MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-288D05
Chromosome	X (Build37)
Map Location	150,182,702 - 150,183,414
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Shroom2, Gpr143, LOC100039874, LOC667147, EG624124, Usp51, LOC635253, Mageh1, EG385454, EG436240, Rragb, Klf8, LOC100039932, EG635136, Ubqln2, Cypt3, LOC100039998, LOC667241, Kctd12b, 2210013O21Rik
Downstream gene	Smt3h1-ps, Spin2, 4921511M17Rik, OTTMUSG00000019268, LOC625650, LOC100040020, EG546397, OTTMUSG00000019256, EG434874, LOC635580, EG625767, LOC270665, LOC100040076, 4930524N10Rik, EG434879, LOC667313, 4930542N07Rik, EG434881, LOC100040899, LOC667331
Link	Open Mouse BAC browser

Click to get alignment info.

name	Shroom2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:110380 MGI:107194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpr143 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18241 MGI:107193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039874 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein

name	LOC667147 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 12 Proteins

name	EG624124 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624124 MGI:3648396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1639 ESTs, 9 Proteins

name	Usp51 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434872 MGI:3588217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	LOC635253 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins

name	Mageh1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75625 MGI:1922875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG385454 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:385454 MGI:3646589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 15 Proteins

name	EG436240 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436240 MGI:3645103
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rragb (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245670 MGI:3038613
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Klf8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245671 MGI:2442430
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039932 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039932
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	EG635136 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:635136 MGI:3643652
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Ubqln2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:54609 MGI:1860283
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cypt3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69361 MGI:1916611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039998 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039998
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC667241 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667241
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Kctd12b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:207474 MGI:2444667
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2210013O21Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70123 MGI:1917373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 28 ESTs

name	Smt3h1-ps (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60456 MGI:1926282
definition	note : SMT3 suppressor of mif two 3 homolog 1, pseudogene (S. cerevisiae) pseudo : _no_value

name	Spin2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278240 MGI:3605548
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4921511M17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78092 MGI:1925342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	OTTMUSG00000019268 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:667256 MGI:3709338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	LOC625650 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:625650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	LOC100040020 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040020
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	EG546397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:546397 MGI:3648189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	OTTMUSG00000019256 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625713 MGI:3709336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins

name	EG434874 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434874 MGI:3643221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	LOC635580 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:635580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins

name	EG625767 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:625767 MGI:3644671
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	LOC270665 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:270665
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 Proteins pseudo : _no_value

name	LOC100040076 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040076
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	4930524N10Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75071 MGI:1922321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins

name	EG434879 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434879 MGI:3643220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins

name	LOC667313 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667313
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	4930542N07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75185 MGI:1922435
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG434881 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434881 MGI:3646587
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040899 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins

name	LOC667331 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:667331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 7 Proteins pseudo : _no_value

name	Shroom2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347787 GeneID:110380 MGI:107194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : shroom family member 2 transcript_id : NM_172441.2

name	Gpr143 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347371 GeneID:18241 MGI:107193
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor 143 transcript_id : NM_010951.3

name	LOC100039874 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272455 GeneID:100039874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 1 Protein product : similar to Predicted gene, EG434881 transcript_id : XM_001473706.1

name	LOC667147 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272504 GeneID:667147
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 35 ESTs, 12 Proteins product : similar to ribosomal protein L7a transcript_id : XM_001474961.1

name	EG624124 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408441 GeneID:624124 MGI:3648396
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 1639 ESTs, 9 Proteins product : predicted gene, EG624124, transcript variant 1 transcript_id : XM_889835.2

name	Usp51 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408442 GeneID:434872 MGI:3588217
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : ubiquitin specific protease 51 transcript_id : XM_988754.1

name	LOC635253 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272463 GeneID:635253
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 ESTs, 2 Proteins product : similar to ubiquitin specific peptidase 51 transcript_id : XM_001473738.1

name	Mageh1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124244089 GeneID:75625 MGI:1922875
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : melanoma antigen, family H, 1 transcript_id : NM_023788.3

