MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-293P12
Chromosome	X (Build37)
Map Location	133,805,912 - 133,807,073
singlet/doublet	singlet
Overlap gene	none
Upstream gene	Ngfrap1, LOC666180, LOC237048, LOC666196, Kir3dl2, LOC100041079, Kir3dl1, Tceal3, Tceal1, Morf4l2, BC065397, Glra4, LOC100041122, Plp1, Rab9b, 1700014N06Rik, LOC621984, LOC100034363, 4930488E11Rik, LOC666244, 2810402A17Rik, Zcchc18, BC031748, LOC666277, LOC436231, LOC666288, LOC100041260, LOC100041272, LOC669737, Esx1, EG666303
Downstream gene	Il1rapl2, 1700025D03Rik
Link	Open Mouse BAC browser

Click to get alignment info.

name	Ngfrap1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12070 MGI:1338016
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666180 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins pseudo : _no_value

name	LOC237048 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:237048
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666196 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 ESTs, 7 Proteins pseudo : _no_value

name	Kir3dl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245615 MGI:3612791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041079 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein

name	Kir3dl1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245616 MGI:2652397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:594844 MGI:1913354
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237052 MGI:2385317
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Morf4l2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56397 MGI:1927167
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	BC065397 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:436230 MGI:3584520
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Glra4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14657 MGI:95750
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein

name	Plp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18823 MGI:97623
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rab9b (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:319642 MGI:2442454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700014N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:69389 MGI:1916639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 Proteins

name	LOC621984 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:621984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 13 Proteins pseudo : _no_value

name	LOC100034363 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034363
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930488E11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:399591 MGI:3026988
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666244 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	2810402A17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67062 MGI:1914312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Zcchc18 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66995 MGI:1914245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	BC031748 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245622 MGI:2384304
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666277 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 127 ESTs, 2 Proteins pseudo : _no_value

name	LOC436231 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:436231
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC666288 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666288
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 Proteins pseudo : _no_value

name	LOC100041260 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041260
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100041272 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041272
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC669737 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669737
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	Esx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13984 MGI:1096388
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG666303 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666303 MGI:3644145
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Il1rapl2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:60367 MGI:1913106
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700025D03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67944 MGI:1915194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ngfrap1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753185 GeneID:12070 MGI:1338016
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nerve growth factor receptor (TNFRSF16) associated protein 1 transcript_id : NM_009750.1

name	Kir3dl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343130 GeneID:245615 MGI:3612791
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 2 transcript_id : NM_177748.2

name	LOC100041079 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272277 GeneID:100041079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 3 ESTs, 1 Protein product : hypothetical protein LOC100041079 transcript_id : XM_001475075.1

name	Kir3dl1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125490383 GeneID:245616 MGI:2652397
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 transcript_id : NM_177749.3

name	Tceal3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71533183 GeneID:594844 MGI:1913354
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 3 transcript_id : NM_001029978.1

name	Tceal1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122806 GeneID:237052 MGI:2385317
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 1 transcript_id : NM_146236.1

name	Morf4l2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:50054116 GeneID:56397 MGI:1927167
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : mortality factor 4 like 2 transcript_id : NM_019768.3

name	BC065397 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142376761 GeneID:436230 MGI:3584520
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC065397 transcript_id : NM_001033001.2

name	Glra4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21040222 GeneID:14657 MGI:95750
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glycine receptor, alpha 4 subunit transcript_id : NM_010297.1

name	LOC100041122 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272279 GeneID:100041122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 ESTs, 1 Protein product : similar to CDNA sequence BC065397 transcript_id : XM_001475362.1

name	Plp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:88196798 GeneID:18823 MGI:97623
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : proteolipid protein (myelin) 1 transcript_id : NM_011123.2

name	Rab9b (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142349713 GeneID:319642 MGI:2442454
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAB9B, member RAS oncogene family transcript_id : NM_176971.2

name	1700014N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408273 GeneID:69389 MGI:1916639
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 36 Proteins product : RIKEN cDNA 1700014N06 gene transcript_id : XM_486774.3

