MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-274G15
Chromosome	X (Build37)
Map Location	36,085,535 - 36,230,686
singlet/doublet	doublet
Overlap gene	6030498E09Rik
Upstream gene	LOC622301, EG622311, Rhox6, Rhox7, Rhox8, LOC436198, Rhox9, LOC100039620, 4930525M21Rik, 4930430D24Rik, Rhox10, Rhox11, Rhox12, 1700123J19Rik, Zbtb33, 6430550H21Rik, EG665331, Atp1b4, Gm40, EG227112, Lamp2, LOC100040971, EG665352, LOC670495, Cul4b, Mcts1, C1galt1c1, EG665369
Downstream gene	LOC547171, LOC670539, LOC100039700, 1700085A12Rik, LOC100039715
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC622301 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:622301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 5 ESTs, 5 Proteins

name	EG622311 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:622311 MGI:3646282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	Rhox6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19202 MGI:1202888
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:547168 MGI:3580246
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434768 MGI:3579898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC436198 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436198
definition	gene_synonym : Rhox7-like note : reproductive homeobox 7 pseudogene pseudo : _no_value

name	Rhox9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:104384 MGI:1890128
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039620 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039620
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	4930525M21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436199 MGI:3588262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins

name	4930430D24Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194735 MGI:3588265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434769 MGI:3580249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox11 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194738 MGI:2681831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rhox12 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:382282 MGI:2685994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700123J19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73614 MGI:1920864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein

name	Zbtb33 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56805 MGI:1927290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	6430550H21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245386 MGI:3045722
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665331 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665331 MGI:3643148
definition	note : predicted gene, EG665331 pseudo : _no_value

name	Atp1b4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67821 MGI:1915071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm40 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:194740 MGI:2684886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins

name	EG227112 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:227112 MGI:3644655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 272 ESTs, 5 Proteins

name	Lamp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16784 MGI:96748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100040971 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	EG665352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665352 MGI:3644312
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC670495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Cul4b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72584 MGI:1919834
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Mcts1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:68995 MGI:1916245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C1galt1c1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59048 MGI:1913493
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665369 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665369 MGI:3647499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 115 ESTs, 5 Proteins

name	6030498E09Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:77883 MGI:1925133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC547171 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:547171
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC670539 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:670539
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039700 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	1700085A12Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78631 MGI:1925881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	LOC100039715 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039715
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC622301 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271518 GeneID:622301
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 5 ESTs, 5 Proteins product : similar to reproductive homeobox on X chromosome 2 transcript_id : XM_886726.3

name	EG622311 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271493 GeneID:622311 MGI:3646282
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG622311 transcript_id : XM_886739.2

name	Rhox6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679512 GeneID:19202 MGI:1202888
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 6 transcript_id : NM_008955.1

name	Rhox7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71480151 GeneID:547168 MGI:3580246
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 7 transcript_id : NM_001025086.1

name	Rhox8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91598892 GeneID:434768 MGI:3579898
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 8 transcript_id : NM_001004193.2

name	Rhox9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:12963858 GeneID:104384 MGI:1890128
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 9 transcript_id : NM_023894.1

name	LOC100039620 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271519 GeneID:100039620
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to reproductive homeobox on X chromosome 11 transcript_id : XM_001473213.1

name	4930525M21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407316 GeneID:436199 MGI:3588262
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 7 Proteins product : RIKEN cDNA 4930525M21 gene transcript_id : XM_975819.1

name	4930430D24Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803081 GeneID:194735 MGI:3588265
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930430D24 gene transcript_id : NM_001034856.2

name	Rhox10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206460 GeneID:434769 MGI:3580249
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 10 transcript_id : NM_001024850.2

name	Rhox11 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206457 GeneID:194738 MGI:2681831
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 11 transcript_id : NM_198598.2

name	Rhox12 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:91206459 GeneID:382282 MGI:2685994
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : reproductive homeobox 12 transcript_id : NM_001025083.2

name	1700123J19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271546 GeneID:73614 MGI:1920864
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 5 ESTs, 1 Protein product : RIKEN cDNA 1700123J19 gene transcript_id : XM_976021.2

name	Zbtb33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118442831 GeneID:56805 MGI:1927290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 33 transcript_id : NM_020256.2

name	Zbtb33 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118442829 GeneID:56805 MGI:1927290
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger and BTB domain containing 33 transcript_id : NM_001079513.1

name	6430550H21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40254260 GeneID:245386 MGI:3045722
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6430550H21 gene transcript_id : NM_172930.2

name	Atp1b4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130945 GeneID:67821 MGI:1915071
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ATPase, (Na+)/K+ transporting, beta 4 polypeptide transcript_id : NM_133690.2