name	EG385454 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408448 GeneID:385454 MGI:3646589
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 15 Proteins product : predicted gene, EG385454 transcript_id : XM_358238.5

name	EG436240 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142364699 GeneID:436240 MGI:3645103
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG436240 transcript_id : NM_001034894.2

name	Rragb (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:51921310 GeneID:245670 MGI:3038613
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Ras-related GTP binding B transcript_id : NM_001004154.1

name	Klf8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142344176 GeneID:245671 MGI:2442430
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kruppel-like factor 8 transcript_id : NM_173780.3

name	Ubqln2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34328235 GeneID:54609 MGI:1860283
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquilin 2 transcript_id : NM_018798.2

name	Cypt3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842382 GeneID:69361 MGI:1916611
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich perinuclear theca 3 transcript_id : NM_173367.2

name	Kctd12b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:40538834 GeneID:207474 MGI:2444667
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : potassium channel tetramerisation domain containing 12b transcript_id : NM_175429.3

name	2210013O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272507 GeneID:70123 MGI:1917373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 27 ESTs product : RIKEN cDNA 2210013O21 gene transcript_id : XM_001475273.1

name	2210013O21Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272506 GeneID:70123 MGI:1917373
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 ESTs product : RIKEN cDNA 2210013O21 gene, transcript variant 2 transcript_id : XM_898756.3

name	Spin2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52851392 GeneID:278240 MGI:3605548
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : spindlin family, member 2 transcript_id : NM_001005370.1

name	4921511M17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408452 GeneID:78092 MGI:1925342
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : RIKEN cDNA 4921511M17 gene transcript_id : XM_989376.1

name	OTTMUSG00000019268 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408451 GeneID:667256 MGI:3709338
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : predicted gene, OTTMUSG00000019268 transcript_id : XM_621118.3

name	LOC625650 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408454 GeneID:625650
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : hypothetical LOC625650 transcript_id : XM_486801.3

name	LOC100040020 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272471 GeneID:100040020
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : hypothetical protein LOC100040020 transcript_id : XM_001473955.1

name	EG546397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272477 GeneID:546397 MGI:3648189
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG546397 transcript_id : XM_621121.4

name	OTTMUSG00000019256 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408459 GeneID:625713 MGI:3709336
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs, 3 Proteins product : predicted gene, OTTMUSG00000019256 transcript_id : XM_136124.4

name	EG434874 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272479 GeneID:434874 MGI:3643221
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : predicted gene, EG434874 transcript_id : XM_486800.5

name	LOC635580 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272481 GeneID:635580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : hypothetical LOC635580 transcript_id : XM_001474001.1

name	EG434879 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408465 GeneID:434879 MGI:3643220
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 ESTs, 3 Proteins product : predicted gene, EG434879 transcript_id : XM_486805.3

name	4930542N07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802341 GeneID:75185 MGI:1922435
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930542N07 gene transcript_id : NM_029199.2

name	EG434881 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:81230475 GeneID:434881 MGI:3646587
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG434881 transcript_id : NM_001037167.1

name	LOC100040899 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272513 GeneID:100040899
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : similar to Predicted gene, EG434881 transcript_id : XM_001475438.1

name	Shroom2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347788 GeneID:110380 MGI:107194
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0005515 - protein binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : apical protein, Xenopus laevis-like product : shroom family member 2 protein_id : NP_766029.2

name	Gpr143 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347372 CCDS:CCDS30476.1 GeneID:18241 MGI:107193
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0003674 - molecular_function [Evidence IEA] [Evidence ND]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : mouse homolog of human ocular albinism 1 (Nettleship-Falls) product : G protein-coupled receptor 143 protein_id : NP_035081.3

name	LOC100039874 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272456 GeneID:100039874
definition	codon_start : 1 product : similar to Predicted gene, EG434881 protein_id : XP_001473756.1

name	LOC667147 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272505 GeneID:667147
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475011.1

name	EG624124 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004436 GeneID:624124 MGI:3648396
definition	codon_start : 1 product : similar to ribosomal protein S7 isoform 1 protein_id : XP_894928.1

