MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-277O05
Chromosome	X (Build37)
Map Location	74,241,897 - 74,243,080
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC385472, LOC100041147, EG238829, Magea7, 4930428D18Rik, EG544974, 4930468A15Rik
Downstream gene	LOC385474, EG436208, LOC546331, LOC100041212, Tbl1x, EG628893, LOC667606, Prkx, Pbsn, OTTMUSG00000017866, LOC100042001, 5430402E10Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC385472 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385472
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC100041147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	EG238829 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:238829 MGI:3648293
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Magea7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17143 MGI:1333836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins

name	4930428D18Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:619294 MGI:3588232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG544974 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:544974 MGI:3644190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins

name	4930468A15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74987 MGI:1922237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins

name	LOC385474 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385474
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG436208 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436208 MGI:3644663
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC546331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 462 ESTs, 17 Proteins pseudo : _no_value

name	LOC100041212 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041212
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Tbl1x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:21372 MGI:1336172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG628893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628893 MGI:3645962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	LOC667606 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins pseudo : _no_value

name	Prkx (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19108 MGI:1309999
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Pbsn (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54192 MGI:1860484
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	OTTMUSG00000017866 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:628923 MGI:3709306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	LOC100042001 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein pseudo : _no_value

name	5430402E10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71351 MGI:1918601
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271707 GeneID:100041147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041147 transcript_id : XM_001475884.1

name	EG238829 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377390 GeneID:238829 MGI:3648293
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG238829 transcript_id : NM_001013760.2

name	Magea7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271767 GeneID:17143 MGI:1333836
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins product : melanoma antigen, family A, 7 transcript_id : XM_001481307.1

name	4930428D18Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142365301 GeneID:619294 MGI:3588232
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930428D18 gene transcript_id : NM_001033799.2

name	EG544974 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001663 GeneID:544974 MGI:3644190
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins product : predicted gene, EG544974 transcript_id : XM_484337.2

name	4930468A15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407580 GeneID:74987 MGI:1922237
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 4 Proteins product : RIKEN cDNA 4930468A15 gene transcript_id : XM_135954.3

name	Tbl1x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348182 GeneID:21372 MGI:1336172
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transducin (beta)-like 1 X-linked transcript_id : NM_020601.2

name	EG628893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83001674 GeneID:628893 MGI:3645962
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG628893 transcript_id : XM_893693.1

name	Prkx (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23956079 GeneID:19108 MGI:1309999
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protein kinase, X-linked transcript_id : NM_016979.1

name	Pbsn (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142369561 GeneID:54192 MGI:1860484
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : probasin transcript_id : NM_017471.2

name	OTTMUSG00000017866 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407583 GeneID:628923 MGI:3709306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : predicted gene, OTTMUSG00000017866 transcript_id : XM_486715.3

name	5430402E10Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352770 GeneID:71351 MGI:1918601
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 5430402E10 gene transcript_id : NM_027768.2

name	LOC100041147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271708 GeneID:100041147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475934.1

name	EG238829 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:62000638 GeneID:238829 MGI:3648293
definition	codon_start : 1 note : novel protein similar to 1700042B14Rik product : hypothetical protein LOC238829 protein_id : NP_001013782.1

name	Magea7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271768 GeneID:17143 MGI:1333836
definition	codon_start : 1 exception : unclassified translation discrepancy note : overriding stop codons product : melanoma antigen, family A, 7 protein_id : XP_001481357.1 transl_except : (pos:73592973..73592975,aa:OTHER) transl_except : (pos:73593540..73593542,aa:OTHER) transl_except : (pos:73593627..73593629,aa:OTHER)

name	4930428D18Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702129 GeneID:619294 MGI:3588232
definition	GO_component : GO:0005923 - tight junction [Evidence IEA] GO_function : GO:0005198 - structural molecule activity [Evidence IEA] codon_start : 1 product : hypothetical protein LOC619294 protein_id : NP_001028971.1

name	EG544974 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001664 GeneID:544974 MGI:3644190
definition	codon_start : 1 product : similar to Predicted gene, EG238829 protein_id : XP_484337.2