name	Gm40 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271548 GeneID:194740 MGI:2684886
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins product : gene model 40, (NCBI) transcript_id : XM_111896.2

name	EG227112 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407323 GeneID:227112 MGI:3644655
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 mRNAs, 272 ESTs, 5 Proteins product : predicted gene, EG227112 transcript_id : XM_887151.2

name	Lamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63054836 GeneID:16784 MGI:96748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 2 transcript_id : NM_001017959.1

name	Lamp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:63054835 GeneID:16784 MGI:96748
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : lysosomal-associated membrane protein 2 transcript_id : NM_010685.3

name	LOC100040971 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271550 GeneID:100040971
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040971 transcript_id : XM_001475716.1

name	Cul4b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345589 GeneID:72584 MGI:1919834
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cullin 4B transcript_id : NM_028288.4

name	Mcts1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802633 GeneID:68995 MGI:1916245
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : malignant T cell amplified sequence 1 transcript_id : NM_026902.2

name	C1galt1c1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982687 GeneID:59048 MGI:1913493
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : C1GALT1-specific chaperone 1 transcript_id : NM_021550.2

name	EG665369 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407325 GeneID:665369 MGI:3647499
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 115 ESTs, 5 Proteins product : predicted gene, EG665369 transcript_id : XM_976422.1

name	6030498E09Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124286798 GeneID:77883 MGI:1925133
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6030498E09 gene transcript_id : NM_183126.2

name	1700085A12Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407330 GeneID:78631 MGI:1925881
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA 1700085A12 gene transcript_id : XM_976675.1

name	LOC622301 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94407314 GeneID:622301
definition	codon_start : 1 product : hypothetical protein protein_id : XP_891819.2

name	EG622311 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271494 GeneID:622311 MGI:3646282
definition	codon_start : 1 product : similar to reproductive homeobox on X chromosome 7 protein_id : XP_891832.2

name	Rhox6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679513 CCDS:CCDS30080.1 GeneID:19202 MGI:1202888
definition	GO_component : GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : placenta specific homeobox 1 product : reproductive homeobox on X chromosome, 6 protein_id : NP_032981.1

name	Rhox7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480152 CCDS:CCDS30081.1 GeneID:547168 MGI:3580246
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : reproductive homeobox on X chromosome 7 product : reproductive homeobox on chromosome X, 7 protein_id : NP_001020257.1

name	Rhox8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921377 CCDS:CCDS30082.1 GeneID:434768 MGI:3579898
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : homeoprotein TOX product : reproductive homeobox on X chromosome, 8 protein_id : NP_001004193.1

name	Rhox9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963859 CCDS:CCDS30083.1 GeneID:104384 MGI:1890128
definition	GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] codon_start : 1 note : placenta specific homeobox 2 product : reproductive homeobox on X chromosome, 9 protein_id : NP_076383.1

name	LOC100039620 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271520 GeneID:100039620
definition	codon_start : 1 product : similar to reproductive homeobox on X chromosome 11 protein_id : XP_001473263.1

name	4930525M21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407317 GeneID:436199 MGI:3588262
definition	codon_start : 1 product : hypothetical protein protein_id : XP_980913.1

name	4930430D24Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702197 GeneID:194735 MGI:3588265
definition	codon_start : 1 note : novel protein similar to B-cell translocation gene 1, anti-proliferative Btg1 product : hypothetical protein LOC194735 protein_id : NP_001030028.1

name	Rhox10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480140 GeneID:434769 MGI:3580249
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 note : reproductive homeobox on X chromosome 10 product : reproductive homeobox on chromosome X, 10 protein_id : NP_001020021.1

name	Rhox11 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38348444 CCDS:CCDS30086.1 GeneID:194738 MGI:2681831
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox on X chromosome, 11 protein_id : NP_941000.1

name	Rhox12 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71480146 CCDS:CCDS30087.1 GeneID:382282 MGI:2685994
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 product : reproductive homeobox on X chromosome, 12 protein_id : NP_001020254.1

name	1700123J19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271547 GeneID:73614 MGI:1920864
definition	codon_start : 1 product : hypothetical protein LOC73614 protein_id : XP_981115.2

name	Zbtb33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118442830 GeneID:56805 MGI:1927290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : zinc finger transcription factor Kaiso product : kaiso protein protein_id : NP_001072981.1

name	Zbtb33 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118442832 CCDS:CCDS30088.1 GeneID:56805 MGI:1927290
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IPI]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] [Evidence ISS]; GO:0016055 - Wnt receptor signaling pathway [Evidence IEA] codon_start : 1 note : zinc finger transcription factor Kaiso product : kaiso protein protein_id : NP_064652.2