name	LOC100034363 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126723624 GeneID:100034363
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymosin beta-like transcript_id : NM_001080967.2

name	4930488E11Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723611 GeneID:399591 MGI:3026988
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930488E11 gene transcript_id : NM_207267.3

name	LOC666244 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126517490 GeneID:666244
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : thymosin beta-like transcript_id : NM_001081983.1

name	2810402A17Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:126723222 GeneID:67062 MGI:1914312
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2810402A17 gene transcript_id : NM_001082412.1

name	Zcchc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482620 GeneID:66995 MGI:1914245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 18 transcript_id : NM_001035510.1

name	Zcchc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482618 GeneID:66995 MGI:1914245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 18 transcript_id : NM_001035509.1

name	Zcchc18 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:78482622 GeneID:66995 MGI:1914245
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : zinc finger, CCHC domain containing 18 transcript_id : NM_025893.2

name	BC031748 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22122858 GeneID:245622 MGI:2384304
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cDNA sequence BC031748 transcript_id : NM_146261.1

name	Esx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6679696 GeneID:13984 MGI:1096388
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : extraembryonic, spermatogenesis, homeobox 1 transcript_id : NM_007957.1

name	Il1rapl2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13507615 GeneID:60367 MGI:1913106
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 1 receptor accessory protein-like 2 transcript_id : NM_030688.1

name	1700025D03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:125347369 GeneID:67944 MGI:1915194
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700025D03 gene transcript_id : NM_026469.2

name	Ngfrap1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753186 CCDS:CCDS30419.1 GeneID:12070 MGI:1338016
definition	GO_component : GO:0005829 - cytosol [Evidence IDA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005123 - death receptor binding [Evidence IPI]; GO:0046872 - metal ion binding [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006917 - induction of apoptosis [Evidence IDA]; GO:0008625 - induction of apoptosis via death domain receptors [Evidence IPI] codon_start : 1 note : p75NTR-associated Cell Death Executor; brain expressed X-linked 3; granule cell antiserum positive 27 product : nerve growth factor receptor (TNFRSF16) associated protein 1 protein_id : NP_033880.1

name	Kir3dl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244534 GeneID:245615 MGI:3612791
definition	GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : KIR-like receptor 2; killer cell immunoglobulin-like receptor three domains long cytoplasmic tail 2 product : killer immunoglobulin-like receptor-like 2 protein_id : NP_808416.1

name	LOC100041079 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272278 GeneID:100041079
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001475125.1

name	Kir3dl1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125490384 GeneID:245616 MGI:2652397
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 note : killer cell immunoglobulin-like receptor Kir3dl1; killer immunoglobulin receptor-like protein 1; KIR-like receptor 1 product : killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1 protein_id : NP_808417.2

name	Tceal3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71533184 CCDS:CCDS30420.1 GeneID:594844 MGI:1913354
definition	codon_start : 1 exception : mismatches in translation product : transcription elongation factor A (SII)-like 3 protein_id : NP_001025149.1

name	Tceal1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122807 CCDS:CCDS30421.1 GeneID:237052 MGI:2385317
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A (SII)-like 1 protein_id : NP_666348.1

name	Morf4l2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:50054117 CCDS:CCDS30422.1 GeneID:56397 MGI:1927167
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0016568 - chromatin modification [Evidence IEA]; GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 exception : mismatches in translation note : MORF-related gene X product : mortality factor 4 like 2 protein_id : NP_062742.3

name	BC065397 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85701590 GeneID:436230 MGI:3584520
definition	GO_function : GO:0005525 - GTP binding [Evidence IEA] codon_start : 1 product : hypothetical protein LOC436230 protein_id : NP_001028173.1

name	Glra4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21040223 GeneID:14657 MGI:95750
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005624 - membrane fraction [Evidence IEA]; GO:0045211 - postsynaptic membrane [Evidence IEA] GO_function : GO:0005254 - chloride channel activity [Evidence IEA]; GO:0031404 - chloride ion binding [Evidence IEA]; GO:0005230 - extracellular ligand-gated ion channel activity [Evidence IEA]; GO:0004890 - GABA-A receptor activity [Evidence IEA]; GO:0005216 - ion channel activity [Evidence IEA]; GO:0030594 - neurotransmitter receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0006811 - ion transport [Evidence IEA]; GO:0007268 - synaptic transmission [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 exception : mismatches in translation note : glycine receptor alpha4 subunit product : glycine receptor, alpha 4 subunit protein_id : NP_034427.1