name	4930468A15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20984390 GeneID:74987 MGI:1922237
definition	codon_start : 1 product : hypothetical protein LOC74987 protein_id : XP_135954.1

name	Tbl1x (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33468969 GeneID:21372 MGI:1336172
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IDA] GO_function : GO:0003682 - chromatin binding [Evidence IDA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006357 - regulation of transcription from RNA polymerase II promoter [Evidence IGI]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 note : transducin (beta)-like 1 product : transducin (beta)-like 1 X-linked protein_id : NP_065626.1

name	EG628893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001675 GeneID:628893 MGI:3645962
definition	codon_start : 1 product : hypothetical protein protein_id : XP_898786.1

name	Prkx (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956080 CCDS:CCDS30248.1 GeneID:19108 MGI:1309999
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence ISS] [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : putative serine/threonine kinase product : protein kinase, X-linked protein_id : NP_058675.1

name	Pbsn (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:8567372 CCDS:CCDS30249.1 GeneID:54192 MGI:1860484
definition	GO_function : GO:0005488 - binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 product : probasin protein_id : NP_059499.1

name	OTTMUSG00000017866 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772133 GeneID:628923 MGI:3709306
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486715.1

name	5430402E10Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:89001098 GeneID:71351 MGI:1918601
definition	GO_function : GO:0005549 - odorant binding [Evidence IEA]; GO:0005215 - transporter activity [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : novel protein similar to odorant binding protein I f Obp1f product : hypothetical protein LOC71351 protein_id : NP_082044.1

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 1 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 2 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 3 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 4 pseudo : _no_value

name	LOC385472 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385472
definition	number : 5 pseudo : _no_value

name	LOC385474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385474
definition	number : 2 pseudo : _no_value

name	LOC385474 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385474
definition	number : 1 pseudo : _no_value

name	EG436208 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436208
definition	number : 1 pseudo : _no_value

name	LOC100041212 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041212
definition	number : 1 pseudo : _no_value

name	LOC546331 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271769 GeneID:546331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 462 ESTs, 17 Proteins product : similar to high-mobility group box 1 pseudo : _no_value transcript_id : XR_033233.1

name	LOC667606 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271711 GeneID:667606
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 5 Proteins product : similar to ATP synthase gamma-subunit pseudo : _no_value transcript_id : XR_032530.1

name	LOC100042001 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271770 GeneID:100042001
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 1 Protein product : hypothetical protein LOC100042001 pseudo : _no_value transcript_id : XR_033262.1