name	6430550H21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:40254261 CCDS:CCDS30089.1 GeneID:245386 MGI:3045722
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC245386 protein_id : NP_766518.2

name	Atp1b4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526860 CCDS:CCDS30090.1 GeneID:67821 MGI:1915071
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0015078 - hydrogen ion transporter activity [Evidence IEA]; GO:0005391 - sodium:potassium-exchanging ATPase activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0006813 - potassium ion transport [Evidence IEA]; GO:0015992 - proton transport [Evidence IEA]; GO:0006814 - sodium ion transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : ATPase, Na+/K+ transporting, beta 4 polypeptide product : ATPase, (Na+)/K+ transporting, beta 4 polypeptide protein_id : NP_598451.1

name	Gm40 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271549 GeneID:194740 MGI:2684886
definition	codon_start : 1 product : similar to CDNA sequence BC049702 protein_id : XP_111896.2

name	EG227112 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83000880 GeneID:227112 MGI:3644655
definition	codon_start : 1 product : hypothetical protein protein_id : XP_892244.1

name	Lamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63054837 CCDS:CCDS30092.1 GeneID:16784 MGI:96748
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence ISS] [Evidence IDA]; GO:0005765 - lysosomal membrane [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0031088 - platelet dense granule membrane [Evidence ISS] codon_start : 1 note : isoform 1 is encoded by transcript variant 1; lysosome-associated membrane protein-2; Lamp II; lysosomal membrane glycoprotein 2 product : lysosomal membrane glycoprotein 2 isoform 1 protein_id : NP_001017959.1

name	Lamp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31543108 CCDS:CCDS30093.1 GeneID:16784 MGI:96748
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005770 - late endosome [Evidence ISS] [Evidence IDA]; GO:0005765 - lysosomal membrane [Evidence ISS]; GO:0005764 - lysosome [Evidence ISS] [Evidence IDA]; GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence ISS]; GO:0031088 - platelet dense granule membrane [Evidence ISS] codon_start : 1 note : isoform 2 is encoded by transcript variant 2; lysosome-associated membrane protein-2; Lamp II; lysosomal membrane glycoprotein 2 product : lysosomal membrane glycoprotein 2 isoform 2 protein_id : NP_034815.2

name	LOC100040971 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271551 GeneID:100040971
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475766.1

name	Cul4b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29501811 GeneID:72584 MGI:1919834
definition	codon_start : 1 exception : mismatches in translation product : cullin 4B protein_id : NP_082564.2

name	Mcts1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312175 CCDS:CCDS30094.1 GeneID:68995 MGI:1916245
definition	GO_function : GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 product : malignant T cell amplified sequence 1 protein_id : NP_081178.1

name	C1galt1c1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:10946990 CCDS:CCDS30095.1 GeneID:59048 MGI:1913493
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] codon_start : 1 product : C1GALT1-specific chaperone 1 protein_id : NP_067525.1

name	EG665369 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407326 GeneID:665369 MGI:3647499
definition	codon_start : 1 product : similar to adaptor-related protein complex 3, sigma 1 subunit protein_id : XP_981516.1

name	6030498E09Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124286799 GeneID:77883 MGI:1925133
definition	codon_start : 1 product : hypothetical protein LOC77883 protein_id : NP_898949.2

name	1700085A12Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407331 GeneID:78631 MGI:1925881
definition	codon_start : 1 product : hypothetical protein LOC78631 protein_id : XP_981769.1

name	EG665352 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665352
definition	number : 1 pseudo : _no_value

name	LOC670495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670495
definition	number : 1 pseudo : _no_value

name	LOC670495 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670495
definition	number : 2 pseudo : _no_value

name	LOC547171 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:547171
definition	number : 1 pseudo : _no_value

name	LOC670539 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670539
definition	number : 3 pseudo : _no_value

name	LOC670539 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670539
definition	number : 2 pseudo : _no_value

name	LOC670539 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:670539
definition	number : 1 pseudo : _no_value

name	LOC100039700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039700
definition	number : 2 pseudo : _no_value

name	LOC100039700 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039700
definition	number : 1 pseudo : _no_value

name	LOC100039715 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039715
definition	number : 2 pseudo : _no_value

name	LOC100039715 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039715
definition	number : 1 pseudo : _no_value

