MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-285K10
Chromosome	X (Build37)
Map Location	82,579,344 - 82,580,463
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Dmd, LOC100042306, LOC100042296, LOC669833, 1600014K23Rik
Downstream gene	Map3k7ip3, Gyk, LOC100042350, LOC629340, LOC100041562, 5430427O19Rik, 1700072E05Rik, Nr0b1, CN716893, LOC667841, LOC236427, EG667852, EG436212
Link	Open Mouse BAC browser

Click to get alignment info.

name	Dmd (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13405 MGI:94909
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100042306 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 161 ESTs

name	LOC100042296 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC669833 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669833
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	1600014K23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71996 MGI:1919246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 19 ESTs, 11 Proteins

name	Map3k7ip3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66724 MGI:1913974
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gyk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14933 MGI:106594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC100042350 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100042350
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC629340 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:629340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 69 ESTs, 6 Proteins pseudo : _no_value

name	LOC100041562 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041562
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	5430427O19Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71398 MGI:1918648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 2 Proteins

name	1700072E05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73495 MGI:1920745
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nr0b1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11614 MGI:1352460
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	CN716893 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434903 MGI:3584456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC667841 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667841
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC236427 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236427
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 38 Proteins pseudo : _no_value

name	EG667852 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667852 MGI:3644372
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	EG436212 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436212 MGI:3647656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins

name	Dmd (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142357345 GeneID:13405 MGI:94909
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophin, muscular dystrophy transcript_id : NM_007868.2

name	LOC100042306 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271794 GeneID:100042306
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 161 ESTs product : similar to pORF2 transcript_id : XM_001478003.1

name	LOC100042296 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271792 GeneID:100042296
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100042296 transcript_id : XM_001477992.1

name	1600014K23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407576 GeneID:71996 MGI:1919246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 ESTs, 11 Proteins product : RIKEN cDNA 1600014K23 gene, transcript variant 1 transcript_id : XM_135938.7

name	1600014K23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271796 GeneID:71996 MGI:1919246
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 11 Proteins product : RIKEN cDNA 1600014K23 gene, transcript variant 2 transcript_id : XM_900638.3

name	Map3k7ip3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61556735 GeneID:66724 MGI:1913974
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mitogen-activated protein kinase kinase kinase 7 interacting protein 3 transcript_id : NM_025729.3

name	Gyk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95147353 GeneID:14933 MGI:106594
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol kinase transcript_id : NM_008194.3

name	Gyk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:95147349 GeneID:14933 MGI:106594
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycerol kinase transcript_id : NM_212444.2

name	LOC100041562 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271737 GeneID:100041562
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100041562 transcript_id : XM_001476582.1

name	5430427O19Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407611 GeneID:71398 MGI:1918648
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 16 ESTs, 2 Proteins product : RIKEN cDNA 5430427O19 gene, transcript variant 2 transcript_id : XM_900683.2

name	1700072E05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142367117 GeneID:73495 MGI:1920745
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700072E05 gene transcript_id : NM_028554.2

name	Nr0b1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802393 GeneID:11614 MGI:1352460
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear receptor subfamily 0, group B, member 1 transcript_id : NM_007430.3

name	CN716893 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111378380 GeneID:434903 MGI:3584456
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : expressed sequence CN716893 transcript_id : NM_001033492.2

name	EG436212 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51772204 GeneID:436212 MGI:3647656
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 29 Proteins product : predicted gene, EG436212 transcript_id : XM_488356.1

name	Dmd (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6681203 GeneID:13405 MGI:94909
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005626 - insoluble fraction [Evidence IDA]; GO:0005792 - microsome [Evidence IDA]; GO:0005886 - plasma membrane [Evidence IDA]; GO:0042383 - sarcolemma [Evidence IDA] [Evidence TAS]; GO:0045202 - synapse [Evidence IDA] GO_function : GO:0003779 - actin binding [Evidence IEA]; GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007517 - muscle development [Evidence IMP]; GO:0007519 - striated muscle development [Evidence IMP] [Evidence IGI] codon_start : 1 note : Duchenne muscular dystrophy; X-linked muscular dystrophy; dystrophin Dp71 product : dystrophin, muscular dystrophy protein_id : NP_031894.1