name	Usp51 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408443 GeneID:434872 MGI:3588217
definition	codon_start : 1 product : hypothetical protein protein_id : XP_993848.1

name	LOC635253 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272464 GeneID:635253
definition	codon_start : 1 product : similar to ubiquitin specific peptidase 51 protein_id : XP_001473788.1

name	Mageh1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:12963825 CCDS:CCDS30478.1 GeneID:75625 MGI:1922875
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND] codon_start : 1 product : melanoma antigen, family H, 1 protein_id : NP_076277.1

name	EG385454 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004553 GeneID:385454 MGI:3646589
definition	codon_start : 1 product : similar to Hmgb1 protein protein_id : XP_358238.3

name	EG436240 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:77861897 CCDS:CCDS30479.1 GeneID:436240 MGI:3645103
definition	codon_start : 1 note : likely orthologue of H.Sapien for forkhead box R2 (FOXR2) product : hypothetical protein LOC436240 protein_id : NP_001030066.1

name	Rragb (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51921311 CCDS:CCDS30480.1 GeneID:245670 MGI:3038613
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005737 - cytoplasm [Evidence ISS] [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence ISS]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence ISS] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0007165 - signal transduction [Evidence ISS] codon_start : 1 product : Ras-related GTP binding B protein_id : NP_001004154.1

name	Klf8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30424645 CCDS:CCDS30481.1 GeneID:245671 MGI:2442430
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 product : Kruppel-like factor 8 protein_id : NP_776141.1

name	Ubqln2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34328236 CCDS:CCDS30482.1 GeneID:54609 MGI:1860283
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006464 - protein modification [Evidence IEA] codon_start : 1 note : Ubiquitin-related protein product : ubiquilin 2 protein_id : NP_061268.2

name	Cypt3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842383 CCDS:CCDS30483.1 GeneID:69361 MGI:1916611
definition	codon_start : 1 note : basic protein CKT1R1; cysteine-rich perinuclear theca protein 3 product : cysteine-rich perinuclear theca 3 protein_id : NP_775543.2

name	Kctd12b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30425146 CCDS:CCDS30484.1 GeneID:207474 MGI:2444667
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0008076 - voltage-gated potassium channel complex [Evidence IEA] GO_function : GO:0005216 - ion channel activity [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0005249 - voltage-gated potassium channel activity [Evidence IEA] GO_process : GO:0006813 - potassium ion transport [Evidence IEA] codon_start : 1 product : potassium channel tetramerisation domain containing 12b protein_id : NP_780638.1

name	2210013O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272508 GeneID:70123 MGI:1917373
definition	codon_start : 1 product : hypothetical protein LOC70123 protein_id : XP_001475323.1

name	2210013O21Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004448 GeneID:70123 MGI:1917373
definition	codon_start : 1 product : hypothetical protein LOC70123 isoform 2 protein_id : XP_903849.1

name	Spin2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52851393 CCDS:CCDS30485.1 GeneID:278240 MGI:3605548
definition	GO_process : GO:0007276 - gametogenesis [Evidence IEA] codon_start : 1 note : spindlin-like; spindlin family member 2 product : spindlin family, member 2 protein_id : NP_001005370.1

name	4921511M17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408453 GeneID:78092 MGI:1925342
definition	codon_start : 1 product : hypothetical protein LOC78092 protein_id : XP_994470.1

name	OTTMUSG00000019268 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:63750724 GeneID:667256 MGI:3709338
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621118.1

name	LOC625650 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772538 GeneID:625650
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486801.1

name	LOC100040020 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272472 GeneID:100040020
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474005.1

name	EG546397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272478 GeneID:546397 MGI:3648189
definition	codon_start : 1 product : hypothetical protein protein_id : XP_621121.4

name	OTTMUSG00000019256 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:38086892 GeneID:625713 MGI:3709336
definition	codon_start : 1 product : hypothetical protein protein_id : XP_136124.2

name	EG434874 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272480 GeneID:434874 MGI:3643221
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486800.4

name	LOC635580 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272482 GeneID:635580
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474051.1

name	EG434879 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408466 GeneID:434879 MGI:3643220
definition	codon_start : 1 product : hypothetical protein protein_id : XP_486805.3

name	4930542N07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13386374 CCDS:CCDS30486.1 GeneID:75185 MGI:1922435
definition	codon_start : 1 product : hypothetical protein LOC75185 protein_id : NP_083475.1

name	EG434881 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:81230476 CCDS:CCDS30487.1 GeneID:434881 MGI:3646587
definition	codon_start : 1 product : hypothetical protein LOC434881 protein_id : NP_001032244.1

name	LOC100040899 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272514 GeneID:100040899
definition	codon_start : 1 product : similar to Predicted gene, EG434881 protein_id : XP_001475488.1