clone name	MSMg01-402L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-313N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-177B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336H18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-411K05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-057A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-290N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-393K24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-431K02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-455C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-528F05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-529M12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530I10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440F18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419F17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051M08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522A16
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-098D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-101D14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-466D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329F15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-317L23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-332O14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-139G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-346I15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-067F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-423D13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-408K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-126G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-377H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-078N10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506B01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-470E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-486F12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270F02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-096A18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081A03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-197M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-441F01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466C06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-351C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-468D20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457I20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057G05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-335A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310I12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022P05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-017G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-193O03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218A10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311E07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350D17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-311O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-176E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084G06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-240M04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-250O16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243J09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-227K05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-106M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-274G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-117F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-281D19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-212J19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-015J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347A17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146G08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-343C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-279K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030O12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331A15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020E18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034G11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-062A14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318C07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044F17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-304B07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-270J03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-268B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-182G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-328K18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-168E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-174P13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178D14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-275N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226G19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052D03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-180A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-041I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-043K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-067L17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209I05
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-274G15.b	B6Ng01-274G15.g
ACC	GA075722	GA075723
length	1,182	1,143
definition	B6Ng01-274G15.b	B6Ng01-274G15.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(36,085,535 - 36,086,740)	(36,229,529 - 36,230,686)
sequence	gaattccaggacagccaaggctacacggagaaacccctgtcttgaaaaaa aaaagaagaagcaacagaaaagagacgattctccatctactactcgaggt cacagaaaaccaggaaaaggaccctaccaggaaccttgctcttggacttt ccagcccctaaatctgtgaagaaaagctccaagttgcttaagttaggtta tggtatttctggtatagcagtctgaactgactgagacacaggccatgtaa caaaacttcctctgattcaatcctaaatgagcccacacatctttccattg ctatctgcctgcatcagcttgaactttcttttatgagaaggaaaccattt ttcttctaaccagaagctgccatcgcacatttttttctctttgaattgac acaagtatatagtctttaaagagtttttactactagtagaaactagacat aaagccccctggatatctccacctttgcactctcttcctttttctcttct cttttaacttatctctcgtagcgagaaggacaaagacatacataggggat gttggcgtgttgaacagtacagagaaatggaaggcctgatttatgtgctt ccctttgagagctacataagctgggcacagtgaactgaactgaggaagga actcttagtgcggagagagcgagcttggaaaactctggatgcagatatgt gtccttcctgcttcaggtcagtggcatagcatactttggaagagtttccg agtcttttgagaaaacaagggtggaagagaagaagggctttccctaaagt aaaatagaacaaatcaaaacaaagccaaaacaaagcagcttagtaaggac ttgagcatactgcttggctgtgtctctaaaccagggtatcacaaagggaa aagaggcatttccctatctacaacaatacatggcttggttttgatatttc aagggccttggtgcctctgctgtagcagcagatagcagttcccagtagac acagttatgtagcacagcacgagaaaaagactaaagcagcactgcacacc gtgccagaggtgggcatcctctgagacctatgctagtattactcttttgt gaaggctctgctctgtgtgagagaaaggacaatggcagtaatttgggaat gattggcaatgtgcctatatctgcagttggca	gaattcaaaatgcttaagaaaatattctctcagaatcacactgagacaac taggaactatttgcaactgacagatcatttacaaattgaaggtgagtatt ctattttagaatagtttatttaaagactgggcaataaataaataactcta tatcaaactaataataaaactttgaatggattaaaaaaagcctttgctgc taaggacatataataataaatattgaaactgggtgattaggttctcagag gttcattttactttgctttattcctgtgaaattttgaacagtttccatac aatttgttttgtttcgttttgttttgtttttcaagacagggtttctctgt gtagccctgaccattttggaactcaatctatggaccaggctggccttgaa ctcagagatccacctgcctctgcctccccggtgctggaaccaaaggcacg agccaccaccacgtggctaataaatttattttttaagattttacataaca aaggtaactttggggtcagtcctataaattgttattaatttgaaattact agcattattagagctttggctctagtttaaactttattattaaagctcct agacccgtgaacttcacaaactcagcctgcctatacttatgctagaggct agggtaattgggatcctatggagccaaaatttgttctggttctagtaaaa gtgccaagagaggggaggggagagactactgaggcaggagataaagggct agctttgaaagccaaagctgttttgatggcaacacctgctgttagttttc catttccagagggattcattatggaaagtgtcctacattctcttgcttta gatttatcagtcaccatataaactaggacactttctcgtggtcagaataa actcagctagatgggagaacccatgaggaactgtggctttggtccagtgc tttaccataatgagggaaagactttcaagtatttttgtattctggagcaa ttctcagttaatcatgtttctcatttgcctttgtgctcacagacatcttg aaggagcttgaaggtgtcaagtatgactagaaatctctgtactgatttta ctcattttttaacagagactgttttcagctagagcaagactcc
quality values	Open. Hide. 58 26 13 22 58 58 28 13 52 58 28 50 31 62 62 41 27 62 62 62 62 62 62 62 51 54 62 62 47 47 47 62 35 54 59 56 59 56 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 59 62 62 49 54 59 59 62 62 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 54 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 42 62 62 62 62 62 62 62 62 58 58 58 58 58 54 49 58 58 54 58 54 58 52 58 54 58 58 52 54 58 58 58 54 58 49 26 58 58 58 58 47 58 58 52 46 58 54 58 52 58 58 52 41 41 58 58 58 58 58 52 58 52 58 58 52 47 52 49 47 52 47 52 54 54 58 58 53 39 54 48 54 58 54 58 49 47 58 58 58 47 47 58 58 49 26 58 58 40 31 58 51 50 41 51 51 51 58 54 52 52 58 50 58 47 54 39 58 40 51 46 49 52 51 37 50 58 50 58 49 53 58 58 32 33 53 50 50 46 49 46 41 50 37 50 39 58 46 52 41 46 39 54 46 50 50 52 49 50 44 40 51 50 52 53 43 39 16 58 41 50 39 50 32 58 51 39 29 50 51 32 52 50 42 42 50 58 58 38 46 32 50 50 37 54 30 31 54 52 49 51 32 49 24 41 53 54 54 54 51 41 44 29 38 33 42 51 49 21 32 28 54 49 32 54 21 20 46 37 49 32 54 41 26 53 23 12 54 54 39 45 54 51 24 54 31 40 34 54 53 37 33 25 54 54 22 34 42 34 33 32 36 36 53 31 32 40 31 47 47 24 34 30 47 34 28 31 32 21 53 52 26 31 17 51 53 29 32 35 29 33 31 21 31 22 33 26 32 27 51 26 23 18 33 30 35 22 31 23 30 29 31 24 45 23 31 20 35 31 28 30 33 25 37 28 38 36 32 38 31 46 26 31 26 32 38 48 43 25 31 31 31 23 30 27 37 31 21 46 28 27 46 41 32 26 36 21 29 20 19 32 46 33 21 44 31 31 31 31 32 26 31 26 22 16 31 21 21 27 31 32 29 32 26 29 15 28 21 26 26 17 43 43 22 14 23 16 32 33 48 37 34 26 19 26 47 31 14 22 22 13 35 24 16 30 20 28 35 32 33 32 27 25 21 13 23 18 34 32 18 29 24 22 34 22 28 27 31 31 18 26 17 16 39 30 20 22 20 31 19 12 10 8 24 24 20 30 33 18 13 22 20 25 27 31 16 4 8 9 28 9 27 6 20 7 25 38 34 47 22 21 27 14 11 10 34 18 27 28 20 15 25 15 9 21 9 11 5 7 8 12 20 11 9 16 3 6 7 8 6 8 18 5 5 34 25 9 18 28 13 6 14 20 16 21 10 9 5 3 3 3 2 9 10 20 16 19 15 12 10 3 3 10 13 9 6 6 28 28 7 4 4 6 22 16 3 18 4 5 1 3 5 10 5 10 5 12 4 5 6 6 3 3 5 4 8 17 13 4 6 21 10 10 23 12 9 5 1 10 8 7 4 7 2 12 12 3 5 3 6 7 4 6 9 5 6 11 4 8 6 1 1 3 5 4 2 2 8 2 2 6 15 4 6 10 8 10 8 15 22 6 9 9 12	Open. Hide. 62 47 56 47 62 47 42 62 62 62 54 59 51 50 35 45 32 31 37 56 62 62 59 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 59 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 42 49 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 49 58 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 54 51 58 58 58 58 58 51 58 58 46 53 58 58 48 58 58 54 54 46 42 58 47 46 50 58 58 47 58 51 53 58 54 58 53 46 39 58 58 58 49 58 49 58 52 58 58 53 53 53 51 58 58 58 54 54 49 50 51 58 58 58 50 58 50 53 53 53 54 58 54 50 58 58 44 22 41 50 46 29 35 39 51 50 41 58 49 41 58 39 39 53 51 58 54 38 34 42 44 50 50 52 51 51 54 42 42 33 19 54 51 37 33 54 51 51 39 52 52 53 54 51 34 41 52 42 49 45 53 39 54 54 54 40 50 49 37 30 23 46 53 51 29 51 37 54 54 47 51 27 46 33 51 46 24 32 25 28 22 41 40 45 40 37 31 17 54 32 47 37 54 46 29 41 25 32 51 46 32 49 40 30 53 40 31 31 42 53 47 34 53 53 52 31 36 33 26 53 52 31 45 45 52 32 53 53 45 31 42 31 53 53 27 21 51 42 31 30 46 30 45 37 31 51 32 29 36 31 51 51 51 31 21 18 21 30 47 35 28 34 29 28 51 13 51 34 33 21 27 28 31 42 31 31 31 43 15 19 48 20 24 30 42 31 31 30 31 31 31 21 15 27 30 26 31 38 32 32 25 31 48 15 19 23 22 9 47 31 31 31 31 24 19 25 34 29 33 29 31 39 30 21 27 46 22 30 33 11 13 10 30 18 27 24 30 43 34 27 31 36 32 31 30 31 11 31 33 31 31 31 10 14 44 33 21 33 32 32 16 30 15 17 27 34 24 14 48 18 37 18 25 17 22 28 18 27 33 31 37 14 24 25 21 21 21 38 23 25 30 21 34 39 18 16 26 25 22 23 21 15 24 33 25 37 48 33 31 17 29 15 8 13 30 24 34 27 20 48 25 30 48 23 18 17 10 33 48 18 21 15 11 28 21 7 5 33 43 34 18 15 8 16 7 24 26 26 21 17 14 9 28 13 13 20 15 17 12 18 28 10 15 9 15 16 19 27 24 24 16 13 24 9 18 18 24 24 15 34 15 21 11 11 18 29 22 6 12 9 27 9 4 9 13 20 10 25 6 10 17 19 9 16 4 3 5 7 8 22 6 23 10 11 21 11 17 5 4 4 2 1 3 6 20 13 20 20 6 2 3 3 5 5 6 7 4 5 3 3 5 7 4 6 6 7 21 5 11 13 7 22 27 16 5 2 12 5 4 3 4 17 17 13 18 8 5 17 5 4 8 5 15 11 5 6 4 23 25 14 13 7 22 8 8 5 4 10 5 6 10 11 8 10 4 4 7 12