name	LOC100042306 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271795 GeneID:100042306
definition	codon_start : 1 product : similar to pORF2 protein_id : XP_001478053.1

name	LOC100042296 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271793 GeneID:100042296
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001478042.1

name	1600014K23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63746642 GeneID:71996 MGI:1919246
definition	codon_start : 1 product : hypothetical protein LOC71996 isoform 1 protein_id : XP_135938.3

name	1600014K23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001616 GeneID:71996 MGI:1919246
definition	codon_start : 1 product : hypothetical protein LOC71996 isoform 2 protein_id : XP_905731.1

name	Map3k7ip3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61556736 GeneID:66724 MGI:1913974
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : mitogen-activated protein kinase kinase kinase 7 interacting protein 3 protein_id : NP_080005.2

name	Gyk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680139 GeneID:14933 MGI:106594
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004370 - glycerol kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006071 - glycerol metabolism [Evidence IMP]; GO:0006072 - glycerol-3-phosphate metabolism [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : glycerol kinase isoform 1 protein_id : NP_032220.1

name	Gyk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46909579 GeneID:14933 MGI:106594
definition	GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0004370 - glycerol kinase activity [Evidence IDA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0006071 - glycerol metabolism [Evidence IMP]; GO:0006072 - glycerol-3-phosphate metabolism [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : glycerol kinase isoform 2 protein_id : NP_997609.1

name	LOC100041562 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271738 GeneID:100041562
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001476632.1

name	5430427O19Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83001627 GeneID:71398 MGI:1918648
definition	codon_start : 1 product : hypothetical protein LOC71398 isoform 2 protein_id : XP_905776.1

name	1700072E05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386320 CCDS:CCDS30259.1 GeneID:73495 MGI:1920745
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC73495 protein_id : NP_082830.1

name	Nr0b1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6671531 CCDS:CCDS30260.1 GeneID:11614 MGI:1352460
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0004872 - receptor activity [Evidence IEA]; GO:0003707 - steroid hormone receptor activity [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA]; GO:0016564 - transcriptional repressor activity [Evidence IDA] GO_process : GO:0030154 - cell differentiation [Evidence IGI]; GO:0030238 - male sex determination [Evidence IGI] [Evidence IMP]; GO:0016481 - negative regulation of transcription [Evidence IDA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : adrenal hypoplasia congenita-like protein; adrenal hypoplasia, congenital homolog product : nuclear receptor subfamily 0, group B, member 1 protein_id : NP_031456.1

name	CN716893 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111378381 CCDS:CCDS30261.1 GeneID:434903 MGI:3584456
definition	codon_start : 1 note : novel protein containing a MAGE family domain product : hypothetical protein LOC434903 protein_id : NP_001028664.2

name	EG436212 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772205 GeneID:436212 MGI:3647656
definition	codon_start : 1 product : similar to MAGE-B3 protein_id : XP_488356.1

name	LOC669833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669833
definition	number : 1 pseudo : _no_value

name	LOC669833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669833
definition	number : 2 pseudo : _no_value

name	LOC669833 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669833
definition	number : 3 pseudo : _no_value

name	LOC100042350 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100042350
definition	number : 1 pseudo : _no_value

name	LOC667841 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667841
definition	number : 1 pseudo : _no_value

name	LOC667841 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667841
definition	number : 2 pseudo : _no_value

name	LOC667841 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667841
definition	number : 3 pseudo : _no_value

name	LOC236427 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236427
definition	number : 2 pseudo : _no_value

name	LOC236427 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236427
definition	number : 1 pseudo : _no_value

name	EG667852 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667852
definition	number : 1 pseudo : _no_value

name	EG667852 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667852
definition	number : 2 pseudo : _no_value

name	EG667852 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667852
definition	number : 3 pseudo : _no_value

name	LOC629340 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271734 GeneID:629340
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 69 ESTs, 6 Proteins product : similar to Translocase of outer mitochondrial membrane 20 homolog (yeast) pseudo : _no_value transcript_id : XR_032822.1

