fhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517339 GeneID:14199 MGI:1298387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : four and a half LIM domains 1 transcript_id : NM_001077361.1

name	Fhl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116517335 GeneID:14199 MGI:1298387
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : four and a half LIM domains 1 transcript_id : NM_001077362.1

name	Mtap7d3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:144922675 GeneID:320923 MGI:2445051
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : MAP7 domain containing 3 transcript_id : NM_177293.3

name	Gpr112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:139949095 GeneID:236798 MGI:2685213
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 112 transcript_id : NM_001033327.2

name	Brs3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142388449 GeneID:12209 MGI:1100501
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : bombesin-like receptor 3 transcript_id : NM_009766.3

name	Htatsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956211 GeneID:72459 MGI:1919709
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HIV TAT specific factor 1 transcript_id : NM_028242.1

name	Vgll1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:18875429 GeneID:170828 MGI:2655768
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vestigial like 1 homolog (Drosophila) transcript_id : NM_133251.1

name	Cd40lg (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:15011845 GeneID:21947 MGI:88337
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : CD40 ligand transcript_id : NM_011616.2

name	Arhgef6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22779884 GeneID:73341 MGI:1920591
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 transcript_id : NM_152801.1

name	Rbmx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981518 GeneID:19655 MGI:1343044
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RNA binding motif protein, X chromosome transcript_id : NM_011252.2

name	Gm364 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271641 GeneID:245423 MGI:2685210
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 10 Proteins product : gene model 364, (NCBI) transcript_id : XM_141763.7

name	Gpr101 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:90855768 GeneID:245424 MGI:2685211
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 101 transcript_id : NM_001033360.2

name	LOC100039066 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271627 GeneID:100039066
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472168.1

name	EG626315 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271629 GeneID:626315 MGI:3646403
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001472203.1

name	EG626315 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001271 GeneID:626315 MGI:3646403
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_896001.1

name	EG630825 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271631 GeneID:630825 MGI:3644064
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472439.1

name	3830403N18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21746153 CCDS:CCDS30141.1 GeneID:70691 MGI:1917941
definition	codon_start : 1 product : Xlr-like protein_id : NP_081786.1

name	Gm773 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:75677458 CCDS:CCDS30142.1 GeneID:331416 MGI:2685619
definition	codon_start : 1 product : hypothetical protein LOC331416 protein_id : NP_001028595.1

name	LOC100039276 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271633 GeneID:100039276
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472647.1

name	1600025M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407459 GeneID:72030 MGI:1919280
definition	codon_start : 1 product : hypothetical protein LOC72030 protein_id : XP_988134.1

name	Zfp449 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794208 CCDS:CCDS30143.1 GeneID:78619 MGI:1925869
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA] codon_start : 1 product : zinc finger protein 449 protein_id : NP_084415.1

name	LOC100039317 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271637 GeneID:100039317
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472499.1

name	6330419J24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271635 GeneID:320237 MGI:2443645
definition	codon_start : 1 product : hypothetical protein LOC320237 protein_id : XP_001472700.1

name	LOC100039346 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271640 GeneID:100039346
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472550.1

name	Ddx26b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370148 CCDS:CCDS30145.1 GeneID:236790 MGI:2442593
definition	codon_start : 1 product : DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B protein_id : NP_766367.1

name	Gm648 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701872 GeneID:270599 MGI:2685494
definition	codon_start : 1 product : hypothetical protein LOC270599 protein_id : NP_001028544.1

name	Tmem32 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122803 CCDS:CCDS30147.1 GeneID:236792 MGI:2384305
definition	codon_start : 1 product : transmembrane protein 32 protein_id : NP_666346.1

name	Slc9a6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370158 GeneID:236794 MGI:2443511
definition	GO_component : GO:0005789 - endoplasmic reticulum membrane [Evidence ISS]; GO:0005792 - microsome [Evidence ISS]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0015297 - antiporter activity [Evidence IEA]; GO:0015385 - sodium:hydrogen antiporter activity [Evidence ISS] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence ISS] codon_start : 1 exception : mismatches in translation product : solute carrier family 9 (sodium/hydrogen exchanger), isoform 6 protein_id : NP_766368.1

