MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-276G09
Chromosome	X (Build37)
Map Location	145,070,788 - 145,071,660
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039462, LOC666789, LOC434863, EG623995, EG624023, LOC666184, LOC100039511, LOC666812, LOC100039519, LOC434864, EG624096, LOC100039545, LOC666837, LOC100039553, LOC100034729, LOC666861, EG666864
Downstream gene	LOC434866, EG666868, EG624260, LOC434865, EG624310, Ott, LOC666888, LOC100039598, LOC100039890, LOC100039612, EG666923, EG624378, LOC100039934, LOC100039629, LOC382243
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC666789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC434863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 9 Proteins

name	EG623995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623995 MGI:3642951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG624023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 15 ESTs, 4 Proteins

name	LOC100039511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC666812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624096 MGI:3643280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins pseudo : _no_value

name	LOC666837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666837
definition	note : lysyl-tRNA synthetase pseudogene pseudo : _no_value

name	LOC100039553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100034729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666864 MGI:3648921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 8 Proteins

name	EG666868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666868 MGI:3644011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG624260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624260 MGI:3646683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 16 ESTs, 4 Proteins

name	EG624310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ott (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18422 MGI:107573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039598 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039598
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039890 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 15 ESTs, 9 Proteins

name	LOC100039612 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039612
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	EG666923 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666923 MGI:3645202
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	EG624378 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624378 MGI:3644585
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100039934 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 16 ESTs, 6 Proteins

name	LOC100039629 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039629
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC382243 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:382243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408343 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 17 ESTs, 5 Proteins product : ovary testis transcribed-like, transcript variant 1 transcript_id : XM_486785.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272432 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 1 Protein product : ovary testis transcribed-like, transcript variant 3 transcript_id : XM_897719.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272434 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : ovary testis transcribed-like transcript_id : XM_001473108.1

name	EG624023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272425 GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624023 transcript_id : XM_888549.3

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408346 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 4 transcript_id : XM_982169.1

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408350 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 2 transcript_id : XM_982089.1

name	LOC434864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126032330 GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001081648.1

name	LOC100034729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:131887312 GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001082966.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272441 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001487784.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272443 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_001487786.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272445 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_001487787.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272447 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001487785.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272451 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 5 transcript_id : XM_001487788.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272449 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 6 transcript_id : XM_001487789.1

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408362 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_486789.4

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408364 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_897890.2

name	EG624310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272430 GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624310 transcript_id : XM_888852.2

name	Ott (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859585 GeneID:18422 MGI:107573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed transcript_id : NM_011022.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272457 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 5 Proteins product : similar to ovary testis transcribed, transcript variant 1 transcript_id : XM_001473712.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272459 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to ovary testis transcribed, transcript variant 2 transcript_id : XM_001473728.1

name	LOC100039890 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272461 GeneID:100039890
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 15 ESTs, 1 Protein product : similar to ovary testis transcribed, transcript variant 3 transcript_id : XM_001473747.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272465 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : similar to Ott protein, transcript variant 1 transcript_id : XM_001473791.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272467 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 1 Protein product : similar to Ott protein, transcript variant 2 transcript_id : XM_001473809.1

name	LOC100039934 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272469 GeneID:100039934
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 15 ESTs, 4 Proteins product : similar to Ott protein, transcript variant 3 transcript_id : XM_001473830.1

name	LOC382243 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:130507580 GeneID:382243
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed like transcript_id : NM_001037716.2

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772467 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 1 protein_id : XP_486785.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272433 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 3 protein_id : XP_902812.3

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272435 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 protein_id : XP_001473158.1

name	EG624023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272426 GeneID:624023 MGI:3644694
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893642.3

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408347 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 4 protein_id : XP_987263.1

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408351 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 2 protein_id : XP_987183.1

name	LOC434864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:126032331 GeneID:434864
definition	codon_start : 1 product : hypothetical protein LOC434864 protein_id : NP_001075117.1

name	LOC100034729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:131887313 GeneID:100034729
definition	codon_start : 1 product : hypothetical protein LOC100034729 protein_id : NP_001076435.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272442 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487834.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272446 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001487837.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272444 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001487836.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272448 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487835.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272452 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_001487838.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272450 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 6 protein_id : XP_001487839.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772471 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 1 protein_id : XP_486789.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408365 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 4 protein_id : XP_902983.2

name	EG624310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272431 GeneID:624310 MGI:3644796
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893945.2

name	Ott (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859586 GeneID:18422 MGI:107573
definition	codon_start : 1 product : ovary testis transcribed protein_id : NP_035152.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272458 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001473762.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272462 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001473797.1

name	LOC100039890 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272460 GeneID:100039890
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001473778.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272466 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 1 protein_id : XP_001473841.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272468 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 2 protein_id : XP_001473859.1

name	LOC100039934 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272470 GeneID:100039934
definition	codon_start : 1 product : similar to Ott protein isoform 3 protein_id : XP_001473880.1

name	LOC382243 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:130507581 GeneID:382243
definition	codon_start : 1 product : ovary testis transcribed like protein_id : NP_001032805.2