clone name	MSMg01-471E18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-464N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-301M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339A16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391N17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127A14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-376K03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-352O23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537N18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-411K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-125B01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-484D03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-147M24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-112F24
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-474L18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-380A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-396A04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-415J10
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-136H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438P10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-510F22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122M19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-386J22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-168B12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414F20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202D07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-296E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-296E11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450J13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-316B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385B08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-278O22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050E09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-075K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272N20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-202N15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-371G04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-538I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-398D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518E23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-261A10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-485K13
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-338J16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051I09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-271L20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-458H16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166I12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-119K06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-535F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126D04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267N08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128H13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-266N24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192G20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-142L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-219K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342D16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056E06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-265P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-035N18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291H16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-209B24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133N07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-208E22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-021B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285K10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-159N16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008I04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-230J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171K14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-322A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-136J07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227F09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-064J20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145P21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-162M12
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-285K10.b	B6Ng01-285K10.g
ACC	GA084046	GA084047
length	1,188	1,105
definition	B6Ng01-285K10.b	B6Ng01-285K10.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaactgaggaataccaaatggctgtgaagcacctgaaaaaatg ttcaacatccttaatcatcaggggaatgcaaatcaaaacaaccctgagat tccacttcacaccagtcagaatggtaaagatcaaaaattcaggtgacagc agatgctggtgaggatgtggagaaagaggaacactcctccattgctgttt ggattgcaagctggtacaaccactttggaaatcagtttggcggttcctca gaaaattggacatggcactactggaggatccagcaataccactactgggc atatacccagaagatgctccaacttgtaataaggacacatgctctactat gttcatagtagccttatttataatagccagaagctggaaagaacacagat gtacctcaacagaggaatgtatacagaaaatgtggtacatttacacaatg gagtactactcagctattaaaaacaatgaatttatgaaagtcttagacaa atggatggatctggaggatgtcatcctaagtgaggtaacacaatcacaaa agaacacacatgatatgcactcactgataagtggatattagcccataatc tcagaatacccaagataaaatttgcaaaacacataaaactcaagaaggaa gaccaaagtttggatacttcgatccttcttagaaggtggaacaaagtacc catggaaggagttacagagacaaagtttggatcagagactgaaggaatga ctatccagagactgccccacttgaggatccatcccataaacaaccattaa acccagacattattgcagatgccaacaagagctagatgacaggagcctga tgaagctgtctcctgaggggctctcccagtgcctgacaaatacagccatc catttggatgaagcacagggtccccaattgaaggaacttagaaaaagtta cccaggagctaaaggggttttgcagttcccattggagggaacatccaatt