clone name	MSMg01-466J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-302H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-346H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-399N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305B16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-182P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-206P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-137O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148A17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-309O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498K16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-522N18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-495C18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-359N10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485F10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-331K10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440H11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337L09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159J18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518L06
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-426K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-372H04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-070E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-057A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181H23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-092H11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156J12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021G01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-170E16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-266A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-178L19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065M09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-317J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-302L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-030F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-247D20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110M07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328E08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-277O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-209F13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-182M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301B05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-191I13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-248L02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-098G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-210O22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-241M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-200A08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-167J11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295K07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267D02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-020D23
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-277O05.b	B6Ng01-277O05.g
ACC	GA078283	GA078284
length	1,171	1,190
definition	B6Ng01-277O05.b	B6Ng01-277O05.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattcaaggcacagacctaaacatgataaaagcaatcaacatcaaacca gtagccaacatcaaagtaaatggtgagaagctggaagcaatcccactgaa atcagggactagacaaggatgaccaatttctccctacctattcaatatag cacatgaaatcctagccagagcaattcgacaacaaaaggagatcaagggg attcaaattttaaaggaagaagtcaaaatatcactatgtacagatcatat gatagaatatataagtgaccctaaaaattccaccaaagaattcctaaaca tgataaacagcttcagcacagtagcgggatataaaattaactcaaactaa tcactggcctttctctaggattaatatagtcaaaatggctatcctgcaga aagcaatctacagattcaatgcaatccccaccaaaattccaactcaattc ttcactgagttagaaagggcaatttgcaaattcatctggtataacaaaaa aactaggatagcaaaaactattctcaacaataaaagaatctctgggggaa tgcctcaagctgtactacagagcaattgtgataaaaactacatggtactt ggatagtgacagacaagtagaccaatggaatagaattgaagattcagaaa tgaacccacatacctatggtcacttgatctttgacaagggagctaaaatc atccagtggaaaaaggacagcattttcaacaaatggtgctggcacaactg gcagttatcatgtagaagaatgcaaattgatccattcttctctccttgta ctaaggtcaaatctaagtggatcgaggaactccacataaaagcagaaaca ctgaaagttacagaggagaaattgggggaaagccttgacgatatgggcac aggagaaaaatttcttaatagaacatcaatggcttgtgatatagatcaga atagacaaatggactcataaaattgaaaagcttctgtagcagacactgtc aatagacaaaatgccaccacagatgggaagattctttcctatctaatcag atagggactaatatccatatatatattgactcagatgtagacttcggaaa atcaggtaactcataaaatggctcagctacagattctcacctggaaaata cgaatatgtgcgtgtgaaagc	gaattccaaggcttttactggatatagaaaggttttctactcatattgaa aaatgtgttaataccagaaaatcaaaatcctttaatatttttgggttatg catgcctcagcatgaaagcatcagcaagtataaaatcaaaatatggatcg accctgagaagttgaacatgtacctcctgccatatctgaaactcatccaa catttaattgtgtatgtgaaaataaacaagcacatctatctcatcagtga actggttttagtcattttttttgtaaagccagagttatacctataccaaa gaaatgttttaaattaaaattctttatgatttactctgacatgtacacaa tgtatatgaaccattcttatccatctctgccattactttctacccatcct cagccctttctaagccttcaactatgacctgtatatattatatgtagctt cattgagaaagaatgacattatagttatatcattgtcattagatgatgga gagcacagatgagaatccgtttaacaaatattaggtggaatgttgaccat tttgtctatttatctttttaaaataaatatacttcatttttatagttttt taagggaaagtaaaaaacatggttttgttttgttttttgtttttttgttt ttttcttgtttgtatgaatttgaaggctggaaaatcagaacaatacacat gacttctgacacttggaattcaattttattaaatctttgaattaggggca taatgataactagacagtctttctgtttattgctattaaaaatagatggc tataaaaatagatggatcatatagccttgtagataggaaattattaatta cttcattttaaaattaaattaattaattttgttaattcattaggactgct tcatttatttggtgttttaaaaattattattatttgctacatccactcca gtagtgaccgggattgaataggctttaaaaaacctggaacgaagtcccaa ggtgaaaaggttccacggaaacttagtctcctggaaccatgcatcccggt atatgaatgcctccaattttgtctcgtgaatggatctgtgtgctttcttt cagatgtttaaataataaggtgcctcagcatgacttgcgaataacctaag ccaagttgaactttgccttccctaagccttctcccaatgc