name	Fhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517336 GeneID:14199 MGI:1298387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : four and a half LIM domains 1 isoform 2 protein_id : NP_001070830.1

name	Fhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517334 CCDS:CCDS30148.1 GeneID:14199 MGI:1298387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform 3 is encoded by transcript variant 3 product : four and a half LIM domains 1 isoform 3 protein_id : NP_034341.2

name	Fhl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116517340 GeneID:14199 MGI:1298387
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0030154 - cell differentiation [Evidence IEA]; GO:0007275 - development [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : four and a half LIM domains 1 isoform 1 protein_id : NP_001070829.1

name	Mtap7d3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:144922676 GeneID:320923 MGI:2445051
definition	codon_start : 1 product : MAP7 domain containing 3 protein_id : NP_796267.2

name	Gpr112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:139949096 CCDS:CCDS30149.1 GeneID:236798 MGI:2685213
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : G-protein coupled receptor 112 product : G protein-coupled receptor 112 protein_id : NP_001028499.2

name	Brs3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542236 CCDS:CCDS30150.1 GeneID:12209 MGI:1100501
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : bombesin-like receptor 3 protein_id : NP_033896.2

name	Htatsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956212 GeneID:72459 MGI:1919709
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : HIV TAT specific factor 1 protein_id : NP_082518.1

name	Vgll1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:18875430 CCDS:CCDS30151.1 GeneID:170828 MGI:2655768
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0030528 - transcription regulator activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045449 - regulation of transcription [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : vestigial-related factor product : vestigial like 1 homolog protein_id : NP_573514.1

name	Cd40lg (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:15011846 CCDS:CCDS30152.1 GeneID:21947 MGI:88337
definition	GO_component : GO:0005615 - extracellular space [Evidence IEA]; GO:0016021 - integral to membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IEA]; GO:0005625 - soluble fraction [Evidence ISS] GO_function : GO:0005174 - CD40 receptor binding [Evidence ISS]; GO:0005125 - cytokine activity [Evidence IEA]; GO:0005164 - tumor necrosis factor receptor binding [Evidence IEA] GO_process : GO:0006916 - anti-apoptosis [Evidence ISS]; GO:0042100 - B cell proliferation [Evidence ISS]; GO:0006952 - defense response [Evidence IEA]; GO:0006955 - immune response [Evidence IEA]; GO:0048305 - immunoglobulin secretion [Evidence IGI]; GO:0006954 - inflammatory response [Evidence ISS]; GO:0045190 - isotype switching [Evidence IDA]; GO:0007159 - leukocyte adhesion [Evidence ISS]; GO:0030168 - platelet activation [Evidence ISS]; GO:0051023 - regulation of immunoglobulin secretion [Evidence IDA]; GO:0007165 - signal transduction [Evidence IDA] [Evidence NAS] codon_start : 1 product : tumor necrosis factor (ligand) superfamily, member 5 protein_id : NP_035746.2

name	Arhgef6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22779885 GeneID:73341 MGI:1920591
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : Rac/Cdc42 guanine exchange factor (GEF) 6 product : Rac/Cdc42 guanine nucleotide exchange factor 6 protein_id : NP_690014.1

name	Rbmx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6755296 CCDS:CCDS30153.1 GeneID:19655 MGI:1343044
definition	GO_component : GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : RNA binding motif protein, X-linked protein_id : NP_035382.1

name	Gm364 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271642 GeneID:245423 MGI:2685210
definition	codon_start : 1 product : hypothetical protein protein_id : XP_141763.7

name	Gpr101 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701848 CCDS:CCDS30154.1 GeneID:245424 MGI:2685211
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor GPR101 product : G protein-coupled receptor 101 protein_id : NP_001028532.1