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_36085535_36086740
seq2: B6Ng01-274G15.b_32_1213

seq1  GAATTCCAGGACAGCCAAGGCTACACGGAGAAACCCCTGTCTTGAAAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCAGGACAGCCAAGGCTACACGGAGAAACCCCTGTCTTGAAAAAA  50

seq1  AAAAGAAGAAGCAACAGAAAAGAGACGATTCTCCATCTACTACTCGAGGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAGAAGCAACAGAAAAGAGACGATTCTCCATCTACTACTCGAGGT  100

seq1  CACAGAAAACCAGGAAAAGGACCCTACCAGGAACCTTGCTCTTGGACTTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAGAAAACCAGGAAAAGGACCCTACCAGGAACCTTGCTCTTGGACTTT  150

seq1  CCAGCCCCTAAATCTGTGAAGAAAAGCTCCAAGTTGCTTAAGTTAGGTTA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGCCCCTAAATCTGTGAAGAAAAGCTCCAAGTTGCTTAAGTTAGGTTA  200

seq1  TGGTATTTCTGGTATAGCAGTCTGAACTGACTGAGACACAGGCCATGTAA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTATTTCTGGTATAGCAGTCTGAACTGACTGAGACACAGGCCATGTAA  250

seq1  CAAAACTTCCTCTGATTCAATCCTAAATGAGCCCACACATCTTTCCATTG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAACTTCCTCTGATTCAATCCTAAATGAGCCCACACATCTTTCCATTG  300

seq1  CTATCTGCCTGCATCAGCTTGAACTTTCTTTTATGAGAAGGAAACCATTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATCTGCCTGCATCAGCTTGAACTTTCTTTTATGAGAAGGAAACCATTT  350

seq1  TTCTTCTAACCAGAAGCTGCCATCGCACATTTTTTTCTCTTTGAATTGAC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTTCTAACCAGAAGCTGCCATCGCACATTTTTTTCTCTTTGAATTGAC  400

seq1  ACAAGTATATAGTCTTTAAAGAGTTTTTACTACTAGTAGAAACTAGACAT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAAGTATATAGTCTTTAAAGAGTTTTTACTACTAGTAGAAACTAGACAT  450

seq1  AAAGCCCCCTGGATATCTCCACCTTTGCACTCTCTTCCTTTTTCTCTTCT  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGCCCCCTGGATATCTCCACCTTTGCACTCTCTTCCTTTTTCTCTTCT  500

seq1  CTTTTAACTTATCTCTCGTAGCGAGAAGGACAAAGACATACATAGGGGAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTTTAACTTATCTCTCGTAGCGAGAAGGACAAAGACATACATAGGGGAT  550

seq1  GTTGGCGTGTTGAACAGTACAGAGAAATGGAAGGCCTGATTTATGTGCTT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGGCGTGTTGAACAGTACAGAGAAATGGAAGGCCTGATTTATGTGCTT  600

seq1  CCCTTTGAGAGCTACATAAGCTGGGCACAGTGAACTGAACTGAGGAAGGA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTTTGAGAGCTACATAAGCTGGGCACAGTGAACTGAACTGAGGAAGGA  650

