MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-286E14
Chromosome	X (Build37)	12 (Build37)
Map Location	148,425,983 - 148,427,122	71,872,311 - 71,872,466
singlet/doublet	singlet	singlet
Overlap gene	none
Upstream gene	Gnl3l, Fgd1, Tsr2, LOC100040221, EG667027, Wnk3, LOC675278, ORF34, LOC623804, LOC100039760, Phf8, LOC385448, LOC237116, Huwe1, LOC675514
Downstream gene	Hsd17b10, Ribc1, Smc1a, LOC100040394, Iqsec2, Jarid1c, 2900056M20Rik, Tspyl2, Gpr173, LOC207318, EG667113, EG635412, LOC635396, EG667130, Shroom2, Gpr143, LOC100039874, LOC667147, EG624124, Usp51
Link	Open Mouse BAC browser

Click to get alignment info.

name	Gnl3l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237107 MGI:2448557
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Fgd1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14163 MGI:104566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tsr2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69499 MGI:1916749
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040221 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG667027 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667027 MGI:3648636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Wnk3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:279561 MGI:2652875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 5 Proteins

name	LOC675278 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1041 ESTs, 10 Proteins

name	ORF34 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207375 MGI:2387687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC623804 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:623804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 236 ESTs, 9 Proteins pseudo : _no_value

name	LOC100039760 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Phf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:320595 MGI:2444341
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385448 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385448
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 51 Proteins pseudo : _no_value

name	LOC237116 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:237116
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 Proteins pseudo : _no_value

name	Huwe1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:59026 MGI:1926884
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC675514 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:675514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 505 ESTs, 23 Proteins pseudo : _no_value

name	Hsd17b10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15108 MGI:1333871
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ribc1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66611 MGI:1913861
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Smc1a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:24061 MGI:1344345
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040394 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 140 ESTs, 9 Proteins pseudo : _no_value

name	Iqsec2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245666 MGI:3528396
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Jarid1c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:20591 MGI:99781
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2900056M20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72997 MGI:1920247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Tspyl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:52808 MGI:106244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr173 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70771 MGI:1918021
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC207318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:207318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins pseudo : _no_value

name	EG667113 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667113 MGI:3645517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins pseudo : _no_value

name	EG635412 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635412 MGI:3647927
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	LOC635396 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG667130 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667130 MGI:3644679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Shroom2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110380 MGI:107194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18241 MGI:107193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC667147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 12 Proteins

name	EG624124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624124 MGI:3648396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1639 ESTs, 9 Proteins

name	Usp51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434872 MGI:3588217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Gnl3l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37674223 GeneID:237107 MGI:2448557
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : guanine nucleotide binding protein-like 3 (nucleolar)-like transcript_id : NM_198110.1

name	Fgd1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118131060 GeneID:14163 MGI:104566
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : FYVE, RhoGEF and PH domain containing 1 transcript_id : NM_008001.3

name	Tsr2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142352950 GeneID:69499 MGI:1916749
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSR2, 20S rRNA accumulation, homolog (S. cerevisiae) transcript_id : NM_175146.3

name	Wnk3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408422 GeneID:279561 MGI:2652875
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 29 ESTs, 5 Proteins product : WNK lysine deficient protein kinase 3, transcript variant 3 transcript_id : XM_909586.2

name	LOC675278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272493 GeneID:675278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1040 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 1 transcript_id : XM_001474457.1

name	LOC675278 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272495 GeneID:675278
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 612 ESTs, 10 Proteins product : similar to ribosomal protein L21, transcript variant 2 transcript_id : XM_001474478.1

name	ORF34 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723306 GeneID:207375 MGI:2387687
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : open reading frame 34 transcript_id : NM_198105.2

name	LOC100039760 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272439 GeneID:100039760
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to ribosomal protein L39 transcript_id : XM_001473449.1

name	Phf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141803266 GeneID:320595 MGI:2444341
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 8 transcript_id : NM_177201.3

name	Huwe1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61676189 GeneID:59026 MGI:1926884
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : HECT, UBA and WWE domain containing 1 transcript_id : NM_021523.3