quality values	Open. Hide. 58 31 16 26 58 28 14 47 62 62 54 42 62 39 47 47 62 62 62 56 56 56 42 42 54 62 44 44 62 62 62 62 42 45 34 28 35 35 28 32 50 59 62 59 59 62 62 62 59 59 54 54 62 62 62 59 51 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 54 59 59 62 62 54 54 62 62 62 62 54 54 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 49 62 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 47 39 62 62 62 62 36 56 62 62 62 62 62 62 62 62 62 49 35 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 54 54 58 54 58 52 54 58 58 58 58 58 54 58 58 58 58 54 33 54 54 48 58 58 58 58 58 58 58 58 39 54 58 58 58 58 58 58 58 58 58 58 39 42 54 41 47 52 45 54 52 54 58 58 54 52 52 38 41 52 58 52 52 58 48 58 58 51 49 58 58 58 58 58 50 47 58 58 58 58 58 50 50 58 47 47 49 58 50 49 47 47 58 58 58 42 39 50 58 54 58 49 50 42 50 58 50 50 51 52 58 54 46 38 20 24 29 48 54 58 58 58 40 51 58 50 58 46 42 58 51 58 51 46 38 26 49 53 39 31 58 58 35 50 58 51 52 51 41 44 31 51 41 54 50 54 41 44 52 50 58 43 43 50 40 44 58 52 43 33 37 50 50 58 49 51 47 49 27 49 47 51 51 54 37 42 44 37 54 54 49 52 39 32 53 40 39 30 38 45 54 51 51 54 54 49 50 41 54 42 39 37 42 52 37 49 35 49 41 34 27 47 27 18 54 40 32 54 52 37 52 40 42 45 54 33 34 42 16 40 37 42 41 49 35 45 34 40 52 34 32 34 31 45 53 45 34 21 51 53 29 49 21 25 41 31 31 52 41 47 32 52 31 45 26 32 13 42 53 45 31 37 32 38 36 32 32 31 30 31 45 27 28 36 33 17 40 34 51 19 27 18 47 34 30 30 30 25 45 28 37 30 29 32 32 32 29 42 31 30 32 32 31 35 24 29 14 36 20 41 35 46 46 42 22 42 31 31 46 40 29 32 17 32 31 30 35 47 31 26 31 37 35 41 24 30 41 19 31 34 12 39 46 31 28 32 30 41 46 46 26 28 47 34 23 26 20 21 29 26 31 31 10 38 23 13 21 18 43 35 25 26 31 29 27 29 25 13 42 48 48 48 31 31 48 34 32 16 37 18 26 21 31 22 30 20 25 27 38 32 8 18 21 21 26 7 18 27 32 21 31 34 27 32 12 25 6 18 27 21 16 4 11 30 29 22 27 32 15 14 37 12 29 20 19 11 9 4 14 27 21 26 34 43 21 13 22 25 26 47 47 25 18 16 20 9 26 16 27 13 14 3 5 24 6 18 11 16 27 24 14 9 12 26 4 5 16 5 10 7 11 27 34 20 11 3 3 4 5 10 3 5 3 3 7 22 25 18 34 18 23 20 11 9 15 4 5 13 28 16 20 23 11 11 15 6 13 3 6 9 12 7 5 16 16 8 17 17 17 6 10 16 13 9 8 5 18 8 11 12 3 7 7 5 4 5 11 8 6 3 4 3 5 11 6 16 7 4 6 15 3 7 7 25 15 6 5 3 1 4 10 30 16 11 9 12 22 5 6 19 9 7 13 4 17 5 7 14 17 8 8 2 9 5 1 2 1 2 1 2 4 24 7 2 1 9 4 4 4 6 5 8 13 13 11 10 7 13 15 26 7 10 4 18 4 6 6 4 6 4 14 5 4 16 6 8 6 4 4 6 4 3 3 6	Open. Hide. 62 47 56 47 62 62 42 24 54 62 62 42 36 27 32 22 21 24 32 38 49 44 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 56 56 62 59 62 59 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 59 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 43 46 62 62 56 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 54 62 62 62 62 62 62 62 62 58 58 54 49 58 58 58 54 58 54 54 58 58 58 54 58 45 58 58 58 54 58 58 58 54 54 58 58 54 58 54 58 58 58 54 54 58 54 58 58 58 42 54 54 58 58 58 58 58 58 58 58 52 58 58 58 54 54 54 58 58 58 58 37 49 58 58 54 54 51 58 54 54 58 52 51 58 58 58 47 49 51 58 58 58 50 53 50 49 58 51 58 58 58 58 50 50 48 49 49 39 58 58 58 49 51 49 58 58 58 58 50 53 53 49 58 58 58 58 58 58 58 58 58 58 58 58 53 58 58 58 58 58 44 42 58 51 58 58 58 53 54 52 58 58 58 58 58 52 58 53 58 58 31 58 52 58 34 54 41 50 58 52 41 51 51 41 58 50 30 58 37 52 58 43 43 58 58 50 34 51 35 18 58 26 40 22 47 50 40 44 50 51 45 53 51 37 37 54 52 52 51 49 41 25 32 52 42 35 30 35 46 39 34 40 37 37 25 22 54 54 30 39 35 37 32 54 37 40 39 53 54 53 37 42 32 52 41 37 29 54 51 36 28 37 45 37 37 37 53 32 41 20 40 52 53 40 37 33 32 31 47 37 52 52 53 42 32 34 38 23 53 45 32 53 35 35 29 34 31 28 53 35 53 53 53 31 32 32 32 53 32 47 30 24 26 34 40 31 49 47 51 12 14 40 33 38 35 35 38 29 31 39 38 42 31 42 34 30 18 20 12 26 30 24 30 26 31 26 31 30 39 51 51 32 26 24 27 11 31 30 27 25 31 27 31 31 33 30 26 42 46 46 23 17 46 46 32 22 24 25 46 31 31 27 29 41 37 42 25 30 33 48 46 32 32 10 10 25 14 12 38 25 22 24 33 28 19 11 31 30 31 32 31 48 16 25 14 20 47 31 31 31 48 29 32 39 22 31 13 41 36 24 24 44 48 48 27 18 11 30 21 24 31 14 30 31 25 44 38 31 34 26 10 13 9 29 28 38 19 21 26 20 21 10 13 27 32 22 22 32 26 21 25 7 37 17 33 21 25 8 10 6 7 22 16 22 19 10 47 14 33 43 47 47 48 32 19 23 32 27 32 15 24 18 19 30 25 14 29 27 31 24 7 10 22 6 7 11 21 28 33 38 10 11 28 20 9 7 5 6 6 17 13 21 19 4 5 16 16 5 6 9 5 4 8 15 6 3 7 18 8 14 17 20 9 24 5 17 20 33 26 6 13 11 7 6 8 6 14 11 15 6 14 13 10 11 6 29 6 19 3 20 28 8 9 7 20 7 14 4 4 9 11 17 7 16 14 8 12 5 5 12 8 12 7 18 14 15 28 19 16 5 17 16 14 7 3 2 2 3 3 15 5 22 18 5 6 17 9 4 3 5 21 24 4 9 7 17 7 11 10 5 8 13 5 6 6 6 8 7 6 3 2 3 7 6 4 6 12 15 4 6 13 12 6 5 22 22 5 2 4 6 21 22 10 11 16 8 4 7 8 21 12 7 4 6 4 4 9 4 2 3 2 3 9 5 6 18 4 2 2 3 6 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_74241897_74243080
seq2: B6Ng01-277O05.g_67_1256 (reverse)