attgacttacccagtacccccagagctcccttgaactaaacacttaattc aaagaaaaactcatgggggaacttgttggctcttatctgccatatgttag cagacgatggctagttcggtcatccatgggggaagaagagtccttgatct tgggaggttccatggcccccatttataaggggaattgc	gaattccttactttaacaagatcttccattgattttgtgcacatcaaagt ttaagaaatattggcacaatgaattagctgctttggtgttttaaatactc tggcacagtgccaggtagtcataccacagagccaaaggaaaaaatatgca catttgtgtaccatttaggaaactgtagtatctatagtacaaaacaaaca agttaacattgttgaagttatttctggtacttcttcccagtcccgtgctc ccagatataagacagactcaaaatatatttacaaataccttggccattta gataggctcttctctgactagatcataacctaaggtaactcttttattct aatgtaattctgccatgtagctggctacctttgctcaggtagcatgcatt catcttgtcacacgtttctgggtgaatattatgtggcttgttctatccca gaattctttctacctccaggatgttccatcttctattctaccctttccta taggccataggatttttttaaatgacaggtgatgcattcatacaatacac taaatgttctctctacagaacacgcacacaaccacacacaatcacacaca cagctgtacgtgtacctgtaaaacattatgtggttcaatacaactagtaa tgctatcatccttgaattgtgtctaactgataactggaacaaatcaatca gtaagtattaccatttgtccaactttggtttctagagaggacactggaga tggagctagaaaagtacaaaaaaatcagtttccatcagagagctgagtga agaaaagaaattagtattgattgaacacctactgtgatagggactgctag gtagaaaactatcttgatgaaatagactctaaggattccatcatcaggca agatatcccaagggaataagaaacagaaaagctcacagaccaattatgat tttcaaatcatgtattttagtgattaaaatatgcagtgaaagcaaagaaa ggagatgggttgcttacacatttgcagaggtgtaatggaatgagaagaga acattctttgattcatgatccacatggttcacccagctgcttaagatgtg tagaa
quality values	Open. Hide. 58 33 35 26 58 54 58 32 42 45 58 58 58 36 28 62 47 38 32 62 41 41 47 62 62 62 62 62 62 62 62 62 54 47 46 46 62 62 47 62 62 47 44 62 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 38 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 54 54 62 62 59 59 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 56 62 54 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 49 62 62 62 62 62 42 47 62 62 62 62 62 62 62 62 49 41 58 54 41 58 58 58 54 58 58 58 54 58 58 54 58 58 54 41 54 49 58 52 54 42 54 52 52 54 54 52 54 47 54 54 54 50 58 49 54 54 54 54 58 54 58 58 49 52 54 58 54 58 52 58 54 54 46 54 58 58 42 40 58 58 54 58 58 58 54 39 42 58 58 58 52 54 58 54 40 58 54 54 58 58 58 52 46 49 58 46 53 47 46 58 47 48 58 50 51 31 46 54 51 51 51 58 58 53 46 32 49 47 49 49 53 51 47 53 50 46 49 54 50 58 50 47 47 42 58 54 23 48 50 49 46 37 16 53 31 50 58 46 33 46 58 51 58 39 28 36 41 58 52 50 46 41 49 49 49 39 32 50 53 53 49 32 51 32 15 58 31 52 58 53 50 46 32 44 40 37 52 42 51 51 51 36 33 49 58 50 53 26 58 49 37 33 25 26 32 25 50 51 30 37 50 24 58 44 18 18 58 30 44 25 37 42 42 41 21 36 19 32 22 52 52 26 33 21 39 51 13 20 42 49 28 41 41 41 38 44 37 45 54 30 33 39 40 52 32 52 49 51 41 35 39 53 35 21 11 52 35 29 34 24 24 47 24 52 39 33 22 14 51 42 28 24 29 35 45 22 42 40 33 52 36 32 37 39 18 33 46 19 40 33 32 28 28 39 37 28 21 25 32 29 35 34 53 21 27 51 32 19 15 32 25 35 32 21 13 37 31 35 40 25 12 21 24 32 31 36 37 32 42 34 28 33 31 25 18 30 30 40 22 24 29 30 30 30 30 22 10 51 46 28 26 38 31 45 43 51 31 18 15 31 31 31 23 24 31 39 26 23 46 32 31 29 31 31 31 27 19 18 28 23 33 9 5 46 9 31 18 13 27 20 33 38 26 31 15 12 6 12 25 28 13 19 22 26 37 21 41 17 16 11 32 12 9 6 11 10 28 18 9 9 9 25 46 46 48 16 9 6 9 14 35 35 12 13 5 12 6 6 31 27 25 38 10 8 44 44 38 23 48 48 11 33 32 21 16 32 11 15 38 38 23 38 15 21 18 13 8 48 13 44 9 11 15 27 21 13 33 18 15 15 24 11 16 9 41 7 8 10 32 10 36 24 24 10 7 9 33 31 36 31 21 9 7 17 11 10 8 12 18 6 8 17 26 14 22 13 10 10 48 14 39 6 10 10 13 33 21 18 7 7 25 29 15 15 32 38 14 16 6 4 5 3 6 8 22 38 28 30 20 6 5 4 6 14 16 19 7 5 15 16 8 11 8 21 15 7 9 5 6 5 8 5 6 10 6 10 6 17 22 7 9 5 5 14 5 8 6 6 14 19 3 6 20 6 8 10 11 9 17 4 19 14 6 6 7 7 1 4 12 28 8 4 4 5 16 10 15 4 5 15 7 17 13 18 10 13 19 16 20 7 9 4 9 5 3 4 18 6 11 11 10 20 9 7 8 4 17 28 9 8 12 5 15 12 4 5 9 6 7 7 16 12 11 9 7 4 4 5	Open. Hide. 62 47 51 42 62 62 62 62 54 62 54 62 62 44 56 62 59 47 59 62 59 59 62 62 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 54 54 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 54 43 62 62 54 52 62 62 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 58 54 58 54 58 58 47 58 36 35 58 58 58 58 58 58 54 58 58 58 58 58 58 52 58 58 54 58 45 41 58 58 54 58 58 58 52 58 54 58 52 58 58 58 58 54 58 54 54 58 58 49 51 49 58 54 58 58 51 58 58 50 58 50 48 58 58 51 52 58 58 58 53 58 53 58 50 58 58 51 39 58 52 58 52 58 58 58 58 42 33 58 53 58 53 58 50 58 47 58 58 58 58 53 52 51 50 54 58 51 34 41 58 58 58 50 50 58 58 50 50 50 51 58 50 50 58 53 58 41 31 58 42 53 58 49 53 52 49 46 58 41 41 49 52 58 33 44 51 35 54 52 53 54 39 52 52 58 52 51 51 51 40 27 58 53 30 58 39 51 52 52 51 50 50 58 53 32 54 31 44 52 54 49 34 33 52 32 54 40 40 41 21 39 49 53 42 53 39 53 42 42 53 39 47 33 33 49 49 37 53 54 53 51 37 51 45 29 42 35 51 33 18 31 20 11 54 40 45 40 40 45 52 31 47 40 45 41 18 30 31 31 52 51 31 18 26 26 33 23 46 42 53 52 40 32 36 52 53 49 30 45 28 31 31 51 52 52 53 52 41 32 33 32 31 37 53 21 23 34 32 45 40 31 18 51 18 37 29 31 45 31 46 17 43 38 33 33 27 46 51 51 42 25 32 47 28 34 38 43 28 31 29 32 31 43 32 27 46 38 24 32 29 29 32 37 43 31 31 31 46 18 31 31 32 34 23 46 29 27 28 34 43 38 38 22 27 27 32 31 16 28 46 48 31 26 38 32 29 31 35 24 30 25 25 32 37 46 33 30 27 23 31 33 33 36 36 25 12 10 16 31 20 31 28 33 26 32 43 25 36 31 11 29 25 25 13 25 18 25 13 19 35 32 44 31 20 31 11 44 21 33 30 24 19 30 24 33 44 22 22 15 15 29 43 41 26 18 30 36 32 20 29 22 23 23 24 28 19 10 15 22 17 21 34 33 22 43 43 30 23 21 36 17 26 34 24 21 32 10 17 4 43 48 22 13 7 31 4 14 28 13 16 48 33 32 22 15 16 26 28 24 23 15 11 20 47 30 18 15 17 19 3 3 3 34 18 9 9 25 6 20 16 14 34 21 7 7 11 4 7 14 9 5 6 16 12 27 47 21 11 22 3 7 5 4 6 12 27 11 38 20 16 15 17 13 10 5 9 3 3 5 10 8 19 10 17 7 12 6 20 13 16 7 26 25 12 22 4 8 8 16 16 11 4 9 8 11 4 10 9 13 10 17 4 5 7 6 5 17 17 6 4 16 6 7 15 5 5 25 16 5 10 6 6 9 2 2 3 11 11 17