name	Hsd17b10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61888837 GeneID:15108 MGI:1333871
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hydroxysteroid (17-beta) dehydrogenase 10 transcript_id : NM_016763.2

name	Ribc1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13385123 GeneID:66611 MGI:1913861
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIB43A domain with coiled-coils 1 transcript_id : NM_025660.1

name	Smc1a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:9790236 GeneID:24061 MGI:1344345
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : structural maintenance of chromosomes 1A transcript_id : NM_019710.1

name	Iqsec2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53832027 GeneID:245666 MGI:3528396
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : IQ motif and Sec7 domain 2 transcript_id : NM_001005475.1

name	Jarid1c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:24475590 GeneID:20591 MGI:99781
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : jumonji, AT rich interactive domain 1C (Rbp2 like) transcript_id : NM_013668.2

name	2900056M20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408435 GeneID:72997 MGI:1920247
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 2900056M20 gene transcript_id : XM_898625.2

name	Tspyl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:87239982 GeneID:52808 MGI:106244
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TSPY-like 2 transcript_id : NM_029836.3

name	Gpr173 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:66793433 GeneID:70771 MGI:1918021
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G-protein coupled receptor 173 transcript_id : NM_027543.3

name	LOC635396 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272453 GeneID:635396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : hypothetical LOC635396 transcript_id : XM_001473639.1

name	Shroom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347787 GeneID:110380 MGI:107194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 2 transcript_id : NM_172441.2

name	Gpr143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347371 GeneID:18241 MGI:107193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 143 transcript_id : NM_010951.3

name	LOC100039874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272455 GeneID:100039874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Predicted gene, EG434881 transcript_id : XM_001473706.1

name	LOC667147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272504 GeneID:667147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 12 Proteins product : similar to ribosomal protein L7a transcript_id : XM_001474961.1

name	EG624124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408441 GeneID:624124 MGI:3648396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1639 ESTs, 9 Proteins product : predicted gene, EG624124, transcript variant 1 transcript_id : XM_889835.2

name	Usp51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408442 GeneID:434872 MGI:3588217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : ubiquitin specific protease 51 transcript_id : XM_988754.1

name	Gnl3l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37674224 GeneID:237107 MGI:2448557
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : guanine nucleotide binding protein-like 3 (nucleolar)-like protein_id : NP_932778.1

name	Fgd1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31982367 CCDS:CCDS30467.1 GeneID:14163 MGI:104566
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005794 - Golgi apparatus [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA]; GO:0030027 - lamellipodium [Evidence IDA]; GO:0001726 - ruffle [Evidence IDA] GO_function : GO:0005085 - guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005089 - Rho guanyl-nucleotide exchange factor activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IDA]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0008360 - regulation of cell shape [Evidence IDA]; GO:0035023 - regulation of Rho protein signal transduction [Evidence IEA] codon_start : 1 note : faciogenital dysplasia product : faciogenital dysplasia homolog protein_id : NP_032027.2

name	Tsr2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424736 CCDS:CCDS30468.1 GeneID:69499 MGI:1916749
definition	codon_start : 1 product : TSR2, 20S rRNA accumulation, homolog protein_id : NP_780355.1

name	Wnk3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408423 GeneID:279561 MGI:2652875
definition	codon_start : 1 note : overriding stop codons product : similar to Serine/threonine-protein kinase WNK3 (Protein kinase with no lysine 3) (Protein kinase, lysine-deficient 3) isoform 3 protein_id : XP_914679.2 transl_except : (pos:147671256..147671258,aa:OTHER)

name	LOC675278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272494 GeneID:675278
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001474507.1

name	LOC675278 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272496 GeneID:675278
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001474528.1

name	ORF34 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723307 GeneID:207375 MGI:2387687
definition	codon_start : 1 note : C9orf10-like product : hypothetical protein LOC207375 protein_id : NP_932773.2

name	LOC100039760 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272440 GeneID:100039760
definition	codon_start : 1 product : similar to ribosomal protein L39 protein_id : XP_001473499.1

name	Phf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28893223 CCDS:CCDS30470.1 GeneID:320595 MGI:2444341
definition	GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : PHD finger protein 8 protein_id : NP_796175.1

