MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-284A24
Chromosome	X (Build37)
Map Location	148,803,412 - 148,946,194
singlet/doublet	doublet
Overlap gene	LOC207318, EG667113
Upstream gene	ORF34, LOC623804, LOC100039760, Phf8, LOC385448, LOC237116, Huwe1, LOC675514, Hsd17b10, Ribc1, Smc1a, LOC100040394, Iqsec2, Jarid1c, 2900056M20Rik, Tspyl2, Gpr173
Downstream gene	EG635412, LOC635396, EG667130, Shroom2, Gpr143, LOC100039874, LOC667147, EG624124, Usp51, LOC635253, Mageh1, EG385454, EG436240, Rragb, Klf8, LOC100039932, EG635136, Ubqln2
Link	Open Mouse BAC browser

Click to get alignment info.

name	ORF34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207375 MGI:2387687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 236 ESTs, 9 Proteins pseudo : _no_value

name	LOC100039760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Phf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320595 MGI:2444341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins pseudo : _no_value

name	LOC237116 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:237116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Huwe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59026 MGI:1926884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 505 ESTs, 23 Proteins pseudo : _no_value

name	Hsd17b10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15108 MGI:1333871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ribc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66611 MGI:1913861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24061 MGI:1344345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 140 ESTs, 9 Proteins pseudo : _no_value

name	Iqsec2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245666 MGI:3528396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jarid1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20591 MGI:99781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900056M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72997 MGI:1920247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tspyl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52808 MGI:106244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr173 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70771 MGI:1918021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC207318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:207318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins pseudo : _no_value

name	EG667113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667113 MGI:3645517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins pseudo : _no_value

name	EG635412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635412 MGI:3647927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC635396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG667130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667130 MGI:3644679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Shroom2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110380 MGI:107194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18241 MGI:107193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC667147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 12 Proteins

name	EG624124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624124 MGI:3648396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1639 ESTs, 9 Proteins

name	Usp51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434872 MGI:3588217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	LOC635253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins

name	Mageh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75625 MGI:1922875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG385454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385454 MGI:3646589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 15 Proteins

name	EG436240 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436240 MGI:3645103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rragb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245670 MGI:3038613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245671 MGI:2442430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG635136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635136 MGI:3643652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ubqln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54609 MGI:1860283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	ORF34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723306 GeneID:207375 MGI:2387687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 34 transcript_id : NM_198105.2

name	LOC100039760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272439 GeneID:100039760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to ribosomal protein L39 transcript_id : XM_001473449.1

name	Phf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803266 GeneID:320595 MGI:2444341
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 8 transcript_id : NM_177201.3

name	Huwe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676189 GeneID:59026 MGI:1926884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HECT, UBA and WWE domain containing 1 transcript_id : NM_021523.3

name	Hsd17b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888837 GeneID:15108 MGI:1333871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 10 transcript_id : NM_016763.2

name	Ribc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385123 GeneID:66611 MGI:1913861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIB43A domain with coiled-coils 1 transcript_id : NM_025660.1

name	Smc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790236 GeneID:24061 MGI:1344345
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structural maintenance of chromosomes 1A transcript_id : NM_019710.1

name	Iqsec2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53832027 GeneID:245666 MGI:3528396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif and Sec7 domain 2 transcript_id : NM_001005475.1

name	Jarid1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475590 GeneID:20591 MGI:99781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji, AT rich interactive domain 1C (Rbp2 like) transcript_id : NM_013668.2

name	2900056M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408435 GeneID:72997 MGI:1920247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 2900056M20 gene transcript_id : XM_898625.2

name	Tspyl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239982 GeneID:52808 MGI:106244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSPY-like 2 transcript_id : NM_029836.3

name	Gpr173 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793433 GeneID:70771 MGI:1918021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 173 transcript_id : NM_027543.3

name	LOC635396 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272453 GeneID:635396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : hypothetical LOC635396 transcript_id : XM_001473639.1

name	Shroom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347787 GeneID:110380 MGI:107194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 2 transcript_id : NM_172441.2

name	Gpr143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347371 GeneID:18241 MGI:107193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 143 transcript_id : NM_010951.3

name	LOC100039874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272455 GeneID:100039874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Predicted gene, EG434881 transcript_id : XM_001473706.1

name	LOC667147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272504 GeneID:667147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 12 Proteins product : similar to ribosomal protein L7a transcript_id : XM_001474961.1

name	EG624124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408441 GeneID:624124 MGI:3648396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1639 ESTs, 9 Proteins product : predicted gene, EG624124, transcript variant 1 transcript_id : XM_889835.2