seq1  ACTCTTAGTGCGGAGAGAGCGAGCTTGGAAAACTCTGGATGCAGATATGT  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTCTTAGTGCGGAGAGAGCGAGCTTGGAAAACTCTGGATGCAGATATGT  700

seq1  GTCCTTCCTGCTTCAGGTCAGTGGCATAGCATACTTTGGAAGAGTTTCCG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTTCCTGCTTCAGGTCAGTGGCATAGCATACTTTGGAAGAGTTTCCG  750

seq1  AGTCTTTTGAGAAAACAAGGGTGGAAGAGAAGAAGGGCTTTCCCTAAAGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCTTTTGAGAAAACAAGGGTGGAAGAGAAGAAGGGCTTTCCCTAAAGT  800

seq1  AAAATAGAACAAATCAAAACAAAGCCAAAACAAAGCAGCTTAGTAAGGAC  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAGAACAAATCAAAACAAAGCCAAAACAAAGCAGCTTAGTAAGGAC  850

seq1  TTGAGCATACTGCTTGGCTGTGTCTCTAAACCAGGGTATCACAAAGGGAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGAGCATACTGCTTGGCTGTGTCTCTAAACCAGGGTATCACAAAGGGAA  900

seq1  AAGAGGCATTTCCCTATCTACAACAATACATGGCTTGGTTTTGATATTTC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGAGGCATTTCCCTATCTACAACAATACATGGCTTGGTTTTGATATTTC  950

seq1  AAGGGCCTTGGTGCCTCTGCTGTAGCAGCAGATAGCAGTTCCCAGTAGAC  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGGCCTTGGTGCCTCTGCTGTAGCAGCAGATAGCAGTTCCCAGTAGAC  1000

seq1  ACAGTTATGTAGCACAAGCACCGAAGAAAAAAGACTAAAGCAGCACTTGC  1050
      ||||||||||||||| |||| |||   ||||||||||||||||||| |||
seq2  ACAGTTATGTAGCAC-AGCA-CGA--GAAAAAGACTAAAGCAGCAC-TGC  1045

seq1  ACACCGTGGCAGGAGGTGGGCATCCTCTGAGGACCCTTATGCTAGTAATT  1100
      |||||||| || |||||||||||||||||| ||||  ||||||||||  |
seq2  ACACCGTGCCA-GAGGTGGGCATCCTCTGA-GACC--TATGCTAGTA--T  1089

seq1  TACTCTTTTGTGAAAGGCTCTGCTCTGTGTGAGAGAAAAAGACAATGGAA  1150
      |||||||||||| |||||||||||||||||||||| ||| |||||||| |
seq2  TACTCTTTTGTG-AAGGCTCTGCTCTGTGTGAGAG-AAAGGACAATGGCA  1137

seq1  AGTATAATTTGGGAGATGATTGGCAGTGTGGCCTTTTATATATCTGCAGT  1200
          |||||||||| |||||||||| |||| |      ||||||||||| 
seq2  ---GTAATTTGGGA-ATGATTGGCAATGTGCC------TATATCTGCAG-  1176

seq1  TTGGCA  1206
      ||||||
seq2  TTGGCA  1182

seq1: chrX_36229529_36230686
seq2: B6Ng01-274G15.g_62_1204 (reverse)

seq1  GGAGTCTTTGCTTCTAGCCTGAAAACAGTCTCTTGGTAAAAAATATAAAA  50
      |||||| |||| ||||| |||||||||||||| || ||||||||     |
seq2  GGAGTC-TTGC-TCTAG-CTGAAAACAGTCTC-TGTTAAAAAAT----GA  42

seq1  TAAAAATCAGGTACAGGAGGATATCTAAGTTCCATTACTTGGCCACTTCA  100
        ||||||| ||||||   ||| ||| |||  || |||||| |  |||||
seq2  GTAAAATCA-GTACAG--AGATTTCT-AGT--CA-TACTTGACACCTTCA  85

seq1  AGCTCTTCCAAGATGTTCTGTGAGCAACAAAGGCAAATGAGAAACATGAT  150
      ||||| | ||||||| ||||||||| ||||||||||||||||||||||||
seq2  AGCTCCTTCAAGATG-TCTGTGAGC-ACAAAGGCAAATGAGAAACATGAT  133

seq1  TAACTGAGAATTGCTCCAGAATAC-AAAATACTTGAAAGTCTTTCCCTCA  199
      |||||||||||||||||||||||| |||||||||||||||||||||||||
seq2  TAACTGAGAATTGCTCCAGAATACAAAAATACTTGAAAGTCTTTCCCTCA  183