name	Huwe1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61676190 GeneID:59026 MGI:1926884
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence ISS] [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003677 - DNA binding [Evidence ISS] [Evidence IEA]; GO:0016874 - ligase activity [Evidence IEA]; GO:0004842 - ubiquitin-protein ligase activity [Evidence ISS] [Evidence IEA] GO_process : GO:0016574 - histone ubiquitination [Evidence ISS]; GO:0051028 - mRNA transport [Evidence IEA]; GO:0006464 - protein modification [Evidence IEA]; GO:0000209 - protein polyubiquitination [Evidence ISS]; GO:0006512 - ubiquitin cycle [Evidence IEA] codon_start : 1 exception : mismatches in translation note : upstream regulatory element binding protein 1; Mcl-1 ubiquitin ligase product : HECT, UBA and WWE domain containing 1 protein_id : NP_067498.3

name	Hsd17b10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:61888838 CCDS:CCDS30471.1 GeneID:15108 MGI:1333871
definition	GO_component : GO:0005783 - endoplasmic reticulum [Evidence IDA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0047015 - 3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity [Evidence IEA]; GO:0003857 - 3-hydroxyacyl-CoA dehydrogenase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : hydroxyacyl-Coenzyme A dehydrogenase, type II product : hydroxyacyl-Coenzyme A dehydrogenase type II protein_id : NP_058043.3

name	Ribc1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385124 CCDS:CCDS30472.1 GeneID:66611 MGI:1913861
definition	GO_component : GO:0019861 - flagellum [Evidence IEA] codon_start : 1 product : RIB43A domain with coiled-coils 1 protein_id : NP_079936.1

name	Smc1a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9790237 CCDS:CCDS30473.1 GeneID:24061 MGI:1344345
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0008280 - cohesin core heterodimer [Evidence ISS]; GO:0000776 - kinetochore [Evidence ISS]; GO:0005634 - nucleus [Evidence ISS] GO_function : GO:0016887 - ATPase activity [Evidence IEA]; GO:0003682 - chromatin binding [Evidence ISS]; GO:0003777 - microtubule motor activity [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0000075 - cell cycle checkpoint [Evidence ISS]; GO:0051301 - cell division [Evidence IEA]; GO:0051276 - chromosome organization and biogenesis [Evidence IEA]; GO:0042770 - DNA damage response, signal transduction [Evidence ISS]; GO:0006281 - DNA repair [Evidence ISS] [Evidence IEA]; GO:0007126 - meiosis [Evidence IPI] [Evidence ISS]; GO:0007067 - mitosis [Evidence IEA]; GO:0007064 - mitotic sister chromatid cohesion [Evidence ISS]; GO:0007052 - mitotic spindle organization and biogenesis [Evidence ISS]; GO:0006974 - response to DNA damage stimulus [Evidence IEA]; GO:0009314 - response to radiation [Evidence ISS] codon_start : 1 exception : mismatches in translation note : chromosome segregation protein SmcB; segregation of mitotic chromosomes b; SMC; SMC (segregation of mitotic chromosomes 1)-like 1 product : SMC1 structural maintenance of chromosomes 1-like 1 protein_id : NP_062684.1

name	Iqsec2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53832028 GeneID:245666 MGI:3528396
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0005086 - ARF guanyl-nucleotide exchange factor activity [Evidence IEA] GO_process : GO:0032012 - regulation of ARF protein signal transduction [Evidence IEA] codon_start : 1 product : IQ motif and Sec7 domain 2 protein_id : NP_001005475.1

name	Jarid1c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22094117 GeneID:20591 MGI:99781
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : selected mouse cDNA on the X product : jumonji, AT rich interactive domain 1C (Rbp2 like) protein_id : NP_038696.1

name	2900056M20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004518 GeneID:72997 MGI:1920247
definition	codon_start : 1 product : hypothetical protein LOC72997 protein_id : XP_903718.1

name	Tspyl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859738 CCDS:CCDS30474.1 GeneID:52808 MGI:106244
definition	GO_process : GO:0051301 - cell division [Evidence IEA] codon_start : 1 note : differentially expressed nucleolar TGF-beta1 target; cell division autoantigen 1 nucleolar protein; CASK interacting nucleosome assembly protein product : nucleolar TGF-beta1 target protein protein_id : NP_084112.1