name	Usp51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408442 GeneID:434872 MGI:3588217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : ubiquitin specific protease 51 transcript_id : XM_988754.1

name	LOC635253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272463 GeneID:635253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : similar to ubiquitin specific peptidase 51 transcript_id : XM_001473738.1

name	Mageh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244089 GeneID:75625 MGI:1922875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family H, 1 transcript_id : NM_023788.3

name	EG385454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408448 GeneID:385454 MGI:3646589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 15 Proteins product : predicted gene, EG385454 transcript_id : XM_358238.5

name	EG436240 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364699 GeneID:436240 MGI:3645103
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436240 transcript_id : NM_001034894.2

name	Rragb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921310 GeneID:245670 MGI:3038613
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras-related GTP binding B transcript_id : NM_001004154.1

name	Klf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344176 GeneID:245671 MGI:2442430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 8 transcript_id : NM_173780.3

name	Ubqln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328235 GeneID:54609 MGI:1860283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 2 transcript_id : NM_018798.2

name	ORF34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723307 GeneID:207375 MGI:2387687
definition	codon_start : 1 note : C9orf10-like product : hypothetical protein LOC207375 protein_id : NP_932773.2

name	LOC100039760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272440 GeneID:100039760
definition	codon_start : 1 product : similar to ribosomal protein L39 protein_id : XP_001473499.1

name	Phf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893223 CCDS:CCDS30470.1 GeneID:320595 MGI:2444341
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PHD finger protein 8 protein_id : NP_796175.1

name	Huwe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676190 GeneID:59026 MGI:1926884
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0016574 - histone ubiquitination [Evidence ISS]; GO:0051028 - mRNA transport [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0000209 - protein polyubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : upstream regulatory element binding protein 1; Mcl-1 ubiquitin ligase product : HECT, UBA and WWE domain containing 1 protein_id : NP_067498.3

name	Hsd17b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888838 CCDS:CCDS30471.1 GeneID:15108 MGI:1333871
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0047015 - 3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity [Evidence IEA]; GO:0003857 - 3-hydroxyacyl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : hydroxyacyl-Coenzyme A dehydrogenase, type II product : hydroxyacyl-Coenzyme A dehydrogenase type II protein_id : NP_058043.3

name	Ribc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385124 CCDS:CCDS30472.1 GeneID:66611 MGI:1913861
definition	GO_component : GO:0019861 - flagellum [Evidence IEA] codon_start : 1 product : RIB43A domain with coiled-coils 1 protein_id : NP_079936.1

name	Smc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790237 CCDS:CCDS30473.1 GeneID:24061 MGI:1344345
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0008280 - cohesin core heterodimer [Evidence ISS]; GO:0000776 - kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0003777 - microtubule motor activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0000075 - cell cycle checkpoint [Evidence ISS]; GO:0051301 - cell division [Evidence IEA]; GO:0051276 - chromosome organization and biogenesis [Evidence IEA]; GO:0042770 - DNA damage response, signal transduction [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS] [Evidence IEA]; GO:0007126 - meiosis [Evidence IPI] [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0007064 - mitotic sister chromatid cohesion [Evidence ISS]; GO:0007052 - mitotic spindle organization and biogenesis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0009314 - response to radiation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : chromosome segregation protein SmcB; segregation of mitotic chromosomes b; SMC; SMC (segregation of mitotic chromosomes 1)-like 1 product : SMC1 structural maintenance of chromosomes 1-like 1 protein_id : NP_062684.1

name	Iqsec2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53832028 GeneID:245666 MGI:3528396
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : IQ motif and Sec7 domain 2 protein_id : NP_001005475.1

name	Jarid1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094117 GeneID:20591 MGI:99781
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : selected mouse cDNA on the X product : jumonji, AT rich interactive domain 1C (Rbp2 like) protein_id : NP_038696.1

name	2900056M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004518 GeneID:72997 MGI:1920247
definition	codon_start : 1 product : hypothetical protein LOC72997 protein_id : XP_903718.1

name	Tspyl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859738 CCDS:CCDS30474.1 GeneID:52808 MGI:106244
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : differentially expressed nucleolar TGF-beta1 target; cell division autoantigen 1 nucleolar protein; CASK interacting nucleosome assembly protein product : nucleolar TGF-beta1 target protein protein_id : NP_084112.1

name	Gpr173 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541943 CCDS:CCDS30475.1 GeneID:70771 MGI:1918021
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor SREB3 product : super conserved receptor expressed in brain 3 protein_id : NP_081819.2

name	LOC635396 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272454 GeneID:635396
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473689.1

name	Shroom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347788 GeneID:110380 MGI:107194
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : apical protein, Xenopus laevis-like product : shroom family member 2 protein_id : NP_766029.2