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 1 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 2 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 3 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 4 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 5 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 6 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 7 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 8 pseudo : _no_value

name	LOC676623 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:676623
definition	number : 9 pseudo : _no_value

name	LOC666268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666268
definition	number : 1 pseudo : _no_value

name	LOC666268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666268
definition	number : 2 pseudo : _no_value

name	LOC666268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666268
definition	number : 3 pseudo : _no_value

name	LOC666097 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666097
definition	number : 1 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 1 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 2 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 3 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 4 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 5 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 6 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 7 pseudo : _no_value

name	LOC626348 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:626348
definition	number : 1 pseudo : _no_value

name	LOC666107 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666107
definition	number : 8 pseudo : _no_value

name	LOC666268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666268
definition	number : 4 pseudo : _no_value

name	LOC666268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666268
definition	number : 5 pseudo : _no_value

name	LOC666268 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666268
definition	number : 6 pseudo : _no_value

name	LOC100039146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039146
definition	number : 6 pseudo : _no_value

name	LOC100039146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039146
definition	number : 5 pseudo : _no_value

name	LOC100039146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039146
definition	number : 4 pseudo : _no_value

name	LOC100039146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039146
definition	number : 3 pseudo : _no_value

name	LOC100039146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039146
definition	number : 2 pseudo : _no_value

name	LOC100039146 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039146
definition	number : 1 pseudo : _no_value

name	LOC100039160 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039160
definition	number : 1 pseudo : _no_value

name	LOC100039187 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039187
definition	number : 1 pseudo : _no_value

name	LOC673263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673263
definition	number : 2 pseudo : _no_value

name	LOC673263 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:673263
definition	number : 1 pseudo : _no_value

name	LOC100039254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039254
definition	number : 1 pseudo : _no_value

name	LOC100039254 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039254
definition	number : 2 pseudo : _no_value

name	LOC100039266 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039266
definition	number : 1 pseudo : _no_value

name	LOC100039342 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039342
definition	number : 1 pseudo : _no_value

name	LOC100039342 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039342
definition	number : 2 pseudo : _no_value

name	LOC100039055 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271625 GeneID:100039055
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Xlr-like pseudo : _no_value transcript_id : XR_030561.1

name	6530403M18Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149271638 GeneID:76212 MGI:1923462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6530403M18 gene transcript_id : XR_035193.1

name	Snord61 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:86604698 GeneID:353374 MGI:2148805
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : small nucleolar RNA, C/D box 61 transcript_id : NR_002903.1