name	Gpr173 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31541943 CCDS:CCDS30475.1 GeneID:70771 MGI:1918021
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : G protein-coupled receptor SREB3 product : super conserved receptor expressed in brain 3 protein_id : NP_081819.2

name	LOC635396 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272454 GeneID:635396
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473689.1

name	Shroom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347788 GeneID:110380 MGI:107194
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : apical protein, Xenopus laevis-like product : shroom family member 2 protein_id : NP_766029.2

name	Gpr143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347372 CCDS:CCDS30476.1 GeneID:18241 MGI:107193
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : mouse homolog of human ocular albinism 1 (Nettleship-Falls) product : G protein-coupled receptor 143 protein_id : NP_035081.3

name	LOC100039874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272456 GeneID:100039874
definition	codon_start : 1 product : similar to Predicted gene, EG434881 protein_id : XP_001473756.1

name	LOC667147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272505 GeneID:667147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475011.1

name	EG624124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004436 GeneID:624124 MGI:3648396
definition	codon_start : 1 product : similar to ribosomal protein S7 isoform 1 protein_id : XP_894928.1

name	Usp51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408443 GeneID:434872 MGI:3588217
definition	codon_start : 1 product : hypothetical protein protein_id : XP_993848.1

name	LOC100040221 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040221
definition	number : 1 pseudo : _no_value

name	EG667027 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667027
definition	number : 1 pseudo : _no_value

name	LOC385448 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385448
definition	number : 1 pseudo : _no_value

name	LOC237116 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:237116
definition	number : 1 pseudo : _no_value

name	EG635412 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635412
definition	number : 1 pseudo : _no_value

name	EG667130 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667130
definition	number : 1 pseudo : _no_value

name	LOC623804 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272497 GeneID:623804
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 236 ESTs, 9 Proteins product : similar to CDK105 pseudo : _no_value transcript_id : XR_031778.1

name	LOC675514 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272501 GeneID:675514
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 505 ESTs, 23 Proteins product : similar to glyceraldehyde-3-phosphate dehydrogenase pseudo : _no_value transcript_id : XR_031853.1

name	LOC100040394 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272502 GeneID:100040394
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 140 ESTs, 9 Proteins product : similar to ubiquitin-conjugating enzyme E2L 3 pseudo : _no_value transcript_id : XR_031871.1

name	LOC207318 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272503 GeneID:207318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins product : similar to A-X actin pseudo : _no_value transcript_id : XR_031952.1

name	EG667113 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408436 GeneID:667113 MGI:3645517
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 63 Proteins product : predicted gene, EG667113 pseudo : _no_value transcript_id : XR_001976.1

clone name	MSMg01-423A05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-321F16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-414H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-324G24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-473B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438J12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-407I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-515L12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-505M17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-045H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-151O21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-512N03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133F14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-081I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-082D02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-542M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-537I19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-368D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-129G21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-166B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-519C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-056G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-385G12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-439O02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459D04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-218O11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-527E17
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-264K23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409E09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-522E16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-545D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482C11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-207G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172C02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-496J24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-120P13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-339G24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-269I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-270M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-198A04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-419B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479A21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-430N21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150D05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-150D05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-444A04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-469K22
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-428K08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-136K19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-288L22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-373O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-342B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E01
singlet/doublet	singlet
plural/unique	plural