name	Gpr143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347372 CCDS:CCDS30476.1 GeneID:18241 MGI:107193
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : mouse homolog of human ocular albinism 1 (Nettleship-Falls) product : G protein-coupled receptor 143 protein_id : NP_035081.3

name	LOC100039874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272456 GeneID:100039874
definition	codon_start : 1 product : similar to Predicted gene, EG434881 protein_id : XP_001473756.1

name	LOC667147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272505 GeneID:667147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475011.1

name	EG624124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004436 GeneID:624124 MGI:3648396
definition	codon_start : 1 product : similar to ribosomal protein S7 isoform 1 protein_id : XP_894928.1

name	Usp51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408443 GeneID:434872 MGI:3588217
definition	codon_start : 1 product : hypothetical protein protein_id : XP_993848.1

name	LOC635253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272464 GeneID:635253
definition	codon_start : 1 product : similar to ubiquitin specific peptidase 51 protein_id : XP_001473788.1

name	Mageh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963825 CCDS:CCDS30478.1 GeneID:75625 MGI:1922875
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] codon_start : 1 product : melanoma antigen, family H, 1 protein_id : NP_076277.1

name	EG385454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004553 GeneID:385454 MGI:3646589
definition	codon_start : 1 product : similar to Hmgb1 protein protein_id : XP_358238.3

name	EG436240 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77861897 CCDS:CCDS30479.1 GeneID:436240 MGI:3645103
definition	codon_start : 1 note : likely orthologue of H.Sapien for forkhead box R2 (FOXR2) product : hypothetical protein LOC436240 protein_id : NP_001030066.1

name	Rragb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921311 CCDS:CCDS30480.1 GeneID:245670 MGI:3038613
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 product : Ras-related GTP binding B protein_id : NP_001004154.1

name	Klf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424645 CCDS:CCDS30481.1 GeneID:245671 MGI:2442430
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : Kruppel-like factor 8 protein_id : NP_776141.1

name	Ubqln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328236 CCDS:CCDS30482.1 GeneID:54609 MGI:1860283
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : Ubiquitin-related protein product : ubiquilin 2 protein_id : NP_061268.2

name	LOC385448 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385448
definition	number : 1 pseudo : _no_value

name	LOC237116 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:237116
definition	number : 1 pseudo : _no_value

name	EG635412 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635412
definition	number : 1 pseudo : _no_value

name	EG667130 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667130
definition	number : 1 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 3 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 2 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 1 pseudo : _no_value

name	EG635136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635136
definition	number : 1 pseudo : _no_value

name	LOC623804 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272497 GeneID:623804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 236 ESTs, 9 Proteins product : similar to CDK105 pseudo : _no_value transcript_id : XR_031778.1

name	LOC675514 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272501 GeneID:675514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 505 ESTs, 23 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_031853.1

name	LOC100040394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272502 GeneID:100040394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 140 ESTs, 9 Proteins product : similar to ubiquitin-conjugating enzyme E2L 3 pseudo : _no_value transcript_id : XR_031871.1

name	LOC207318 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272503 GeneID:207318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins product : similar to A-X actin pseudo : _no_value transcript_id : XR_031952.1

name	EG667113 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408436 GeneID:667113 MGI:3645517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins product : predicted gene, EG667113 pseudo : _no_value transcript_id : XR_001976.1

