MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-294L04
Chromosome	X (Build37)	X (Build37)
Map Location	131,709,843 - 131,710,903	131,887,393 - 131,888,556
singlet/doublet	singlet	singlet
Overlap gene	LOC100040635
Upstream gene	Arl13a, 4732479N06Rik, LOC100040849, Tmem35, Cenpi, Drp2, Taf7l, LOC669370, LOC674122, Timm8a1, Btk, Rpl36a, Gla, Hnrph2, LOC665936, LOC665941, Armcx1, LOC100040933, LOC100040520, Armcx6, Armcx3, Armcx2, LOC637800, LOC100040987, Nxf2, B930008K04Rik, EG621246
Downstream gene	Tceal6, EG621322, Pramel3, EG621352, EG331529, EG621380, EG666040, EG666045, AV320801, EG621467, Nxf7, 4930534P07Rik, 1700008I05Rik, 1700129I15Rik, Gprasp1, Gprasp2, Bhlhb9, LOC100041110, 2900062L11Rik, 6530401D17Rik, Bex2, Nxf3, Bex4, Tceal8
Link	Open Mouse BAC browser

Click to get alignment info.

name	Arl13a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74448 MGI:1921698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins

name	4732479N06Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215201 MGI:2442530
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040849 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040849
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 Proteins pseudo : _no_value

name	Tmem35 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67564 MGI:1914814
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cenpi (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:102920 MGI:2147897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Drp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:13497 MGI:107432
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Taf7l (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74469 MGI:1921719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC669370 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:669370
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC674122 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins pseudo : _no_value

name	Timm8a1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:30058 MGI:1353433
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Btk (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12229 MGI:88216
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Rpl36a (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:19982 MGI:1201789
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gla (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:11605 MGI:1347344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hnrph2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56258 MGI:1201779
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins pseudo : _no_value

name	LOC665941 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins pseudo : _no_value

name	Armcx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78248 MGI:1925498
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040933 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 4 Proteins

name	LOC100040520 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Armcx6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:278097 MGI:2147993
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armcx3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71703 MGI:1918953
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Armcx2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67416 MGI:1914666
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC637800 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:637800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins pseudo : _no_value

name	LOC100040987 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040987
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Nxf2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83454 MGI:1933192
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	B930008K04Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:215693 MGI:2442284
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621246 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621246 MGI:3645256
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	LOC100040635 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins

name	Tceal6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66104 MGI:1923939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621322 MGI:3643636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	Pramel3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83565 MGI:1890657
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621352 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621352 MGI:3647031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG331529 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331529 MGI:3647038
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG621380 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621380 MGI:3648721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	EG666040 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666040 MGI:3648697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins

name	EG666045 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666045 MGI:3648700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins

name	AV320801 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:331531 MGI:3035227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins

name	EG621467 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:621467 MGI:3643481
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Nxf7 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:170722 MGI:2159343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930534P07Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:75829 MGI:1923079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins

name	1700008I05Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:71841 MGI:1919091
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	1700129I15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78478 MGI:1925728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gprasp1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:67298 MGI:1917418
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 3 mRNAs

name	Gprasp2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 58 ESTs, 3 Proteins

name	Bhlhb9 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70237 MGI:1917487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041110 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041110
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	2900062L11Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76976 MGI:1924226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	6530401D17Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:76219 MGI:1923469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA pseudo : _no_value

name	Bex2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:12069 MGI:1338017
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Nxf3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245610 MGI:2685230
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Bex4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:406217 MGI:3606746
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Tceal8 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66684 MGI:1913934
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Arl13a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408238 GeneID:74448 MGI:1921698
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 2 ESTs, 2 Proteins product : ADP-ribosylation factor-like 13A, transcript variant 1 transcript_id : XM_136037.3

name	4732479N06Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27369763 GeneID:215201 MGI:2442530
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4732479N06 gene transcript_id : NM_172540.1

name	Tmem35 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31982652 GeneID:67564 MGI:1914814
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transmembrane protein 35 transcript_id : NM_026239.2

name	Cenpi (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130223 GeneID:102920 MGI:2147897
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : centromere protein I transcript_id : NM_145924.2

name	Drp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345112 GeneID:13497 MGI:107432
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : dystrophin related protein 2 transcript_id : NM_010078.2

name	Taf7l (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118130557 GeneID:74469 MGI:1921719
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor transcript_id : NM_028958.3

name	Timm8a1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373281 GeneID:30058 MGI:1353433
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : translocase of inner mitochondrial membrane 8 homolog a1 (yeast) transcript_id : NM_013898.2

name	Btk (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:7709993 GeneID:12229 MGI:88216
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Bruton agammaglobulinemia tyrosine kinase transcript_id : NM_013482.1

name	Rpl36a (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802220 GeneID:19982 MGI:1201789
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ribosomal protein L36a transcript_id : NM_019865.3

name	Gla (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:133778923 GeneID:11605 MGI:1347344
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : galactosidase, alpha transcript_id : NM_013463.2

name	Hnrph2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980970 GeneID:56258 MGI:1201779
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heterogeneous nuclear ribonucleoprotein H2 transcript_id : NM_019868.2