clone name	B6Ng01-252D07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306N22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005L10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-040H03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-069G18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-251C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118M08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-177C16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119H17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189D21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-288M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167J23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104L24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-131F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-136G24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011O05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-291K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249I20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-318L15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024L20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-133D23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166D11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-188N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047A20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-263A06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150C03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-014D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223D15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-286E14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-348F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-147L09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226A09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163F07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-236F15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284A24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-109L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006H20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-337H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-298N03
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-286E14.b	B6Ng01-286E14.g
ACC	GA084522	GA084523
length	1,143	955
definition	B6Ng01-286E14.b	B6Ng01-286E14.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(148,425,983 - 148,427,122)	(71,872,311 - 71,872,466)
sequence	gaattctaaagaaccaagagagggaggcatcatagacagcagatgggggt ttctaggaggagagagccatcaaccatgtcgaatgtagtaagaaagcccc agttacacaaaggctgataaatgaccttcagtgtttggagtgtagctccc aggtagaactgatgttctctgtgtacaaggcctctgggttctactcccag cactaaagggaaaaggaaagtagtcattggtctgggcaacagtcaagtca ttgtgaccctaggaaagcatcatgcaggttcattcaaccatcactcccat gtcctcaaggacaaacattctgctaagagtgtatcttaaacacacactct ctcagagctcatcagaggtgttctcacatctcctctctcttgctgagttc aagccattcacttcaatttggtctcatctcatttggaaatgataaggcca cattcggatgcttcttgcatccatcacttgggggtcctttctttttgcca gtgtcagcagcagacaaagtcaatgcaactctgttttgcagaggtaactg caggaatgctcagcaaggttaactgcattaccttgttatggtttcatctc ccagaagtaaggactatcagtttttctctatttcctgaggattgtgatgt aatgctggaattttttttttggttctattgttgttcttcctatgtagtaa ccattggtctttttcatccctattttttaatgatcttgggagggaaatgc atacaataaagagggagaatgcttaatggtacagatcttcaagaaagtgg aaaggactgggacacaaaacccaattggggagagtgagcatcttcaaaca ttctcttaaccctaaggaatggatggtgtaccttgagacaactttagaaa tataagaagcagcattgacttaatgggtttccatttgctctaaacagtgc tttaagcttcagttccattggagtcagcagaagaaagtttaagagccctg tggacttgtgtggaaaaaacttcttattttattttcactaataagatatg gaccatgtctttctagatagtgtgaataacaaaacctacagtaatatagt cttggtggcttgtcacaattggaaatcagttaggctagacatg	gaattcttgtcagggcttatctagattatttcaactgagggagaaagaat catccatgggctggcattctggagagtataaaaaggagagagagaactga gcacaagaatgcatctctcactctgcttcctgcctgtgatgcaatgtagc cagatgtttcaagtttctgctgacttgacttccctgcaatgatggacatg caccttcaaaactgtaagcctaaatattaactcttccctcccttaaattg cttttatcagaggttacagtaacagaaaaagtaattaatatataaaatta gtattaacaagtagggttctttttttggttttattttgttgttgttgtgg ggtttcaggttgttgtttgttttgtttgttttgttttgctatgtagctct gctgatctggaactcactgtgtagaccaggctgacctcgaactcgcagac attgtctgcctctgcctcccaagtgctgggattaaaggcatgtgccacta cacccagctgagttggggcttttgctatgataaacctgactatgtggttc ttaggcctttgaaactttttttgtggctggaatatggaagagtgtggtac ttgggctagaaaaagtctaacatgctagaattaggatttagtgggtcatt ctcatgggacctttggaagagctgagaagagtgtagacagtggaaacccc agctcatgagatttcagaggggaacaaggactcttagaaaagcaggtcag ggccattcatgtgatattttgtccaagaatctttctgtattctgcttgtg cactaagaacgttgagtgaggtttaacttgaaggcagtgaactaacttgc ttggtaaaggaaatttcaggattagaataagcacttgagctatggtatgg ctactgtttactattcttatccaggtctaccataagaaaaaaaaaaagtg gaagc