clone name	MSMg01-081I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-194H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217O01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F17
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-284A24.b	B6Ng01-284A24.g
ACC	GA082859	GA082860
length	897	185
definition	B6Ng01-284A24.b	B6Ng01-284A24.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(148,945,298 - 148,946,194)	(148,803,412 - 148,803,596)
sequence	gaattcagtcatattttaaatatgaagcatttaacacagtgtaatccaaa tatatttggcactttaatactgagtgatgatggtaggagagacatgtctc tgttttctgtaattaatcctttatatttctctgagatcagagaactctcc atgggcagtaaaggactgaaattcataacattatgacttatgggagtggt gaatctgacccgaggtgtttgaagtgtttctgatggtgcagcacaatcta tgggttgacaccttgtgtaaaaaccacattgaatgttctgatggtgcacc tgggaaaagctgccagaaataccttagatatgttacacaattgactttga attaagttggctgttgaatgataaaccttttctttgttgccaggttctct gcagcccccactttaagaaaatgtgtcctagggagttaattgtggtgaga ggtaaaaagacttgtgaagattataggcagataaatatgggctatggaac tggctggtcttgggccttgagacgctggtggagaggagcagctatgaagg atggtttcaaacctctaggctaagcaagaaggaagttggcacctcacaag cagcactggggggggggggctgtgcagaaggtgtgggctgatgattcttt tggagttcatcttgagggactcaaacgctccattttaaaatttcttttac ttacttattgagctttcacacatgtagatttgactatggtcatagctact ccaactttcagagaaatctcagttcctcctagatacacactgacatagct cttccccaaattcattccttcttattctttcttagaggaaaaactgcccc aatttttttattaatgatgtccatctgccacatgaaatctatgtgcc	ctggcccgggaatcaccccgcttcacacaaatccagattccgtgatgcgg gaaacacctagcttggatagggtctcagtgaggagtcctggccccttagc tagaccctgtgtagcctgttggtcctcccctctcctcgatttgcacagtc cctgcccgaggggcgggtggaggagggagggaagg
quality values	Open. Hide. 58 33 42 35 58 26 23 58 58 47 42 62 62 54 62 62 47 62 62 62 62 62 47 54 62 62 62 62 62 54 51 39 31 31 44 24 34 21 27 28 46 43 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 59 62 62 59 62 49 54 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 59 62 62 62 62 62 54 54 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 34 62 54 49 38 54 62 62 62 62 62 62 62 62 62 62 48 62 47 62 62 54 58 58 52 58 58 58 58 58 58 58 54 58 45 41 58 58 58 58 58 54 49 58 58 58 58 58 58 58 58 54 58 58 58 49 58 49 58 58 58 52 58 54 36 58 58 58 52 58 58 54 58 52 52 43 41 54 54 54 58 52 54 58 58 54 54 58 50 45 48 58 58 47 58 58 58 58 37 27 12 12 19 10 15 23 23 11 14 6 9 32 31 21 40 18 34 22 23 18 19 22 21 31 40 35 50 50 27 24 23 32 28 26 31 46 35 50 37 32 43 37 38 50 50 38 17 25 28 32 40 37 37 28 37 23 9 19 29 39 32 42 34 36 37 22 26 18 9 10 15 26 40 17 14 26 13 12 15 33 9 22 21 22 9 37 24 40 30 16 30 32 28 40 6 7 9 39 36 16 26 19 32 21 32 11 40 24 21 19 32 38 26 21 18 18 37 37 32 47 37 28 35 32 32 24 38 40 37 52 40 37 51 30 14 34 25 22 21 14 27 35 26 40 16 51 12 9 44 27 25 24 31 33 37 11 14 31 13 18 6 28 52 33 27 23 31 22 31 24 8 19 5 17 17 29 47 29 32 28 24 6 11 7 9 6 25 24 45 31 18 9 7 30 31 21 31 15 12 19 19 9 10 17 31 6 26 19 17 19 14 14 13 13 21 11 30 28 6 25 11 33 19 19 17 18 22 28 32 12 8 14 11 18 23 24 19 16 25 27 27 36 9 25 7 10 6 6 10 6 11 31 30 19 32 23 13 29 32 28 12 8 17 9 9 9 13 12 15 18 32 42 30 9 11 21 9 9 20 11 29	Open. Hide. 62 59 62 59 32 43 49 28 32 28 26 28 29 49 49 62 62 62 62 62 62 62 62 59 51 59 59 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 49 42 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 37 43 62 62 62 62 62 62 62 62 59 62 49 49 62 62 62 62 62 59 59 62 62 62 62 24 21

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_148945298_148946194
seq2: B6Ng01-284A24.b_45_941 (reverse)

seq1  GGCACATAGATTTCATGT-GCAGATGGACATCACTAATTAAAAAATT-GT  48
      |||||||||||||||||| |||||||||||||| |||| |||||||| | 
seq2  GGCACATAGATTTCATGTGGCAGATGGACATCATTAATAAAAAAATTGGG  50

seq1  GCAGTTTTTCCTCTAAGAAAGAATAAG-AGGAATGAATTTGGGAAGAAGC  97
      ||||||||||||||||||||||||||| ||||||||||||||| |  |||
seq2  GCAGTTTTTCCTCTAAGAAAGAATAAGAAGGAATGAATTTGGGGAAGAGC  100

seq1  TATGTCAGTGTGTATCTAGG-GGAACTGAGATTTCTCTGAAAGTTGGAGT  146
      |||||||||||||||||||| |||||||||||||||||||||||||||||
seq2  TATGTCAGTGTGTATCTAGGAGGAACTGAGATTTCTCTGAAAGTTGGAGT  150

seq1  AGCTATGACCATAGTCAAATCTACATGTGTGAAAGCCTCAATAAGTAAGT  196
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  AGCTATGACCATAGTCAAATCTACATGTGTGAAAG-CTCAATAAGTAAGT  199