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_82579344_82580463
seq2: B6Ng01-285K10.g_66_1170

seq1  GAATTCCTTACTTTAACAAGATCTTCCATTGATTTTGTGCACATCAAAGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCCTTACTTTAACAAGATCTTCCATTGATTTTGTGCACATCAAAGT  50

seq1  TTAAGAAATATTGGCACAATGAATTAGCTGCTTTGGTGTTTTAAATACTC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAGAAATATTGGCACAATGAATTAGCTGCTTTGGTGTTTTAAATACTC  100

seq1  TGGCACAGTGCCAGGTAGTCATACCACAGAGCCAAAGGAAAAAATATGCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGCACAGTGCCAGGTAGTCATACCACAGAGCCAAAGGAAAAAATATGCA  150

seq1  CATTTGTGTACCATTTAGGAAACTGTAGTATCTATAGTACAAAACAAACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGTGTACCATTTAGGAAACTGTAGTATCTATAGTACAAAACAAACA  200

seq1  AGTTAACATTGTTGAAGTTATTTCTGGTACTTCTTCCCAGTCCCGTGCTC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTAACATTGTTGAAGTTATTTCTGGTACTTCTTCCCAGTCCCGTGCTC  250

seq1  CCAGATATAAGACAGACTCAAAATATATTTACAAATACCTTGGCCATTTA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGATATAAGACAGACTCAAAATATATTTACAAATACCTTGGCCATTTA  300