quality values	Open. Hide. 47 26 27 35 58 54 58 52 54 58 54 62 62 46 42 27 49 62 62 62 62 62 62 62 54 47 49 56 56 47 62 35 32 24 11 21 21 19 28 28 27 30 59 44 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 50 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 59 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 39 58 58 58 58 54 54 54 58 58 54 58 58 58 58 52 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 52 58 49 54 52 54 58 58 58 58 58 54 54 58 58 54 54 58 54 58 58 53 54 58 58 50 58 58 49 58 51 58 58 58 58 58 51 58 51 51 49 58 58 53 58 58 58 48 51 58 51 46 58 58 42 32 58 58 53 58 58 50 50 33 58 54 37 53 53 53 35 58 46 41 51 58 54 58 53 53 53 58 58 58 51 58 53 54 52 52 58 58 53 53 58 43 51 58 25 50 32 25 58 54 50 51 39 37 46 50 47 58 39 47 41 53 58 58 51 35 35 58 58 58 58 58 58 58 58 53 58 54 37 43 51 42 52 37 54 54 32 54 54 41 50 50 28 41 45 54 41 45 45 53 45 53 42 35 35 34 49 50 34 52 51 54 53 34 54 42 54 54 54 22 39 26 45 40 54 54 37 42 37 54 54 54 54 34 32 54 52 53 34 37 41 32 47 45 53 53 49 42 54 37 37 54 30 29 44 29 31 52 37 46 16 52 45 53 49 52 32 53 21 51 51 42 31 51 52 33 40 36 34 38 31 33 31 47 32 20 26 29 25 25 40 31 35 32 48 45 33 26 30 46 46 42 33 36 31 33 37 51 20 12 45 34 24 31 36 51 38 27 21 22 31 24 30 45 16 11 33 16 25 28 30 31 35 46 46 41 31 27 38 23 31 32 31 21 30 26 31 31 22 22 22 17 46 46 32 20 31 31 31 31 36 32 38 26 42 37 47 33 31 25 34 32 42 34 38 32 34 31 22 14 36 41 17 32 27 32 33 25 36 20 30 33 24 15 12 15 30 29 31 46 41 31 14 46 41 9 9 46 23 21 24 16 25 29 16 32 33 27 38 14 5 10 30 33 25 18 25 12 14 25 25 44 14 34 44 21 31 31 24 36 48 18 22 31 32 28 18 36 44 32 27 20 32 24 31 27 23 41 16 26 18 22 34 27 23 32 18 15 9 8 7 14 18 16 26 17 23 5 7 32 32 24 13 28 28 11 33 6 6 32 39 33 20 17 39 19 8 4 4 4 7 12 36 10 15 30 14 26 21 21 18 22 21 14 7 12 12 14 14 18 34 34 34 38 24 19 18 11 10 6 7 14 11 33 40 13 21 27 38 38 24 9 7 28 7 11 23 9 5 7 5 11 7 10 10 11 15 9 13 18 27 7 21 14 27 26 38 21 20 7 6 6 7 4 6 14 6 21 5 7 18 9 5 6 15 6 5 6 30 23 9 10 19 14 20 16 14 9 19 8 13 8 13 4 3 2 3 13 5 6 4 5 5 16 3 3 2 6 9 17 7 8 2 2 3 8 8 6 7 16 12 2 4 11 4 5 4 4 6 6 19 10 13 6 9 13 15 9 8	Open. Hide. 62 47 51 42 62 62 62 62 62 62 44 23 22 25 21 21 32 62 41 62 62 28 35 59 59 62 59 59 59 62 62 59 46 62 62 62 59 59 59 62 54 54 46 59 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 59 54 56 62 62 56 59 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 54 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 54 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 54 62 62 62 62 59 62 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 49 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 54 62 62 62 62 62 62 41 37 54 62 62 62 54 62 62 62 62 62 62 62 62 62 56 62 54 56 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 54 46 50 62 62 62 62 62 62 62 62 62 52 54 62 62 62 58 58 54 58 58 48 49 46 58 52 54 54 54 52 54 52 47 40 47 42 38 58 58 58 58 58 41 39 54 45 39 54 58 58 58 40 52 54 41 48 54 58 58 50 58 46 42 54 53 54 49 50 39 47 54 42 58 58 58 51 54 52 33 54 52 47 52 54 42 41 54 52 54 46 49 46 42 58 54 52 52 52 58 52 41 34 51 58 54 36 15 58 54 51 53 53 58 58 54 28 46 46 38 58 51 50 47 32 38 36 58 50 41 50 42 16 58 11 27 51 58 23 35 58 26 40 53 50 54 33 42 54 30 58 16 51 37 39 52 29 50 41 30 52 32 51 34 58 51 26 6 41 50 52 26 32 34 50 34 34 42 52 51 31 31 29 39 39 39 14 27 33 8 58 58 58 25 32 37 40 15 14 58 41 30 41 32 16 27 32 16 52 58 58 33 32 41 19 6 51 39 42 22 22 58 20 33 35 21 53 46 39 24 32 45 33 32 42 39 31 20 54 54 34 53 26 33 16 15 33 33 53 53 33 40 52 54 45 35 39 52 23 32 40 34 40 35 42 25 33 35 45 34 31 37 28 34 34 33 31 32 37 33 32 21 18 10 31 37 30 32 42 31 23 37 16 54 24 9 25 31 40 44 45 28 19 9 21 10 9 30 24 32 11 32 26 40 29 19 15 15 12 21 21 23 40 30 34 31 34 52 31 23 45 20 47 27 30 53 41 40 45 18 9 27 8 8 8 6 20 24 22 15 24 8 15 13 18 19 25 32 14 16 37 26 31 18 18 46 8 24 12 34 31 29 12 16 32 20 18 12 14 23 26 33 18 35 28 14 31 23 30 21 10 16 9 13 27 14 9 19 34 35 42 18 15 30 15 42 21 31 46 41 41 40 46 40 46 31 39 22 17 14 8 16 31 36 27 22