clone name	MSMg01-093G03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313E05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-180H24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-186O23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-349D08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-122L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-373K09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-544M05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-124N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147I11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-104G12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-532H12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-120E12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-424N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-466I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-207N11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-545B22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-513G07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-462B12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-293F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340K05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347J02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-424P14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-491J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269K01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391L11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526L01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-525L10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366F12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-501C17
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-333C15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-173D17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-176I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-503J05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-157B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-374E15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544D15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-061K10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-451E03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-525H02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271I22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-292H23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-344H13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-536P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-429H15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-313A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-294L24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237A19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-141M17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-178H23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-147N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166A12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-171N03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-430O09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482J04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-153F20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-318K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-374P19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-510I07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-065E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-308H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-471P21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-117E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-477M21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-403O05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-099K21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-322O08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440J07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-501F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-507G01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-533G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-354B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-236H21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328E10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-415P23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346P03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-534K03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-067I19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-093P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-137B15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158E17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350D15
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361J14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-419E22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-422B09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074I06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-067P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-451L16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-516C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-394P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453K23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527M03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-358C02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-451D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522K15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218O06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487M22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-422L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-523L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-476I22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108J17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529J22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-410B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273H17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-401A13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-233K13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-233O10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-120O16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-458F17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048F06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512D19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-349F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368E16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-378C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-514C03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069C17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-220B22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175H09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-199H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044M18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