seq1  TTATGGTAAAGCACTGGACCAAAGCCACAGTTCCTCATGGGTTCT-CCAT  248
      ||||||||||||||||||||||||||||||||||||||||||||| ||||
seq2  TTATGGTAAAGCACTGGACCAAAGCCACAGTTCCTCATGGGTTCTCCCAT  233

seq1  CTAGCTGAGTTTATTCTGACCACGAGAAAGTGTCCTAGTTTATATGGTGA  298
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAGCTGAGTTTATTCTGACCACGAGAAAGTGTCCTAGTTTATATGGTGA  283

seq1  CTGATAAATCTAAAGCAAGAGAATGTAGGACACTTTCCATAATGAATCCC  348
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATAAATCTAAAGCAAGAGAATGTAGGACACTTTCCATAATGAATCCC  333

seq1  TCTGGAAATGGAAAACTAACAGCAGGTGTTGCCATCAAAACAGCTTTGGC  398
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGGAAATGGAAAACTAACAGCAGGTGTTGCCATCAAAACAGCTTTGGC  383

seq1  TTTCAAAGCTAGCCCTTTATCTCCTGCCTCAGTAGTCTCTCCCCTCCCCT  448
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTCAAAGCTAGCCCTTTATCTCCTGCCTCAGTAGTCTCTCCCCTCCCCT  433

seq1  CTCTTGGCACTTTTACTAGAACCAGAACAAATTTTGGCTCCATAGGATCC  498
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTTGGCACTTTTACTAGAACCAGAACAAATTTTGGCTCCATAGGATCC  483

seq1  CAATTACCCTAGCCTCTAGCATAAGTATAGGCAGGCTGAGTTTGTGAAGT  548
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATTACCCTAGCCTCTAGCATAAGTATAGGCAGGCTGAGTTTGTGAAGT  533

seq1  TCACGGGTCTAGGAGCTTTAATAATAAAGTTTAAACTAGAGCCAAAGCTC  598
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCACGGGTCTAGGAGCTTTAATAATAAAGTTTAAACTAGAGCCAAAGCTC  583

seq1  TAATAATGCTAGTAATTTCAAATTAATAACAATTTATAGGACTGACCCCA  648
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATAATGCTAGTAATTTCAAATTAATAACAATTTATAGGACTGACCCCA  633

seq1  AAGTTACCTTTGTTATGTAAAATCTTAAAAAATAAATTTATTAGCCACGT  698
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTTACCTTTGTTATGTAAAATCTTAAAAAATAAATTTATTAGCCACGT  683

seq1  GGTGGTGGCTCGTGCCTTTGGTTCCAGCACCGGGGAGGCAGAGGCAGGTG  748
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTGGTGGCTCGTGCCTTTGGTTCCAGCACCGGGGAGGCAGAGGCAGGTG  733

seq1  GATCTCTGAGTTCAAGGCCAGCCTGGTCCATAGATTGAGTTCCAAAATGG  798
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTCTGAGTTCAAGGCCAGCCTGGTCCATAGATTGAGTTCCAAAATGG  783

seq1  TCAGGGCTACACAGAGAAACCCTGTCTTGAAAAACAAAACAAAACGAAAC  848
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAGGGCTACACAGAGAAACCCTGTCTTGAAAAACAAAACAAAACGAAAC  833

seq1  AAAACAAATTGTATGGAAACTGTTCAAAATTTCACAGGAATAAAGCAAAG  898
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAACAAATTGTATGGAAACTGTTCAAAATTTCACAGGAATAAAGCAAAG  883

seq1  TAAAATGAACCTCTGAGAACCTAATCACCCAGTTTCAATATTTATTATTA  948
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAATGAACCTCTGAGAACCTAATCACCCAGTTTCAATATTTATTATTA  933

seq1  TATGTCCTTAGCAGCAAAGGCTTTTTTTAATCCATTCAAAGTTTTATTAT  998
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGTCCTTAGCAGCAAAGGCTTTTTTTAATCCATTCAAAGTTTTATTAT  983

seq1  TAGTTTGATATAGAGTTATTTATTTATTGCCCAGTCTTTAAATAAACTAT  1048
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTTTGATATAGAGTTATTTATTTATTGCCCAGTCTTTAAATAAACTAT  1033

seq1  TCTAAAATAGAATACTCACCTTCAATTTGTAAATGATCTGTCAGTTGCAA  1098
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAAATAGAATACTCACCTTCAATTTGTAAATGATCTGTCAGTTGCAA  1083

seq1  ATAGTTCCTAGTTGTCTCAGTGTGATTCTGAGAGAATATTTTCTTAAGCA  1148
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTTCCTAGTTGTCTCAGTGTGATTCTGAGAGAATATTTTCTTAAGCA  1133

seq1  TTTTGAATTC  1158
      ||||||||||
seq2  TTTTGAATTC  1143

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information