seq1  GCATT-GGAGAAGGC-TAGG--AAGCAAAGTTCAACTTTGCTTAGGTATT  46
      ||||| ||||||||| ||||  | |||||||||||||| ||||||||  |
seq2  GCATTGGGAGAAGGCTTAGGGAAGGCAAAGTTCAACTTGGCTTAGGTTAT  50

seq1  TGGCAAGTCATTGCTTGGAGGCACC-TATTATTAAACAATACTGAAAGAA  95
      | |||||||| ||||  |||||||| ||||||| ||  || |||||||||
seq2  TCGCAAGTCA-TGCT--GAGGCACCTTATTATTTAAACAT-CTGAAAGAA  96

seq1  AGCACACAGATCCATTCACGAGGACAAATTTGGA-GCATTCATTATA-CG  143
      ||||||||||||||||||||| |||||| ||||| ||||||| |||| ||
seq2  AGCACACAGATCCATTCACGA-GACAAAATTGGAGGCATTCA-TATACCG  144

seq1  GGATGGCATGGTTCCAGGAGACTAAGTTTCCGTG--AACTTTTCACCTTG  191
      |||| |||||||||||||||||||||||||||||  | ||||||||||||
seq2  GGAT-GCATGGTTCCAGGAGACTAAGTTTCCGTGGAACCTTTTCACCTTG  193

seq1  GGACTTCG-TCCAGGTTTTTT-AAGCCTA-TCAAT-CCGGTCACTACTGG  237
      |||||||| |||||||||||| ||||||| ||||| ||||||||||||||
seq2  GGACTTCGTTCCAGGTTTTTTAAAGCCTATTCAATCCCGGTCACTACTGG  243

seq1  AGTGGATGTAGCAAATAATAATAATTTTTAAAACACCAAATAAATGAAGC  287
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGGATGTAGCAAATAATAATAATTTTTAAAACACCAAATAAATGAAGC  293