name	LOC100041122 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272280 GeneID:100041122
definition	codon_start : 1 product : similar to CDNA sequence BC065397 protein_id : XP_001475412.1

name	Plp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23956058 CCDS:CCDS30424.1 GeneID:18823 MGI:97623
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0008366 - axon ensheathment [Evidence IMP]; GO:0048469 - cell maturation [Evidence IMP]; GO:0042759 - long-chain fatty acid biosynthesis [Evidence IMP]; GO:0042552 - myelination [Evidence TAS] [Evidence IMP] codon_start : 1 note : myelin proteolipid protein; rump shaker; myelin synthesis deficiency product : proteolipid protein 1 protein_id : NP_035253.1

name	Rab9b (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:28892801 CCDS:CCDS30425.1 GeneID:319642 MGI:2442454
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0006810 - transport [Evidence IEA] codon_start : 1 note : RAB9B member RAS oncogene family product : RAB9B, member RAS oncogene family protein_id : NP_795945.1

name	1700014N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772429 GeneID:69389 MGI:1916639
definition	codon_start : 1 product : histone variant H2bl2 protein_id : XP_486774.1

name	4930488E11Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:46402291 GeneID:399591 MGI:3026988
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 exception : unclassified translation discrepancy product : hypothetical protein LOC399591 protein_id : NP_997150.1

name	LOC100034363 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:124378056 GeneID:100034363
definition	codon_start : 1 product : hypothetical protein LOC100034363 protein_id : NP_001074436.1

name	LOC666244 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:126517491 GeneID:666244
definition	codon_start : 1 product : thymosin beta-like protein_id : NP_001075452.1

name	2810402A17Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:126723223 GeneID:67062 MGI:1914312
definition	codon_start : 1 product : mitochondrial carrier triple repeat 6 protein_id : NP_001075881.1

name	Zcchc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78482619 CCDS:CCDS30427.1 GeneID:66995 MGI:1914245
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger CCHC domain containing 18 product : SMAD-interacting zinc finger protein 2 protein_id : NP_001030586.1

name	Zcchc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78482621 CCDS:CCDS30427.1 GeneID:66995 MGI:1914245
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger CCHC domain containing 18 product : SMAD-interacting zinc finger protein 2 protein_id : NP_001030587.1

name	Zcchc18 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:78482623 CCDS:CCDS30427.1 GeneID:66995 MGI:1914245
definition	GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : zinc finger CCHC domain containing 18 product : SMAD-interacting zinc finger protein 2 protein_id : NP_080169.2

name	BC031748 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122859 CCDS:CCDS30428.1 GeneID:245622 MGI:2384304
definition	codon_start : 1 product : hypothetical protein LOC245622 protein_id : NP_666373.1

name	Esx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6679697 GeneID:13984 MGI:1096388
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005667 - transcription factor complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA] codon_start : 1 exception : mismatches in translation note : extraembryonic spermatogenesis homeobox 1 product : extraembryonic, spermatogenesis, homeobox 1 protein_id : NP_031983.1

name	Il1rapl2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13507616 CCDS:CCDS30429.1 GeneID:60367 MGI:1913106
definition	GO_function : GO:0004910 - interleukin-1, Type II, blocking receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] codon_start : 1 product : interleukin 1 receptor accessory protein-like 2 protein_id : NP_109613.1

name	1700025D03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:125347370 GeneID:67944 MGI:1915194
definition	GO_component : GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 note : novel protein likely orthologue of human testis expressed sequence 13A (TEX13A) product : hypothetical protein LOC67944 protein_id : NP_080745.2

name	LOC237048 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:237048
definition	number : 1 pseudo : _no_value

name	LOC436231 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:436231
definition	number : 1 pseudo : _no_value