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 3 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 2 pseudo : _no_value

name	LOC100039932 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039932
definition	number : 1 pseudo : _no_value

name	EG635136 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:635136
definition	number : 1 pseudo : _no_value

name	LOC100039998 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039998
definition	number : 1 pseudo : _no_value

name	LOC667241 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667241
definition	number : 1 pseudo : _no_value

name	EG625767 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625767
definition	number : 2 pseudo : _no_value

name	EG625767 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:625767
definition	number : 1 pseudo : _no_value

name	LOC270665 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:270665
definition	number : 1 pseudo : _no_value

name	LOC100040076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040076
definition	number : 2 pseudo : _no_value

name	LOC100040076 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040076
definition	number : 1 pseudo : _no_value

name	LOC667313 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667313
definition	number : 1 pseudo : _no_value

name	LOC667313 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:667313
definition	number : 2 pseudo : _no_value

name	4930524N10Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94408464 GeneID:75071 MGI:1922321
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 Proteins product : RIKEN cDNA 4930524N10 gene transcript_id : XR_001603.1

name	LOC667331 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272486 GeneID:667331
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 15 ESTs, 7 Proteins product : similar to non-imprinted in Prader-Willi/Angelman syndrome 2 pseudo : _no_value transcript_id : XR_031557.1

clone name	MSMg01-342B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-486E03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-194H22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-063I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446I04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524I18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-515G14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-438E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-397B04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-183I06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-217O01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-421H22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-526K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-109O01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494E20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-116M18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-046F15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-049M01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-487G17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-418B11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-464E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087A13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-396E16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-166I05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-267B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-307M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-267J16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-447N16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-483N03
singlet/doublet	doublet
plural/unique	plural