seq1  AGTCCTAATGAATTAACAAAATTAATTAATTTAATTTTAAAATGAAGTAA  337
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTCCTAATGAATTAACAAAATTAATTAATTTAATTTTAAAATGAAGTAA  343

seq1  TTAATAATTTCCTATCTACAAGGCTATATGATCCATCTATTTTTATAGCC  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAATAATTTCCTATCTACAAGGCTATATGATCCATCTATTTTTATAGCC  393

seq1  ATCTATTTTTAATAGCAATAAACAGAAAGACTGTCTAGTTATCATTATGC  437
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTATTTTTAATAGCAATAAACAGAAAGACTGTCTAGTTATCATTATGC  443

seq1  CCCTAATTCAAAGATTTAATAAAATTGAATTCCAAGTGTCAGAAGTCATG  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTAATTCAAAGATTTAATAAAATTGAATTCCAAGTGTCAGAAGTCATG  493

seq1  TGTATTGTTCTGATTTTCCAGCCTTCAAATTCATACAAACAAGAAAAAAA  537
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTGTTCTGATTTTCCAGCCTTCAAATTCATACAAACAAGAAAAAAA  543

seq1  CAAAAAAACAAAAAACAAAACAAAACCATGTTTTTTACTTTCCCTTAAAA  587
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAAAAACAAAAAACAAAACAAAACCATGTTTTTTACTTTCCCTTAAAA  593

seq1  AACTATAAAAATGAAGTATATTTATTTTAAAAAGATAAATAGACAAAATG  637
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTATAAAAATGAAGTATATTTATTTTAAAAAGATAAATAGACAAAATG  643

seq1  GTCAACATTCCACCTAATATTTGTTAAACGGATTCTCATCTGTGCTCTCC  687
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCAACATTCCACCTAATATTTGTTAAACGGATTCTCATCTGTGCTCTCC  693

seq1  ATCATCTAATGACAATGATATAACTATAATGTCATTCTTTCTCAATGAAG  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATCTAATGACAATGATATAACTATAATGTCATTCTTTCTCAATGAAG  743

seq1  CTACATATAATATATACAGGTCATAGTTGAAGGCTTAGAAAGGGCTGAGG  787
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACATATAATATATACAGGTCATAGTTGAAGGCTTAGAAAGGGCTGAGG  793

seq1  ATGGGTAGAAAGTAATGGCAGAGATGGATAAGAATGGTTCATATACATTG  837
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGGGTAGAAAGTAATGGCAGAGATGGATAAGAATGGTTCATATACATTG  843

seq1  TGTACATGTCAGAGTAAATCATAAAGAATTTTAATTTAAAACATTTCTTT  887
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTACATGTCAGAGTAAATCATAAAGAATTTTAATTTAAAACATTTCTTT  893

seq1  GGTATAGGTATAACTCTGGCTTTACAAAAAAAATGACTAAAACCAGTTCA  937
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTATAGGTATAACTCTGGCTTTACAAAAAAAATGACTAAAACCAGTTCA  943

seq1  CTGATGAGATAGATGTGCTTGTTTATTTTCACATACACAATTAAATGTTG  987
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGATGAGATAGATGTGCTTGTTTATTTTCACATACACAATTAAATGTTG  993

seq1  GATGAGTTTCAGATATGGCAGGAGGTACATGTTCAACTTCTCAGGGTCGA  1037
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAGTTTCAGATATGGCAGGAGGTACATGTTCAACTTCTCAGGGTCGA  1043

seq1  TCCATATTTTGATTTTATACTTGCTGATGCTTTCATGCTGAGGCATGCAT  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCATATTTTGATTTTATACTTGCTGATGCTTTCATGCTGAGGCATGCAT  1093

seq1  AACCCAAAAATATTAAAGGATTTTGATTTTCTGGTATTAACACATTTTTC  1137
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACCCAAAAATATTAAAGGATTTTGATTTTCTGGTATTAACACATTTTTC  1143

seq1  AATATGAGTAGAAAACCTTTCTATATCCAGTAAAAGCCTTGGAATTC  1184
      |||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATGAGTAGAAAACCTTTCTATATCCAGTAAAAGCCTTGGAATTC  1190

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information