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_148425983_148427122
seq2: B6Ng01-286E14.b_49_1191

seq1  GAATTCTAAAGAACCAAGAGAGGGAGGCATCATAGACAGCAGATGGGGGT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTAAAGAACCAAGAGAGGGAGGCATCATAGACAGCAGATGGGGGT  50

seq1  TTCTAGGAGGAGAGAGCCATCAACCATGTCGAATGTAGTAAGAAAGCCCC  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTAGGAGGAGAGAGCCATCAACCATGTCGAATGTAGTAAGAAAGCCCC  100

seq1  AGTTACACAAAGGCTGATAAATGACCTTCAGTGTTTGGAGTGTAGCTCCC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTACACAAAGGCTGATAAATGACCTTCAGTGTTTGGAGTGTAGCTCCC  150

seq1  AGGTAGAACTGATGTTCTCTGTGTACAAGGCCTCTGGGTTCTACTCCCAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTAGAACTGATGTTCTCTGTGTACAAGGCCTCTGGGTTCTACTCCCAG  200

seq1  CACTAAAGGGAAAAGGAAAGTAGTCATTGGTCTGGGCAACAGTCAAGTCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTAAAGGGAAAAGGAAAGTAGTCATTGGTCTGGGCAACAGTCAAGTCA  250

seq1  TTGTGACCCTAGGAAAGCATCATGCAGGTTCATTCAACCATCACTCCCAT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGACCCTAGGAAAGCATCATGCAGGTTCATTCAACCATCACTCCCAT  300

seq1  GTCCTCAAGGACAAACATTCTGCTAAGAGTGTATCTTAAACACACACTCT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCTCAAGGACAAACATTCTGCTAAGAGTGTATCTTAAACACACACTCT  350

seq1  CTCAGAGCTCATCAGAGGTGTTCTCACATCTCCTCTCTCTTGCTGAGTTC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAGAGCTCATCAGAGGTGTTCTCACATCTCCTCTCTCTTGCTGAGTTC  400

seq1  AAGCCATTCACTTCAATTTGGTCTCATCTCATTTGGAAATGATAAGGCCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCCATTCACTTCAATTTGGTCTCATCTCATTTGGAAATGATAAGGCCA  450

seq1  CATTCGGATGCTTCTTGCATCCATCACTTGGGGGTCCTTTCTTTTTGCCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCGGATGCTTCTTGCATCCATCACTTGGGGGTCCTTTCTTTTTGCCA  500

seq1  GTGTCAGCAGCAGACAAAGTCAATGCAACTCTGTTTTGCAGAGGTAACTG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGTCAGCAGCAGACAAAGTCAATGCAACTCTGTTTTGCAGAGGTAACTG  550

seq1  CAGGAATGCTCAGCAAGGTTAACTGCATTACCTTGTTATGGTTTCATCTC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGAATGCTCAGCAAGGTTAACTGCATTACCTTGTTATGGTTTCATCTC  600

seq1  CCAGAAGTAAGGACTATCAGTTTTTCTCTATTTCCTGAGGATTGTGATGT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCAGAAGTAAGGACTATCAGTTTTTCTCTATTTCCTGAGGATTGTGATGT  650