clone name	B6Ng01-161N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-298N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-038A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305B19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-053F22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151B18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-196B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222D14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197D20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-147E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151J17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146A13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-296F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-255F11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255H07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-164D18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-119K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-200G13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-183A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288D05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-067C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-048J22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-023M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-279H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153C05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-280A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-168K16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-001O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-092F20
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-288D05.b	B6Ng01-288D05.g
ACC	GA085927	GA085928
length	717	408
definition	B6Ng01-288D05.b	B6Ng01-288D05.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcactttgtagaccaggctggccttgaactcagagatccacctgcc tctgcctcccgagtgctgggattaaaggcgtgcgccaccacgcccggctg gggtgctgtctcttaatggaacatctgtatacactaccttctcctaaggc ttagggaatgatgtgggagaggtggatggggaaaaaaactacagtaaaag aaagatgtggaataagggaggaagaaggcatgaggtatggtgtaatcaga tcaatgaagtgaaaaattctatggaacaagagtattgaattcggtgttac agtttgaatgtgaaacatcccttagaggtgtatgtgttgaagggacagtc cctagtcagtggcactattttgaagtgtgctgaagactttagaagattgg gcctaccaagaagtagctccagcgtgcttttgaagtttcgtgtcctgttc ctggtgcttttcctgtgtctttgtgcttcccggccattatggccactatg agatgaacacctggctcctcccacacctttccaacttggtgctttgccat gcctcaggcttaaaagcaacagagctagttagctgtgcactaaaacctct gaaaccacaagccaaaatacataataaacaaacagttaataacccctccc ttctttgttgttttaaaatttattagccaagaaatggaaaaaccctagca tacacctagaaagcggg	atcccatatacagtaatcaaacccagacactattatggatgcaaaaatgt acatgctgacaggagtctgatatagctgtctcctgagaggccctgccaga gccttacaaatacagagttagatgatcacagccaaccatttgactgagtg cggggggtccccagtagtggagttagacaaaggactgaaggaattggagg agtttccaaccccatagaaagaacaacaatatcaaccaaccagacccccc ctccccaagaactcccagggactaagccatcaacaaaggagtacacatgg ctccaacagcatatgtagcagaggatggccttgtcatgcatcaataggag aaaaggcccttggtcctatgccccagtgtaggggaattaagggtggggta gtgggagt
quality values	Open. Hide. 47 25 21 26 54 41 29 42 52 62 62 62 54 49 38 47 38 37 38 43 56 56 62 62 62 56 62 62 62 54 24 24 32 30 32 13 13 28 17 21 32 30 24 24 43 45 56 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 59 62 62 62 62 54 54 54 54 59 59 56 54 59 59 49 45 48 56 50 46 56 56 59 59 56 56 62 59 62 62 59 56 62 56 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 59 59 62 59 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 62 62 59 62 59 59 62 59 62 62 62 56 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 62 62 59 59 62 54 49 62 59 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 59 62 56 59 51 59 54 59 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 50 62 56 56 59 59 62 56 62 59 59 59 62 62 59 62 51 59 59 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 51 46 48 42 46 56 62 59 62 62 62 62 62 59 59 51 54 48 62 62 62 59 62 59 56 59 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 43 62 59 62 59 59 59 50 59 59 56 59 59 49 59 59 59 51 62 59 62 62 62 59 62 62 62 59 59 59 51 59 59 49 49 59 59 59 49 49 59 59 49 62 51 59 51 50 59 59 40 50 56 56 59 59 59 59 62 59 51 59 59 59 59 59 49 36 49 56 43 59 59 59 62 59 59 59 56 51 45 51 39 34 30 18 32 28 23 34 34 18 59 59 59 59 51 56 59 51 51 59 56 59 59 56 59 59 59 59 51 59 59 59 56 43 59 59 59 51 56 59 62 59 62 62 56 56 62 59 59 62 62 59 59 45 44 56 56 50 56 51 56 39 51 42 47 56 56 44 47 45 56 62 56 51 56 56 62 51 47 32 32 27 33 33 33 62 56 20 17 25 13 13 20 31 51 22 37 31 42 42 33 33 32 51 56 56 56 51 51 51 56 56 56 47 47 40 43 39 38 38 56 56 56 41 12 14 9 11 9 15 46 62 40 56 62 56 42 33 27 30 27 30 30 42 40 35 35 34 27 22 9 18 27 49 43 38 35 25 46 28 33 25 27 32 28 16 43 12 24 35 24 34 32 28 25 18 22 32 40 30 40 30 50 41 34 23 40 52 42 45 54 58 58 35 35 46 27 27 32 46 35 49 35 25 34 37 35 35 23 29 33 52 32 30 24 26 22 27 30 52 15 25 27 19 18 25 39 22 23 8 21 38 16 54 46 39 54 35 47 52 46 35 33 38 41 30 46 25 42 41 52 34 37 34 37 46 52 45 41 50 52 50 49 50 51 30 38 31 37 24 32 51 37 39 23 42 23 22 30 41 28 26 18 13 15 18 18 18 14 19 28 13 28 30 39 33 50 39 39 47 51 24 24 18 27 22 17 28 11 13 12	Open. Hide. 51 59 59 62 59 59 30 24 30 23 39 16 23 28 28 27 40 35 46 46 50 56 59 59 59 46 59 59 56 59 59 62 62 54 56 54 62 62 59 59 62 62 59 59 59 62 59 62 62 62 59 62 59 62 59 56 50 50 46 50 43 50 54 54 49 62 62 62 54 54 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 54 59 59 62 62 59 62 62 62 62 62 62 59 59 59 59 59 62 62 62 62 62 59 59 54 62 59 59 51 51 62 59 59 59 59 54 54 62 62 59 62 59 59 62 59 62 59 59 59 62 62 62 59 62 62 62 62 59 59 62 62 54 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 59 62 59 62 59 62 62 62 62 59 62 59 62 59 59 62 59 59 62 62 62 59 59 62 62 56 59 62 62 62 62 56 62 62 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 50 62 62 54 56 62 62 59 59 59 62 56 59 59 59 59 59 59 59 62 62 62 62 62 62 59 56 54 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 49 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 56 62 56 62 44 51 62 62 62 62 62 62 54 51 56 56 62 62 56 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 20 14