name	LOC666288 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666288
definition	number : 1 pseudo : _no_value

name	LOC666288 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666288
definition	number : 2 pseudo : _no_value

name	LOC666288 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666288
definition	number : 3 pseudo : _no_value

name	LOC100041260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041260
definition	number : 1 pseudo : _no_value

name	LOC100041260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041260
definition	number : 2 pseudo : _no_value

name	LOC100041260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041260
definition	number : 3 pseudo : _no_value

name	LOC100041272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041272
definition	number : 1 pseudo : _no_value

name	LOC100041272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041272
definition	number : 2 pseudo : _no_value

name	LOC100041272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041272
definition	number : 3 pseudo : _no_value

name	LOC100041272 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041272
definition	number : 4 pseudo : _no_value

name	LOC669737 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669737
definition	number : 1 pseudo : _no_value

name	LOC669737 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669737
definition	number : 2 pseudo : _no_value

name	LOC669737 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669737
definition	number : 3 pseudo : _no_value

name	LOC669737 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669737
definition	number : 4 pseudo : _no_value

name	EG666303 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666303
definition	number : 3 pseudo : _no_value

name	EG666303 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666303
definition	number : 2 pseudo : _no_value

name	EG666303 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666303
definition	number : 1 pseudo : _no_value

name	LOC666180 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272275 GeneID:666180
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 ESTs, 3 Proteins product : similar to RIKEN cDNA 5730427N09 gene pseudo : _no_value transcript_id : XR_032038.1

name	LOC666196 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272276 GeneID:666196
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 81 ESTs, 7 Proteins product : similar to Btf3 protein pseudo : _no_value transcript_id : XR_032046.1

name	LOC621984 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272281 GeneID:621984
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 ESTs, 13 Proteins product : similar to glycogen synthase kinase 3 alpha pseudo : _no_value transcript_id : XR_032263.1

name	LOC666277 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272282 GeneID:666277
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 127 ESTs, 2 Proteins product : similar to ribosomal protein S7 pseudo : _no_value transcript_id : XR_032526.1