seq1  GATAGGCTCTTCTCTGACTAGATCATAACCTAAGGTAACTCTTTTATTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATAGGCTCTTCTCTGACTAGATCATAACCTAAGGTAACTCTTTTATTCT  350

seq1  AATGTAATTCTGCCATGTAGCTGGCTACCTTTGCTCAGGTAGCATGCATT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGTAATTCTGCCATGTAGCTGGCTACCTTTGCTCAGGTAGCATGCATT  400

seq1  CATCTTGTCACACGTTTCTGGGTGAATATTATGTGGCTTGTTCTATCCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATCTTGTCACACGTTTCTGGGTGAATATTATGTGGCTTGTTCTATCCCA  450

seq1  GAATTCTTTCTACCTCCAGGATGTTCCATCTTCTATTCTACCCTTTCCTA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTTCTACCTCCAGGATGTTCCATCTTCTATTCTACCCTTTCCTA  500

seq1  TAGGCCATAGGATTTTTTTAAATGACAGGTGATGCATTCATACAATACAC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCCATAGGATTTTTTTAAATGACAGGTGATGCATTCATACAATACAC  550

seq1  TAAATGTTCTCTCTACAGAACACGCACACAACCACACACAATCACACACA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAATGTTCTCTCTACAGAACACGCACACAACCACACACAATCACACACA  600

seq1  CAGCTGTACGTGTACCTGTAAAACATTATGTGGTTCAATACAACTAGTAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGCTGTACGTGTACCTGTAAAACATTATGTGGTTCAATACAACTAGTAA  650

seq1  TGCTATCATCCTTGAATTGTGTCTAACTGATAACTGGAACAAATCAATCA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTATCATCCTTGAATTGTGTCTAACTGATAACTGGAACAAATCAATCA  700

seq1  GTAAGTATTACCATTTGTCCAACTTTGGTTTCTAGAGAGGACACTGGAGA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAAGTATTACCATTTGTCCAACTTTGGTTTCTAGAGAGGACACTGGAGA  750

seq1  TGGAGCTAGAAAAGTACAAAAAAATCAGTTTCCATCAGAGAGCTGAGTGA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAGCTAGAAAAGTACAAAAAAATCAGTTTCCATCAGAGAGCTGAGTGA  800

seq1  AGAAAAGAAATTAGTATTGATTGAACACCTACTGTGATAGGGACTGCTAG  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAAAGAAATTAGTATTGATTGAACACCTACTGTGATAGGGACTGCTAG  850

seq1  GTAGAAAACTATCTTGATGAAATAGACTCTAAGGATTCCATCATCAGGCA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAAAACTATCTTGATGAAATAGACTCTAAGGATTCCATCATCAGGCA  900

seq1  AGATATCCCAA-GGAATAAGAAACAGAAAAGCTCACAGACCAAATTATGA  949
      ||||||||||| ||||||||||||||||||||||||||||| ||||||||
seq2  AGATATCCCAAGGGAATAAGAAACAGAAAAGCTCACAGACC-AATTATGA  949

seq1  TTTTCAAATCATGTAATTTTAGTTGATTTAAAATATGCAGTGAAAAGCAA  999
      |||||||||||||| ||||||| ||| ||||||||||||||| ||||| |
seq2  TTTTCAAATCATGT-ATTTTAG-TGA-TTAAAATATGCAGTG-AAAGC-A  994

seq1  AAGGAAAGAGATGGGTTGGCTTAACACATTTGCCAGAGGGTGTAAATGGA  1049
      ||| || |||||||||| |||| ||||||||| |||| ||||| ||||||
seq2  AAGAAAGGAGATGGGTT-GCTT-ACACATTTG-CAGA-GGTGT-AATGGA  1039

seq1  ATGGAGAGAGAACATTCTTTGAATCATGGATTCCACATGGTTCACCCAGC  1099
      |||   |||||||||||||||| |||||   |||||||||||||||||| 
seq2  ATGAGAAGAGAACATTCTTTGATTCATG--ATCCACATGGTTCACCCAG-  1086

seq1  CTGCTAAAGATGTGGTTAGAA  1120
      ||||| ||||||||  |||||
seq2  CTGCTTAAGATGTG--TAGAA  1105

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information