-312B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-273B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-027L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-157J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152O04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-111P05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009G16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092P20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302J05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-135G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216M23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-216H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-143I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260G06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267J24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-050N13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318J13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-159N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230O02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078B20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-290C09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-312M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327E01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-229B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-072M18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-206C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219N13
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-271F14.b	B6Ng01-271F14.g
ACC	GA073454	GA073455
length	1,117	570
definition	B6Ng01-271F14.b	B6Ng01-271F14.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(53,724,326 - 53,725,443)	(53,921,005 - 53,921,580)
sequence	gaattcttaacattgaaagctttaagttgcacaaatatttggcataaggc taaggacaagaaccaagagaaaagtcatttgtcttgtggagagacagagt tgattggaaaagctgggcatatttttgttccatcattccatctttttcat ctgtttactgacatagacccggttcttgatgacaaagatgaacagtgtca aattgaagaagaaagtaaactggttaaaaaatactgttgaaattgcttta tttcaatggtctgggttgctacagagaaaactttccctaaacttatggag agcagatggaaaaaaagaaaaactgtttatccttcaacaaaagaattgat ggccctactatatttagactttaacttgggacatctgggaaaatgttcaa atccgttaatcatctagtttgtaactatctacaaagaagctgaaggtcga gattagccctttagcataggcttatgaagaacaaatactatcaggctgct tttatttcctttcatgcaaaaccaaatgtgtgttgaggagggaaagcaac atgtattgtctcccggacatcaacagcagcccttgttattcagtcgccat gaagggctctcctcagctgggatgacttagactgtgcggctatcaggaga gtgtcaagataggctgaggagcaactgtgctcccaaatgaggcatgagtt ggggacagaaggtcacagtgactggtgtgtaagagaggctgggtcgtgac agtctgtaacatgtagtgctttatttttattttttattatttgctctttg aatagatccactgctggtaccttttaatagctaaccatgctagagaattt caatcatctatttttttttttctgcttatactcaatttacatagtttgta aagaacatttaggtgcagctgtcctaaatacctttatgcacgactttgga tggggatgttaatactgtgtttatgaaacatttgaattatcttaagtcaa tcaaggtcactatatttttggaaaaggatttacaatgacctttagagcta gagcagaaaggctctagcactactccacattccctccccttctgcactgt ggatctcctatctcctt	cacctaacaacctcactctaacgcatagcctaccgcgaagatgttcttat ttagtctgctgcattctcctttaggctcaaagcatggtttaaacacctct gtgttgtgttttcccctgtccccagcctggctcatgtctcagcccggatg agttgctaatggtctatggactgccaagttagaatttaaaacactggctg gccaaacttgttaaatatcaaactcctggctcctgttttttttttttttt aaaggaactctgttgagtttgtgtgtgtgcgtgtgttaaaaaaatttttt tgtagctccccagagggtttaattgcctttatcttgacttctcacacaaa actagtatggggatgggggtggggacaactttggttatctgacagaagtc ttccagctttctctggtggaaaaccagctcatgtaatttttgtctgagcc atatggaaacccagctgtataggagattcgaatggacaacaacatcagac agcaaagcctcgtgacacccaaatcaaccaagaattgactagtctcaaga catttctgtccagtatctga
quality values	Open. Hide. 49 31 32 35 62 62 62 54 56 62 41 32 54 62 62 47 62 62 54 62 62 62 54 62 54 62 62 62 59 62 62 62 62 62 49 62 62 59 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 59 62 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 54 62 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 49 54 62 62 62 62 62 62 59 62 62 62 62 54 62 59 59 62 62 54 54 54 62 62 62 54 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 54 52 62 62 62 62 62 62 62 62 62 62 46 62 62 62 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 54 49 58 58 58 52 58 58 58 54 54 49 58 58 58 58 58 58 58 58 58 58 58 58 44 58 58 39 49 58 58 58 58 54 58 58 58 58 54 58 58 58 54 54 58 58 54 58 58 52 47 58 58 58 44 54 52 58 54 50 58 58 52 53 58 58 53 58 58 58 58 51 54 58 51 50 42 58 53 46 51 58 53 53 51 51 50 54 58 58 53 33 58 58 50 54 52 51 50 58 48 51 50 52 58 54 58 58 58 36 31 54 51 40 58 51 50 27 49 49 58 58 50 51 58 53 58 50 51 50 51 53 42 25 49 41 33 58 46 50 51 46 53 38 58 52 51 28 50 41 41 35 58 51 39 16 51 58 30 49 30 44 50 50 58 51 51 54 50 40 33 44 23 50 58 50 51 58 25 49 32 40 42 54 54 42 54 54 38 54 54 52 39 26 35 40 51 51 17 39 29 42 39 52 52 37 35 47 33 33 33 51 49 42 54 45 51 32 34 46 34 54 32 51 24 49 32 53 51 54 49 33 40 45 35 51 31 33 37 31 40 45 45 51 32 40 53 42 42 42 53 42 53 31 32 51 24 45 54 47 39 33 52 52 49 45 45 34 53 51 49 49 42 40 31 32 45 45 51 47 42 32 39 42 37 53 41 34 32 33 35 32 31 32 32 23 45 26 36 31 42 35 31 38 36 29 31 31 46 31 51 46 30 32 30 31 31 25 45 31 38 42 16 31 21 31 41 42 30 31 36 46 32 42 32 26 48 42 31 32 22 33 43 32 43 43 34 32 32 48 48 46 46 48 48 46 46 46 30 32 31 31 30 43 29 29 30 29 34 32 31 19 29 31 47 41 22 31 35 31 30 31 41 48 31 30 16 34 47 28 27 33 28 27 31 32 48 31 28 6 28 22 27 27 26 24 31 31 38 24 24 27 32 19 41 26 17 25 38 32 31 48 29 18 26 34 34 25 29 18 38 24 30 48 29 31 31 28 24 30 43 39 33 23 17 19 9 23 23 20 16 27 34 32 34 22 21 22 39 26 15 21 11 24 37 26 14 16 20 47 30 22 24 16 28 25 22 19 22 16 15 8 15 27 34 28 18 16 23 16 14 14 21 20 16 28 24 16 14 20 4 6 6 30 29 30 14 8 16 13 34 38 18 11 8 6 4 6 14 13 13 21 20 8 17 28 10 13 19 21 16 17 8 22 21 28 28 14 11 28 24 27 28 9 29 33 15 10 16 16 19 20 21 19 13 12 4 5 12 13 23 10 13 3 3 10 10 15 8 17 29 4 11 15 25 26 14 3 5 6 4 3 4 9 13 6 18 6 4 12 11 6 6 14 4 12 5 15 16 16 11 12 11 3 2	Open. Hide. 32 22 62 62 54 24 11 25 15 11 11 9 11 6 33 28 49 49 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 59 62 62 62 62 62 59 59 24 24 17 16 13 27 23 23 36 54 42 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 54 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 56 59 56 34 43 56 59 59 54 48 48 59 59 59 59 62 56 62 59 56 56 50 38 48 56 48 43 48 59 56 50 59 59 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 56 50 30 50 56 56 59 59 59 51 39 62 50 62 62 56 62 62 62 62 62 62 62 62 62 62 62 59 56 59 59 59 56 62 59 62 62 62 56 59 59 59 59 59 62 59 59 62 62 56 59 59 45 48 59 59 62 62 62 59 59 59 62 62 59 62 62 59 62 62 62 56 39 23 30 34 43 49 49 59 59 59 51 59 59 59 56 59 59 62 50 38 34 56 34 23 27 23 30 34 38 38 36 30 51 34 23 15 15 24 18 16 19 25 11 24 39 35 25 27 24 16 49 49 18 34 34 23 34 34 50 36 12 16 13 13 19 11 16 23 18 19 39 51 62 43 50 18 10 10 11 11 18 34 34 43 34 30 30 30 16 18 18 29 13 18 11 10 11 7 25 26 17 43 30 36 24 8 27 44 51 44 43 45 18 12 18 13 13 17 25 15 34 21 7 5 34 13 14 13 27 26 39 34 13 24 24 34 25 13 34 38 39 42 20 31 38 20 16 16 14 22 14 22 26 24 32 26 30 10 24 38 35 32 20 24 14 14 16 15 30 26 31 20 16 24 16 27 14 24 30 50 39 42 31 37 34 14 18 20 20 39 23 26 15 8 10 14