seq1  AATGCTGGAATTTTTTTTTTGGTTCTATTGTTGTTCTTCCTATGTAGTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGCTGGAATTTTTTTTTTGGTTCTATTGTTGTTCTTCCTATGTAGTAA  700

seq1  CCATTGGTCTTTTTCATCCCTATTTTTTAATGATCTTGGGAGGGAAATGC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCATTGGTCTTTTTCATCCCTATTTTTTAATGATCTTGGGAGGGAAATGC  750

seq1  ATACAATAAAGAGGGAGAATGCTTAATGGTACAGATCTTCAAGAAAGTGG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATACAATAAAGAGGGAGAATGCTTAATGGTACAGATCTTCAAGAAAGTGG  800

seq1  AAAGGACTGGGACACAAAACCCAATTGGGGAGAGTGAGCATCTTCAAACA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGGACTGGGACACAAAACCCAATTGGGGAGAGTGAGCATCTTCAAACA  850

seq1  TTCTCTTAACCCTAAGGAATGGATGGTGTACCTTGAGACAACTTTAGAAA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCTCTTAACCCTAAGGAATGGATGGTGTACCTTGAGACAACTTTAGAAA  900

seq1  TAATAAGAAGCAGCATTGACTTAAT-GGTTTCCATTTGCTCTAAACAGTG  949
      | ||||||||||||||||||||||| ||||||||||||||||||||||||
seq2  T-ATAAGAAGCAGCATTGACTTAATGGGTTTCCATTTGCTCTAAACAGTG  949

seq1  C-TTAAGCTTCAG-TCCATTGGAGTCAGCAG-AGAAAGTTTAAGGAGCCT  996
      | ||||||||||| ||||||||||||||||| ||||||||||||   |||
seq2  CTTTAAGCTTCAGTTCCATTGGAGTCAGCAGAAGAAAGTTTAAGAGCCCT  999

seq1  GTGGACTTGTGTGGAAAAAACTTCCTA-TTTATTTTCACTAAT-AGATAT  1044
      |||||||||||||||||||||||| || ||||||||||||||| ||||||
seq2  GTGGACTTGTGTGGAAAAAACTTCTTATTTTATTTTCACTAATAAGATAT  1049

seq1  GGACCATGTCTTTCTAGATAGTGTGAATAACAAA--CTACAGTAATATTA  1092
      ||||||||||||||||||||||||||||||||||  ||||||||||| ||
seq2  GGACCATGTCTTTCTAGATAGTGTGAATAACAAAACCTACAGTAATA-TA  1098

seq1  GTTCTTGTGGCTTTGTCACCAATTGAAATCAGGTTTTAGCTAGACATG  1140
      ||  | ||||| ||||||| | | ||||||||  ||  ||||||||||
seq2  GTCTTGGTGGC-TTGTCACAATTGGAAATCAG--TTAGGCTAGACATG  1143

seq1: chr12_71872311_71872466
seq2: B6Ng01-286E14.g_402_558

seq1  ATTTTGTTGTTGTTGTTTTGTTT--GTTTGGTTTTTTGTTTGTTTGTTTG  48
      ||||||||||||||||   ||||  | ||| | |||  ||||||||||| 
seq2  ATTTTGTTGTTGTTGTGGGGTTTCAGGTTGTTGTTTGTTTTGTTTGTTT-  49

seq1  TTTTTCTCTTTGGAGCCTTGGCTGTCCTGGAACTCACTTTGTAGACCAGG  98
      | |||  || || || ||  ||||  |||||||||||| |||||||||||
seq2  TGTTTTGCTATGTAG-CTCTGCTGATCTGGAACTCACTGTGTAGACCAGG  98

seq1  CTGGCCTCGAACTCAGAAAC-TCGCCTACCTCTGCCTCCCAAGTGCTGAG  147
      ||| ||||||||||  | || | | || |||||||||||||||||||| |
seq2  CTGACCTCGAACTCGCAGACATTGTCTGCCTCTGCCTCCCAAGTGCTGGG  148

seq1  ATTAAAGGC  156
      |||||||||
seq2  ATTAAAGGC  157

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information