clone name	MSMg01-311G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132I17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-142F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-153K09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-187L07
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-074O16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-070P17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-190J17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-330C10
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-529K01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-417D16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-159B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-412H01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-524D09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-483D06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-212P04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348N24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-428L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-366B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504M16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-337J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-265H14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-208I03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158B13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-488L22
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427B14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-206B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-162J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-305K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413N20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-392D07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-341M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-311G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-299A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-165L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106L09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-108G15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-433F03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-051N02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-073L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-300N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-272I21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335M18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-360F22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-053N16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052E14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482E23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-544H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-516I09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143B12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-213C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-311P15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-436H14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519O24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-347I21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010O19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-313E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156H24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-058K02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-174P06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-251F07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-301P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-285K01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-131M01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019O18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218N03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240F04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-264D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145P24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-090P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-149I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327G07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-305P08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-293P12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-115G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-328H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-095C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295H17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-284M11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-255K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163H15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-017K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-106B09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-099A09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024H18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-236M01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-054L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-247I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-056M12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295G23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-189C23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-222I10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283A12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-283B11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-249N03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-013H10
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-293P12.b	B6Ng01-293P12.g
ACC	GA090220	GA090221
length	1,210	1,156
definition	B6Ng01-293P12.b	B6Ng01-293P12.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcacctgaggaataccgaatggcagagaagcacctgaaaaaatg ttcaacatccttaatcatcagggaaatgcaaatcaaaacaaccctgagat tccacctcacaccagtgagaatggctaagatcaaaaattcaggtgacagc agatgctggcgaggatgtggagaaagaggaacactcctccattgttggtg ggattgcaggcttgtacaaccactctggaaatcagtctggcggttcctca gaaaattggacatagtactaccggaggatccagcaatacctctcctgggc atatatccagaagaagccccaactggtaagaaggacacatgctccactat gttcatagcagccttatttataatagccagaaactggaaagaacccagat gcccctcaacagaggaatggatacagaaaatgtggtacatctacacaatg gagtactactcagctattaaaaagaatgaatttatgaaattcctaaccaa atggaaggacctggagagcatcatcctgagtgaggtaacacaatcacaaa ggaactcacacaatatgtactcactgataagtggatactagcccaaaacc taggatacccacgatataagatacaatttcctaaacacatgaaactcaag aaaaatgaagactgaagtgtggacactatgcccctccttagaagtgagaa caaaacacccatggaaggagttacagaaacaaagtatggagctgagatga aaggatggaccatgtagagactgccatatccagggatccaccccataatc agcttccaaatgctgacaccattgcatacactagcaagattttactgaaa ggacccagatgtagctgtctcttgtgagactatgccggggcctagcaaac acagaagtggatgctcacagtcagctaatggatggatcacagggctccca atgggaggagctagagaaagtacccaaggaggctaaagggatcttcacct ataggtgggaacaacattatgaactaacagtacccctggagctctggact ctagctgcatatgtatcaaaggatgggctagtcggccatcactggaaagg agaggtccatggacacgcagaccttgggtgccgggtacaggacgcagtca atgggggcactggctggctaggctatctacttctgcagggtacgatcggt gtcgcagtac	gaattcacctgtgtgcactccccaataatgaggttatagacacgcatagc tgtatttggctttttaacagggatactggaaacttgtgttctaacatttg gacagcacattttataaattcatgaatcatgctaagttattagttctata atttattcttagaaagtttaggtcttcaaagtaggaaaatcttatagaga tgatatcttctaagatcttacaaaaattctttttgcatataaatattggt cacaccctttaataattattccttcccacccaaagtcctctgctagataa ccacatttttctttactttctcttgtatataaccaagtttctggaagaat tctttacatttttcttttgctttgattgtgtctaatttgttcagcctagt gtagtctaacaacatagtaagccagcacgtgttaagattatttatgagct ttgtgttgctaaataagaaggaccatttctgcttgcataactttgaaccc attgtggtgtgtgcttcatgggtcatcatgttctagtgaatctgtccttc cttgaatctatcatgttttattttatttattgtacatgatttctatatgt aaatatccaccatgttaaattagatagacacccagtgtactcacagttca atgaatgccagctttaccatatgagaaagaataaaatgaatcttcagtgg ttttaaaatcacatctagttagaacctacttttctgagtagatggcctgt aaggttcagctctgtcagagccagcagtaaatcccagatcctgtaaaaca atagtttacaaagaacacatagatacttttgtgaatctttgttttctcat atcataagatgaatgatactagtatctttcttattgggttgtggaaaaga ctgtactagtgaaagattgaatgcacaaaattcctttggtattgggtttt agcccttggttaaaacttatttaatttagtctatgttttccccccccctt ctctctttcacacacacacacacatacacacacacacacacacacattgg gaattgcattgttgatttgatctagctttcattacttttttcagcaattg cctttcttaagtcagtaattgagaattgaaataggcattccaggtactaa tatatg
quality values	Open. Hide. 46 25 35 38 62 62 62 32 23 62 62 62 43 22 47 62 38 32 44 62 54 62 62 62 62 62 62 62 62 59 62 43 22 24 25 17 23 23 21 27 27 28 23 25 27 45 56 62 54 54 62 62 59 59 62 62 62 62 62 62 54 62 62 62 62 59 54 62 59 59 62 62 54 32 62 62 62 56 51 35 28 50 56 56 59 56 56 48 48 48 48 62 62 62 62 54 54 54 54 62 62 62 62 54 62 62 62 62 62 62 62 62 59 59 62 54 54 59 59 54 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 54 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 62 54 54 59 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 54 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 43 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 45 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 58 48 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 49 58 58 58 58 58 58 52 58 58 58 42 58 58 58 45 54 52 58 58 58 58 58 54 58 58 54 58 54 54 58 58 54 48 58 58 58 46 58 58 51 41 58 42 39 46 38 58 48 50 58 58 58 52 58 53 54 58 49 58 52 51 54 48 48 54 58 58 54 58 51 52 58 54 51 50 58 50 58 58 49 58 58 51 58 53 50 58 50 58 58 58 58 50 39 54 51 51 50 54 32 54 58 58 58 51 58 58 50 58 43 41 41 50 58 47 51 54 51 49 39 43 54 50 53 58 53 51 50 40 51 58 36 35 47 51 37 49 40 50 39 58 58 35 47 49 41 42 34 44 50 50 54 39 50 18 54 51 31 51 50 32 53 40 35 38 54 24 50 26 54 46 35 45 53 49 51 44 44 32 51 53 45 54 32 37 34 39 40 54 35 16 51 33 32 44 54 52 37 42 42 32 37 33 53 34 53 37 32 35 39 53 31 41 31 45 40 45 28 38 31 32 53 51 26 32 32 35 30 32 46 46 40 32 53 35 42 34 36 29 36 52 45 41 29 32 30 51 31 30 45 31 45 31 31 26 29 25 25 19 33 46 31 31 24 33 30 31 24 30 37 39 31 45 21 29 28 17 6 46 47 20 31 33 31 41 32 47 18 6 13 29 12 33 26 25 31 30 30 42 31 30 31 31 42 43 34 31 30 31 31 33 36 31 41 44 23 27 15 24 30 30 13 28 46 20 47 47 29 27 26 31 31 24 31 25 46 31 27 21 37 33 25 32 33 23 18 9 26 29 24 37 31 38 35 27 32 14 16 20 36 32 29 32 28 25 18 23 18 31 23 23 21 21 23 31 23 23 31 29 31 48 33 13 30 14 33 25 8 24 10 8 37 10 19 31 8 24 11 21 33 24 20 21 9 19 43 26 23 25 26 25 24 11 8 5 24 15 21 5 13 17 32 17 39 18 13 31 16 11 7 11 9 31 14 11 5 6 6 18 19 13 24 20 8 10 27 14 24 18 11 14 13 25 11 26 13 24 27 28 15 17 13 19 10 18 11 3 10 18 24 22 40 47 25 13 24 12 26 13 19 13 6 8 7 11 28 13 10 10 10 19 11 15 17 18 17 8 5 11 10 21 11 15 17 13 23 28 25 4 6 22 10 20 23 8 9 3 9 5 6 7 13 13 7 8 12 23 16 5 8 17 11 2 5 13 8 10 7 18 5 12 7 17 3 13 17 8 8 6 13 6 4 6 13 6 9 6 7 14 6 5 20 20 9 4 6 3 2 3 4 2 5 8 9 6 6 4 12 5 3 2 1 3 5 15 3 7 13 8 1 11 29 29 28 3 1 5 1 2 15 2 1 2 21 12 1 6 6 18 9 1 1 2 5 1 2 4 6 11 8 1 5 5 3 1 4 27 4 11 4 4 18 9 7 5 15 4 4 12 5 4 16 4 4 15 4 4 4	Open. Hide. 37 35 62 47 62 47 32 54 62 31 29 21 25 21 30 22 24 26 34 28 27 27 29 43 43 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 56 48 38 33 38 48 48 46 32 27 36 45 59 59 59 62 59 59 62 62 59 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 54 42 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 49 54 62 62 62 62 62 62 62 62 54 49 54 54 62 62 62 62 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 43 62 54 42 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 58 58 58 58 58 54 58 58 54 52 58 58 58 58 58 54 58 58 41 58 54 58 58 58 54 58 58 46 48 58 58 58 54 54 54 54 58 58 58 49 58 58 58 54 58 58 54 58 58 37 54 58 58 52 54 58 58 54 52 58 58 54 58 58 58 58 58 58 58 52 58 54 54 54 50 58 51 58 51 50 58 58 58 50 51 35 58 50 37 41 49 58 50 58 50 51 58 58 37 50 58 48 58 58 40 41 58 41 30 41 50 48 58 51 52 40 51 43 42 52 53 50 50 58 50 58 26 38 35 58 40 33 53 58 58 51 49 50 54 42 47 54 39 41 52 52 46 52 58 28 39 58 58 37 23 58 58 58 50 53 42 50 39 58 51 41 52 42 54 50 41 50 58 39 39 36 50 49 40 34 58 58 34 42 53 37 39 18 45 39 32 42 31 51 50 32 46 39 51 30 32 49 11 9 7 53 37 37 34 53 39 41 44 54 26 52 35 29 26 8 37 44 26 39 45 42 28 53 52 45 40 45 30 28 27 30 26 54 30 35 49 31 51 36 42 47 54 42 27 24 28 52 42 34 54 52 53 39 52 32 53 45 31 40 51 32 31 52 29 33 27 14 31 32 28 28 35 52 47 40 38 20 21 32 52 32 45 34 52 33 34 19 47 47 43 31 27 35 33 35 32 31 38 31 26 30 33 28 36 23 29 33 31 18 26 37 24 23 31 36 31 29 32 27 30 37 42 48 31 43 33 30 30 26 32 38 46 24 18 42 32 15 21 28 22 46 48 42 21 31 22 22 20 14 24 37 31 31 13 25 41 36 48 31 18 36 16 31 19 25 21 30 32 27 21 31 31 43 34 19 6 14 22 26 27 46 14 21 31 14 26 22 33 16 44 15 20 47 47 17 20 32 31 44 26 28 25 23 19 13 14 17 44 48 25 23 31 26 32 24 47 31 28 32 24 39 32 22 27 22 14 7 20 12 32 29 48 48 29 23 31 39 27 37 24 31 21 20 11 14 13 21 10 7 7 18 39 48 11 23 9 7 5 21 12 8 6 6 14 6 4 7 10 5 3 7 12 8 9 9 14 21 14 7 6 4 5 6 11 9 8 8 6 6 17 5 6 8 11 25 3 3 5 8 8 28 20 23 28 14 6 3 5 8 5 3 17 5 5 16 6 6 4 13 19 23 7 25 9 23 9 11 5 13 7 19 28 28 28 28 23 16 16 6 6 4 5 22 8 6 7 17 12 17 10 6 18 12 3 4 3 3 13 11 5 11 9 9 3 5 9 8 7 7 22 5 8 6 7 9 4 4 6 5 5 18 13 16 8 5 6 15 5 5 5 16 6 1 5 10 5 4 4 4 6 6