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_53724326_53725443
seq2: B6Ng01-271F14.b_44_1160

seq1  GAATTCTTAACATTGAAAGCTTTAAGTTGCACAAATATTTGGCATAAGGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAACATTGAAAGCTTTAAGTTGCACAAATATTTGGCATAAGGC  50

seq1  TAAGGACAAGAACCAAGAGAAAAGTCATTTGTCTTGTGGAGAGACAGAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAGGACAAGAACCAAGAGAAAAGTCATTTGTCTTGTGGAGAGACAGAGT  100

seq1  TGATTGGAAAAGCTGGGCATATTTTTGTTCCATCATTCCATCTTTTTCAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTGGAAAAGCTGGGCATATTTTTGTTCCATCATTCCATCTTTTTCAT  150

seq1  CTGTTTACTGACATAGACCCGGTTCTTGATGACAAAGATGAACAGTGTCA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTTTACTGACATAGACCCGGTTCTTGATGACAAAGATGAACAGTGTCA  200

seq1  AATTGAAGAAGAAAGTAAACTGGTTAAAAAATACTGTTGAAATTGCTTTA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATTGAAGAAGAAAGTAAACTGGTTAAAAAATACTGTTGAAATTGCTTTA  250

seq1  TTTCAATGGTCTGGGTTGCTACAGAGAAAACTTTCCCTAAACTTATGGAG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAATGGTCTGGGTTGCTACAGAGAAAACTTTCCCTAAACTTATGGAG  300

seq1  AGCAGATGGAAAAAAAGAAAAACTGTTTATCCTTCAACAAAAGAATTGAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCAGATGGAAAAAAAGAAAAACTGTTTATCCTTCAACAAAAGAATTGAT  350

seq1  GGCCCTACTATATTTAGACTTTAACTTGGGACATCTGGGAAAATGTTCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCCCTACTATATTTAGACTTTAACTTGGGACATCTGGGAAAATGTTCAA  400

seq1  ATCCGTTAATCATCTAGTTTGTAACTATCTACAAAGAAGCTGAAGGTCGA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCCGTTAATCATCTAGTTTGTAACTATCTACAAAGAAGCTGAAGGTCGA  450

seq1  GATTAGCCCTTTAGCATAGGCTTATGAAGAACAAATACTATCAGGCTGCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTAGCCCTTTAGCATAGGCTTATGAAGAACAAATACTATCAGGCTGCT  500

seq1  TTTATTTCCTTTCATGCAAAACCAAATGTGTGTTGAGGAGGGAAAGCAAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTTCCTTTCATGCAAAACCAAATGTGTGTTGAGGAGGGAAAGCAAC  550

seq1  ATGTATTGTCTCCCGGACATCAACAGCAGCCCTTGTTATTCAGTCGCCAT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGTATTGTCTCCCGGACATCAACAGCAGCCCTTGTTATTCAGTCGCCAT  600

seq1  GAAGGGCTCTCCTCAGCTGGGATGACTTAGACTGTGCGGCTATCAGGAGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGGGCTCTCCTCAGCTGGGATGACTTAGACTGTGCGGCTATCAGGAGA  650

seq1  GTGTCAAGATAGGCTGAGGAGCAACTGTGCTCCCAAATGAGGCATGAGTT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCAAGATAGGCTGAGGAGCAACTGTGCTCCCAAATGAGGCATGAGTT  700

seq1  GGGGACAGAAGGTCACAGTGACTGGTGTGTAAGAGAGGCTGGGTCGTGAC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGGACAGAAGGTCACAGTGACTGGTGTGTAAGAGAGGCTGGGTCGTGAC  750

seq1  AGTCTGTAACATGTAGTGCTTTATTTTTATTTTTTATTATTTGCTCTTTG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTGTAACATGTAGTGCTTTATTTTTATTTTTTATTATTTGCTCTTTG  800

seq1  AATAGATCCACTGCTGGTACCTTTTAATAGCTAACCATGCTAGAGAATTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATAGATCCACTGCTGGTACCTTTTAATAGCTAACCATGCTAGAGAATTT  850

seq1  CAATCATCTA-TTTTTTTTTTCTGCTTATACTCAATTTACATAGTTTGTA  899
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CAATCATCTATTTTTTTTTTTCTGCTTATACTCAATTTACATAGTTTGTA  900

seq1  AAGAACATTTAGGTGCAGCTGTCCTAAATACCTTTATGCACGACTTTGGA  949
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAACATTTAGGTGCAGCTGTCCTAAATACCTTTATGCACGACTTTGGA  950