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_150182702_150183414
seq2: B6Ng01-288D05.b_46_761

seq1  GAATTCACTTTGTAGACCAGGCTGGCCTTGAACTCAGAGATCCACCTGCC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACTTTGTAGACCAGGCTGGCCTTGAACTCAGAGATCCACCTGCC  50

seq1  TCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCGGCTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGCCTCCCGAGTGCTGGGATTAAAGGCGTGCGCCACCACGCCCGGCTG  100

seq1  GGGTGCTGTCTCTTAATGGAACATCTGTATACACTACCTTCTCCTAAGGC  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGGTGCTGTCTCTTAATGGAACATCTGTATACACTACCTTCTCCTAAGGC  150

seq1  TTAGGGAATGATGTGGGAGAGGTGGATGGGGAAAAAAACTACAGTAAAAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGGAATGATGTGGGAGAGGTGGATGGGGAAAAAAACTACAGTAAAAG  200

seq1  AAAGATGTGGAATAAGGGAGGAAGAAGGCATGAGGTATGGTGTAATCAGA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAGATGTGGAATAAGGGAGGAAGAAGGCATGAGGTATGGTGTAATCAGA  250

seq1  TCAATGAAGTGAAAAATTCTATGGAACAAGAGTATTGAATTCGGTGTTAC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATGAAGTGAAAAATTCTATGGAACAAGAGTATTGAATTCGGTGTTAC  300

seq1  AGTTTGAATGTGAAACATCCCTTAGAGGTGTATGTGTTGAAGGGACAGTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTTTGAATGTGAAACATCCCTTAGAGGTGTATGTGTTGAAGGGACAGTC  350

seq1  CCTAGTCAGTGGCACTATTTTGAAGTGTGCTGAAGACTTTAGAAGATTGG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGTCAGTGGCACTATTTTGAAGTGTGCTGAAGACTTTAGAAGATTGG  400

seq1  GCCTACCAAGAAGTAGCTCCAGCGTGCTTTTGAAGTTTCGTGTCCTGTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTACCAAGAAGTAGCTCCAGCGTGCTTTTGAAGTTTCGTGTCCTGTTC  450

seq1  CTGGTGCTTTTCCTGTGTCTTTGTGCTTCCCGGCCATTATGGCCACTATG  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTGCTTTTCCTGTGTCTTTGTGCTTCCCGGCCATTATGGCCACTATG  500

seq1  AGATGAACACCTGGCTCCTCCCACACCTTTCCAACTTGGTGCTTTGCCAT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGATGAACACCTGGCTCCTCCCACACCTTTCCAACTTGGTGCTTTGCCAT  550

seq1  GCCTCAGGCTTAAAAGCAACAGAGCTAGTTAGCTGTGCACTAAAACCTCT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTCAGGCTTAAAAGCAACAGAGCTAGTTAGCTGTGCACTAAAACCTCT  600

seq1  GAAACCACAAGCCAAAATACATAATAAACAAACAG-TAATAACCCCTCCC  649
      ||||||||||||||||||||||||||||||||||| ||||||||||||||
seq2  GAAACCACAAGCCAAAATACATAATAAACAAACAGTTAATAACCCCTCCC  650

seq1  TTCTTTGTTGTTTTAAAATTTATTAGCCAAGAAATGG-AAAACCCTAGCA  698
      ||||||||||||||||||||||||||||||||||||| ||||||||||||
seq2  TTCTTTGTTGTTTTAAAATTTATTAGCCAAGAAATGGAAAAACCCTAGCA  700

seq1  TACACCTAG-AAGCGG  713
      ||||||||| ||||||
seq2  TACACCTAGAAAGCGG  716

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information