seq1  AAAAGAAATTTTAAAATGGAGCGTTTGAGTCCCTCAAGATGAACTCCAAA  246
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAAGAAATTTTAAAATGGAGCGTTTGAGTCCCTCAAGATGAACTCCAAA  249

seq1  AGAATCATCAGCCCACACCTTCTGCACAACTGCCCCCCCCCCCCAGTGCT  296
      ||||||||||||||||||||||||||||   |||||||||||||||||||
seq2  AGAATCATCAGCCCACACCTTCTGCACA---GCCCCCCCCCCCCAGTGCT  296

seq1  GCTTGTGAGGTGCCAACTTCCTTCTTGCTTAGCCTAGAGGTTTGAAACCA  346
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTTGTGAGGTGCCAACTTCCTTCTTGCTTAGCCTAGAGGTTTGAAACCA  346

seq1  TCCTTCATAGCTGCTCCTCTCCACCAGCGTCTCAAGGCCCAAGACCAGCC  396
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTTCATAGCTGCTCCTCTCCACCAGCGTCTCAAGGCCCAAGACCAGCC  396

seq1  AGTTCCATAGCCCATATTTATCTGCCTATAATCTTCACAAGTCTTTTTAC  446
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTCCATAGCCCATATTTATCTGCCTATAATCTTCACAAGTCTTTTTAC  446

seq1  CTCTCACCACAATTAACTCCCTAGGACACATTTTCTTAAAGTGGGGGCTG  496
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCTCACCACAATTAACTCCCTAGGACACATTTTCTTAAAGTGGGGGCTG  496

seq1  CAGAGAACCTGGCAACAAAGAAAAGGTTTATCATTCAACAGCCAACTTAA  546
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAGAACCTGGCAACAAAGAAAAGGTTTATCATTCAACAGCCAACTTAA  546

seq1  TTCAAAGTCAATTGTGTAACATATCTAAGGTATTTCTGGCAGCTTTTCCC  596
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCAAAGTCAATTGTGTAACATATCTAAGGTATTTCTGGCAGCTTTTCCC  596

seq1  AGGTGCACCATCAGAACATTCAATGTGGTTTTTACACAAGGTGTCAACCC  646
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTGCACCATCAGAACATTCAATGTGGTTTTTACACAAGGTGTCAACCC  646

seq1  ATAGATTGTGCTGCACCATCAGAAACACTTCAAACACCTCGGGTCAGATT  696
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGATTGTGCTGCACCATCAGAAACACTTCAAACACCTCGGGTCAGATT  696

seq1  CACCACTCCCATAAGTCATAATGTTATGAATTTCAGTCCTTTACTGCCCA  746
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACCACTCCCATAAGTCATAATGTTATGAATTTCAGTCCTTTACTGCCCA  746

seq1  TGGAGAGTTCTCTGATCTCAGAGAAATATAAAGGATTAATTACAGAAAAC  796
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGAGTTCTCTGATCTCAGAGAAATATAAAGGATTAATTACAGAAAAC  796

seq1  AGAGACATGTCTCTCCTACCATCATCACTCAGTATTAAAGTGCCAAATAT  846
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGACATGTCTCTCCTACCATCATCACTCAGTATTAAAGTGCCAAATAT  846

seq1  ATTTGGATTACACTGTGTTAAATGCTTCATATTTAAAATATGACTGAATT  896
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTGGATTACACTGTGTTAAATGCTTCATATTTAAAATATGACTGAATT  896

seq1  C  897
      |
seq2  C  897

seq1: chrX_148803412_148803596
seq2: B6Ng01-284A24.g_71_255

seq1  CTGGCCCGGGAATCACCCCGCTTCACACAAATCCAGATTCCGTGATGCGG  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGCCCGGGAATCACCCCGCTTCACACAAATCCAGATTCCGTGATGCGG  50

seq1  GAAACACCTAGCTTGGATAGGGTCTCAGTGAGGAGTCCTGGCCCCTTAGC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAACACCTAGCTTGGATAGGGTCTCAGTGAGGAGTCCTGGCCCCTTAGC  100

seq1  TAGACCCTGTGTAGCCTGTTGGTCCTCCCCTCTCCTCGATTTGCACAGTC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGACCCTGTGTAGCCTGTTGGTCCTCCCCTCTCCTCGATTTGCACAGTC  150

seq1  CCTGCCCGAGGGGCGGGTGGAGGAGGGAGGGAAGG  185
      |||||||||||||||||||||||||||||||||||
seq2  CCTGCCCGAGGGGCGGGTGGAGGAGGGAGGGAAGG  185

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information