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 1 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 2 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 3 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 4 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 5 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 1 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 2 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 3 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 4 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 5 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 7 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 2 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 2 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 3 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 4 pseudo : _no_value

name	LOC666812 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666812
definition	number : 1 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 2 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 1 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 2 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 1 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 2 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 1 pseudo : _no_value

name	LOC666861 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666861
definition	number : 1 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 2 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 1 pseudo : _no_value

name	EG666868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666868
definition	number : 1 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 2 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 1 pseudo : _no_value

name	LOC666888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666888
definition	number : 1 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 2 pseudo : _no_value

name	LOC100039598 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039598
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 1 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 2 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 3 pseudo : _no_value

name	LOC100039612 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039612
definition	number : 4 pseudo : _no_value

name	EG666923 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666923
definition	number : 1 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 2 pseudo : _no_value

name	EG624378 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624378
definition	number : 1 pseudo : _no_value

name	LOC100039629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039629
definition	number : 2 pseudo : _no_value

name	LOC100039629 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039629
definition	number : 1 pseudo : _no_value

name	LOC100039545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272427 GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins product : similar to Ott protein pseudo : _no_value transcript_id : XR_031018.1

clone name	MSMg01-541N09
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-256G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-073K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-018I18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-061H03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272G11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040B03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171M09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215I06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-075O03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-273M02
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-276G09.b	B6Ng01-276G09.g
ACC	GA077190	GA077191
length	874	404
definition	B6Ng01-276G09.b	B6Ng01-276G09.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattccccaaaacaagatttagggcaagaggatcttaaatttgagggca gcctggttatataggaattagtacaaaagtcagttaggcttcctttgata tttgttgcaaaaggcctcatgtatggctgctagtggctctgggttatgca ttcttataatagggcttcatgtcagtaatcactacagaaaaaaaaaatta gacattgtctcatgtatccaaggctggctttaatctcattgtatacatga agatggctttgaactttggatactcttgcctctacctcctgagtgctggg gttgcagacatagaccagtaaacctgctattatgcatttctgggtaatga actaagagattcatacatgttagacagtataacaactggactatatcact agtctaagaaggaagtttttattgtgtaggtaaagaaatcttagggacaa ggtttatcatatacagtttcactttgccataaaacaacaaatgtccaaag gctgtgttgctcttttggtataataatttgagttgctgtagtgagtagtt ctgcataagcaaggtacgttctgtaaccactttctgtcttgttataaata ctgttccttttaggctttgggtggactaaagaatgtttgaggaggggata ggagttcaatgttagttcaatgttagtaatatttatcaattagataaata ttactttccttcctccccttccttttcctctccctccatccttgcctccc tccctattttttcagtgctaaccatggaactcagagctagaaaattctag gcaagcactctactgattactttcatattagtttccttataaaaaattcc cttccttccttccttcctttcctt	tttgttcagttctgagccccattttttaatggggttatttgattttctga agtccaccttcttgagttctttatatatgttggatattagtcccctatct ggtttatgataggtaaagatcctttcccaatctgttggtagtctttttgt cttactgacggtgtcttttgccttgcagaaactttggagtttcattaggt cccatttgtcaattctcgatcttacagtacaagccattgctgttctgttc aggaatttttcctctgtgcccatatcttcaaggcttttccccactttctc ctctataagtttcagtgtctctggttttatgtgaagttcttttatatgcc ccagtacaggggaacaccagggccaaaaagggggagtgggtgggtagggg agtg
quality values	Open. Hide. 58 26 27 26 58 58 58 58 41 39 58 58 62 42 30 49 62 38 33 62 62 54 62 62 49 62 62 62 62 54 54 62 31 25 31 25 21 21 21 28 35 28 34 33 38 50 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 59 62 62 62 62 62 62 59 59 50 56 59 33 34 54 59 59 56 62 59 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 47 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 54 52 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 54 58 54 58 54 58 52 58 52 52 54 58 58 58 58 58 54 58 52 58 51 58 58 58 58 58 58 58 51 58 54 51 58 41 46 51 53 52 58 58 50 58 58 58 58 58 58 54 54 48 58 58 54 52 31 49 50 58 58 51 51 58 53 46 58 58 58 22 40 52 58 58 46 58 51 32 39 40 58 58 51 58 28 48 41 18 58 39 33 29 30 53 52 58 58 26 58 52 53 39 46 50 58 39 50 51 37 46 51 50 52 51 49 58 35 51 51 39 53 51 49 52 38 35 54 46 46 53 45 47 49 53 53 53 25 53 42 42 54 54 53 39 31 41 51 42 51 54 45 54 54 37 47 35 51 35 40 54 54 51 46 51 42 41 44 54 54 45 52 54 53 54 47 37 54 54 47 42 35 42 37 49 54 47 32 41 52 54 53 45 53 47 38 32 49 49 26 45 40 53 53 53 53 32 34 32 39 39 47 40 52 32 33 41 43 32 32 40 32 30 40 31 45 31 26 30 33 11 41 43 31 16 33 51 46 23 25 38 43 31 31 15 38 27 26 39 30 37 36 41 43 45 38 21 26 27 35 31 31 31 31 33 21 47 46 29 31 31 30 42 30 43 24 28 31 16 15 22 25 27 37 31 46 47 46 46 47 22 15 38 24 46 31 30 39 32 30 24 41 41 36 32 31 19 29 33 31 24 39 16 31 16 9 17 9 11	Open. Hide. 62 49 62 62 62 30 39 10 18 30 34 32 28 32 37 46 56 59 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 59 59 59 48 32 38 56 46 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 42 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 46 49 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 54 62 27 24