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_133805912_133807073
seq2: B6Ng01-293P12.g_70_1225

seq1  GAATTCACCTGTGTGCACTCCCCAATAATGAGGTTATAGACACGCATAGC  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCACCTGTGTGCACTCCCCAATAATGAGGTTATAGACACGCATAGC  50

seq1  TGTATTTGGCTTTTTAACAGGGATACTGGAAACTTGTGTTCTAACATTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGTATTTGGCTTTTTAACAGGGATACTGGAAACTTGTGTTCTAACATTTG  100

seq1  GACAGCACATTTTATAAATTCATGAATCATGCTAAGTTATTAGTTCTATA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACAGCACATTTTATAAATTCATGAATCATGCTAAGTTATTAGTTCTATA  150

seq1  ATTTATTCTTAGAAAGTTTAGGTCTTCAAAGTAGGAAAATCTTATAGAGA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTATTCTTAGAAAGTTTAGGTCTTCAAAGTAGGAAAATCTTATAGAGA  200

seq1  TGATATCTTCTAAGATCTTACAAAAATTCTTTTTGCATATAAATATTGGT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATATCTTCTAAGATCTTACAAAAATTCTTTTTGCATATAAATATTGGT  250

seq1  CACACCCTTTAATAATTATTCCTTCCCACCCAAAGTCCTCTGCTAGATAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACACCCTTTAATAATTATTCCTTCCCACCCAAAGTCCTCTGCTAGATAA  300

seq1  CCACATTTTTCTTTACTTTCTCTTGTATATAACCAAGTTTCTGGAAGAAT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACATTTTTCTTTACTTTCTCTTGTATATAACCAAGTTTCTGGAAGAAT  350

seq1  TCTTTACATTTTTCTTTTGCTTTGATTGTGTCTAATTTGTTCAGCCTAGT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTACATTTTTCTTTTGCTTTGATTGTGTCTAATTTGTTCAGCCTAGT  400