seq1  TGGGGATGTTAATACTGTGTTTATGAAACATTTGAATTATCTTAAGTCAA  999
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGGGATGTTAATACTGTGTTTATGAAACATTTGAATTATCTTAAGTCAA  1000

seq1  TCAAGGTCACTAATATTTTGGAAAAGGATTACAAATGACCTTTAGAGCTA  1049
      ||||||||||||   |||||||||||||||   |||||||||||||||||
seq2  TCAAGGTCACTATATTTTTGGAAAAGGATTTACAATGACCTTTAGAGCTA  1050

seq1  GAGCAGAAAGGGCTCTAGCACTACTCCCACA-TCCCTCCCCTTCGAGCAC  1098
      ||||||||| ||||||||||||||| ||||| ||||||||||||  ||||
seq2  GAGCAGAAA-GGCTCTAGCACTACT-CCACATTCCCTCCCCTTC-TGCAC  1097

seq1  TGTGGATCTTCTATCTCCTT  1118
      ||||||||| ||||||||||
seq2  TGTGGATCTCCTATCTCCTT  1117

seq1: chrX_53921005_53921580
seq2: B6Ng01-271F14.g_69_644 (reverse)

seq1  TCAGATACTGTACAGAAATGTCTTGAGACTAGTCAATTCTTGGTTGATTT  50
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  TCAGATACTGGACAGAAATGTCTTGAGACTAGTCAATTCTTGGTTGATTT  50

seq1  GGGTGTCACGAGGCTTTGCTGTCTGATGTTGTTGTCCATTCGAATCTCCT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGTCACGAGGCTTTGCTGTCTGATGTTGTTGTCCATTCGAATCTCCT  100

seq1  ATACAGCTGGGTTTCCATATGGCTCAGACAAAAATTACATGAGCTGGTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACAGCTGGGTTTCCATATGGCTCAGACAAAAATTACATGAGCTGGTTT  150

seq1  TCCACCAGAGAAAGCTGGAAGACTTCTGTCAGATAACCAAAGTTGTCCCC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCACCAGAGAAAGCTGGAAGACTTCTGTCAGATAACCAAAGTTGTCCCC  200

seq1  ACCCCCATCCCCATACTAGTTTTGTGTGAGAAGTCAAGATAAAGGCAATT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCCCATCCCCATACTAGTTTTGTGTGAGAAGTCAAGATAAAGGCAATT  250

seq1  AAACCCTCTGGGGAGCTACAAAAAAATTTTTTTAACACACGCACACACAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCCTCTGGGGAGCTACAAAAAAATTTTTTTAACACACGCACACACAC  300

seq1  AAACTCAACAGAGTTCCTTTAAAAAAAAAAAAAAACAGGAGCCAGGAGTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACTCAACAGAGTTCCTTTAAAAAAAAAAAAAAACAGGAGCCAGGAGTT  350

seq1  TGATATTTAACAAGTTTGGCCAGCCAGTGTTTTAAATTCTAACTTGGCAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATATTTAACAAGTTTGGCCAGCCAGTGTTTTAAATTCTAACTTGGCAG  400

seq1  TCCATAGACCATTAGCAACTCATCCGGGCTGAGACATGAGCCAGGCTGGG  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATAGACCATTAGCAACTCATCCGGGCTGAGACATGAGCCAGGCTGGG  450

seq1  GACAGGGGAAAACACAACACAGAGGTGTTTAAACCATGCTTTGAGCCTAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGGGGAAAACACAACACAGAGGTGTTTAAACCATGCTTTGAGCCTAA  500

seq1  AGGAGAATGCAGCAGACTAAATAAGAACATCTTCGCGGTAGGCTATGCGT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGAGAATGCAGCAGACTAAATAAGAACATCTTCGCGGTAGGCTATGCGT  550

seq1  TAGAGTGAGGTTGTTAGGTGGAATTC  576
      ||||||||||||||||||||||||||
seq2  TAGAGTGAGGTTGTTAGGTGGAATTC  576

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information