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_145070788_145071660
seq2: B6Ng01-276G09.b_46_919 (reverse)

seq1  AAGG-AAGGAAGGAAGGAAGGAAGGGAATTTTTTATAAGGAAACTAATAT  49
      |||| |||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAAGGAAGGAAGGAAGGAAGGGAATTTTTTATAAGGAAACTAATAT  50

seq1  GAAAGTAATCAGTAGAGTGCTTGCCTAGAATTTTCTAGCTCTGAGTTCCA  99
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAGTAATCAGTAGAGTGCTTGCCTAGAATTTTCTAGCTCTGAGTTCCA  100

seq1  TGGTTAGCACTGAAAAAATAGGGAGGGAGGCAAGGATGGAGGGAGAGGAA  149
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTAGCACTGAAAAAATAGGGAGGGAGGCAAGGATGGAGGGAGAGGAA  150

seq1  AAGGAAGGGGAGGAAGGAAAGTAATATTTATCTAATTGATAAATATTACT  199
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGAAGGGGAGGAAGGAAAGTAATATTTATCTAATTGATAAATATTACT  200

seq1  AACATTGAACTAACATTGAACTCCTATCCCCTCCTCAAACATTCTTTAGT  249
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATTGAACTAACATTGAACTCCTATCCCCTCCTCAAACATTCTTTAGT  250

seq1  CCACCCAAAGCCTAAAAGGAACAGTATTTATAACAAGACAGAAAGTGGTT  299
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACCCAAAGCCTAAAAGGAACAGTATTTATAACAAGACAGAAAGTGGTT  300

seq1  ACAGAACGTACCTTGCTTATGCAGAACTACTCACTACAGCAACTCAAATT  349
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACAGAACGTACCTTGCTTATGCAGAACTACTCACTACAGCAACTCAAATT  350

seq1  ATTATACCAAAAGAGCAACACAGCCTTTGGACATTTGTTGTTTTATGGCA  399
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATACCAAAAGAGCAACACAGCCTTTGGACATTTGTTGTTTTATGGCA  400

seq1  AAGTGAAACTGTATATGATAAACCTTGTCCCTAAGATTTCTTTACCTACA  449
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGAAACTGTATATGATAAACCTTGTCCCTAAGATTTCTTTACCTACA  450

seq1  CAATAAAAACTTCCTTCTTAGACTAGTGATATAGTCCAGTTGTTATACTG  499
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAATAAAAACTTCCTTCTTAGACTAGTGATATAGTCCAGTTGTTATACTG  500

seq1  TCTAACATGTATGAATCTCTTAGTTCATTACCCAGAAATGCATAATAGCA  549
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAACATGTATGAATCTCTTAGTTCATTACCCAGAAATGCATAATAGCA  550

seq1  GGTTTACTGGTCTATGTCTGCAACCCCAGCACTCAGGAGGTAGAGGCAAG  599
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTTTACTGGTCTATGTCTGCAACCCCAGCACTCAGGAGGTAGAGGCAAG  600

seq1  AGTATCCAAAGTTCAAAGCCATCTTCATGTATACAATGAGATTAAAGCCA  649
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTATCCAAAGTTCAAAGCCATCTTCATGTATACAATGAGATTAAAGCCA  650

seq1  GCCTTGGATACATGAGACAATGTCTAATTTTTTTTTTCTGTAGTGATTAC  699
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTGGATACATGAGACAATGTCTAATTTTTTTTTTCTGTAGTGATTAC  700

seq1  TGACATGAAGCCCTATTATAAGAATGCATAACCCAGAGCCACTAGCAGCC  749
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGACATGAAGCCCTATTATAAGAATGCATAACCCAGAGCCACTAGCAGCC  750

seq1  ATACATGAGGCCTTTTGCAACAAATATCAAAGGAAGCCTAACTGACTTTT  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACATGAGGCCTTTTGCAACAAATATCAAAGGAAGCCTAACTGACTTTT  800

seq1  GTACTAATTCCTATATAACCAGGCTGCCCTCAAATTTAAGATCCTCTTGC  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTAATTCCTATATAACCAGGCTGCCCTCAAATTTAAGATCCTCTTGC  850

seq1  CCTAAATCTTGTTTTGGGGAATTC  873
      ||||||||||||||||||||||||
seq2  CCTAAATCTTGTTTTGGGGAATTC  874

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information