seq1  GTAGTCTAACAACATAGTAAGCCAGCACGTGTTAAGATTATTTATGAGCT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGTCTAACAACATAGTAAGCCAGCACGTGTTAAGATTATTTATGAGCT  450

seq1  TTGTGTTGCTAAATAAGAAGGACCATTTCTGCTTGCATAACTTTGAACCC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTGTTGCTAAATAAGAAGGACCATTTCTGCTTGCATAACTTTGAACCC  500

seq1  ATTGTGGTGTGTGCTTCATGGGTCATCATGTTCTAGTGAATCTGTCCTTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTGGTGTGTGCTTCATGGGTCATCATGTTCTAGTGAATCTGTCCTTC  550

seq1  CTTGAATCTATCATGTTTTATTTTATTTATTGTACATGATTTCTATATGT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTGAATCTATCATGTTTTATTTTATTTATTGTACATGATTTCTATATGT  600

seq1  AAATATCCACCATGTTAAATTAGATAGACACCCAGTGTACTCACAGTTCA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATATCCACCATGTTAAATTAGATAGACACCCAGTGTACTCACAGTTCA  650

seq1  ATGAATGCCAGCTTTACCATATGAGAAAGAATAAAATGAATCTTCAGTGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGAATGCCAGCTTTACCATATGAGAAAGAATAAAATGAATCTTCAGTGG  700

seq1  TTTTAAAATCACATCTAGTTAGAACCTAC-TTTCTGAGTAGATGGCCTGT  749
      ||||||||||||||||||||||||||||| ||||||||||||||||||||
seq2  TTTTAAAATCACATCTAGTTAGAACCTACTTTTCTGAGTAGATGGCCTGT  750

seq1  AAGGTTCAGCTCTGTCAGAGCCAGCAGTAAATCCCAGATCCTGTAAAACA  799
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTTCAGCTCTGTCAGAGCCAGCAGTAAATCCCAGATCCTGTAAAACA  800

seq1  ATAGTTTACAAAGAACACATAGATACTTTTGTGAATCTTTGTTTTCTCAT  849
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGTTTACAAAGAACACATAGATACTTTTGTGAATCTTTGTTTTCTCAT  850

seq1  ATCATAAGATGAATGATACTAGTATCTTTCTTATTGGGTTGTGGAAAAGA  899
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCATAAGATGAATGATACTAGTATCTTTCTTATTGGGTTGTGGAAAAGA  900

seq1  CTGTACTAGTGAAAGATTGAATGCACAAAATTCCTTTGGTATT-GGTTTT  948
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  CTGTACTAGTGAAAGATTGAATGCACAAAATTCCTTTGGTATTGGGTTTT  950

seq1  AGCCCTTGGTTAAAACTTATTTAATTTAGTCTATGTTTTCCCCCCCCC-T  997
      |||||||||||||||||||||||||||||||||||||||||||||||| |
seq2  AGCCCTTGGTTAAAACTTATTTAATTTAGTCTATGTTTTCCCCCCCCCTT  1000

seq1  CTCTCTTTCACACACACACACACACACACACACACACACACACACACACA  1047
      ||||||||      |||||||||||||||| |||||||||||||||||||
seq2  CTCTCTTT------CACACACACACACACATACACACACACACACACACA  1044

seq1  CAATTGGTATTGCATTGTTTGAATTTGAATCTAGCTTCCATTACTTTTTT  1097
      || | || |||||||||||   ||||| ||||||||| ||||||||||||
seq2  CATTGGGAATTGCATTGTT--GATTTG-ATCTAGCTTTCATTACTTTTTT  1091

seq1  CAGC-ATTGCCTTTCTTTTAGTCAGTAAAATGAGAATGAAAATA-GCATT  1145
      |||| |||||||||| || ||||||| || |||||||  ||||| |||||
seq2  CAGCAATTGCCTTTC-TTAAGTCAGT-AATTGAGAATTGAAATAGGCATT  1139

seq1  -CAAGTACTATATATATG  1162
       || |||||| |||||||
seq2  CCAGGTACTA-ATATATG  1156

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information