name	Armcx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:46402516 GeneID:78248 MGI:1925498
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 1 transcript_id : NM_030066.2

name	LOC100040933 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272270 GeneID:100040933
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 31 ESTs, 4 Proteins product : similar to Armadillo repeat containing, X-linked 6 transcript_id : XM_001475509.1

name	LOC100040520 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272253 GeneID:100040520
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100040520 transcript_id : XM_001474152.1

name	Armcx6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:56090482 GeneID:278097 MGI:2147993
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 6 transcript_id : NM_001007578.1

name	Armcx3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:21311832 GeneID:71703 MGI:1918953
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 3 transcript_id : NM_027870.1

name	Armcx2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142372774 GeneID:67416 MGI:1914666
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : armadillo repeat containing, X-linked 2 transcript_id : NM_026139.3

name	Nxf2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13752590 GeneID:83454 MGI:1933192
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 2 transcript_id : NM_031259.1

name	B930008K04Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:111185886 GeneID:215693 MGI:2442284
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA B930008K04 gene transcript_id : NM_175446.3

name	LOC100040635 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272260 GeneID:100040635
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins product : similar to AV320801 protein transcript_id : XM_001474398.1

name	Tceal6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142377046 GeneID:66104 MGI:1923939
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 6 transcript_id : NM_025355.3

name	EG621322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83003999 GeneID:621322 MGI:3643636
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621322 transcript_id : XM_885719.1

name	Pramel3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878222 GeneID:83565 MGI:1890657
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : preferentially expressed antigen in melanoma-like 3 transcript_id : NM_031390.1

name	EG621352 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408263 GeneID:621352 MGI:3647031
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621352 transcript_id : XM_885753.2

name	EG331529 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142354224 GeneID:331529 MGI:3647038
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : predicted gene, EG331529 transcript_id : NM_183320.2

name	EG621380 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:83004003 GeneID:621380 MGI:3648721
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG621380 transcript_id : XM_885786.1

name	EG666040 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408265 GeneID:666040 MGI:3648697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 4 ESTs, 4 Proteins product : predicted gene, EG666040 transcript_id : XM_981153.1

name	EG666045 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408267 GeneID:666045 MGI:3648700
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins product : predicted gene, EG666045 transcript_id : XM_981193.1

name	AV320801 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408269 GeneID:331531 MGI:3035227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 6 ESTs, 5 Proteins product : expressed sequence AV320801 transcript_id : XM_284742.5

name	Nxf7 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:30794231 GeneID:170722 MGI:2159343
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 7 transcript_id : NM_130888.1

name	4930534P07Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408271 GeneID:75829 MGI:1923079
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 1 EST, 5 Proteins product : RIKEN cDNA 4930534P07 gene transcript_id : XM_136073.3

name	1700008I05Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:141802960 GeneID:71841 MGI:1919091
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700008I05 gene transcript_id : NM_027952.2

name	1700129I15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114158706 GeneID:78478 MGI:1925728
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 1700129I15 gene transcript_id : NM_030106.2

name	Gprasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53729354 GeneID:67298 MGI:1917418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor associated sorting protein 1 transcript_id : NM_001005385.1

name	Gprasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53729356 GeneID:67298 MGI:1917418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor associated sorting protein 1 transcript_id : NM_026081.5

name	Gprasp1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:53729357 GeneID:67298 MGI:1917418
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : G protein-coupled receptor associated sorting protein 1 transcript_id : NM_001004359.2

name	Gprasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408272 GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 58 ESTs, 3 Proteins product : G protein-coupled receptor associated sorting protein 2, transcript variant 1 transcript_id : XM_142154.6

name	Gprasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272267 GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 3 Proteins product : G protein-coupled receptor associated sorting protein 2 transcript_id : XM_001474818.1

name	Gprasp2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272265 GeneID:245607 MGI:2442071
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 58 ESTs, 3 Proteins product : G protein-coupled receptor associated sorting protein 2 transcript_id : XM_001474790.1

name	Bhlhb9 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:37718978 GeneID:70237 MGI:1917487
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : basic helix-loop-helix domain containing, class B9 transcript_id : NM_198161.1

name	Bex2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6753183 GeneID:12069 MGI:1338017
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed X-linked 2 transcript_id : NM_009749.1

name	Nxf3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142366895 GeneID:245610 MGI:2685230
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : nuclear RNA export factor 3 transcript_id : NM_001024141.2

name	Bex4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:47059052 GeneID:406217 MGI:3606746
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : brain expressed gene 4 transcript_id : NM_212457.1

name	Tceal8 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31981214 GeneID:66684 MGI:1913934
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : transcription elongation factor A (SII)-like 8 transcript_id : NM_025703.2

name	Arl13a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985424 GeneID:74448 MGI:1921698
definition	codon_start : 1 product : ADP-ribosylation factor-like 13 isoform 1 protein_id : XP_136037.1

name	4732479N06Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369764 GeneID:215201 MGI:2442530
definition	GO_function : GO:0008168 - methyltransferase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC215201 protein_id : NP_766128.1

name	Tmem35 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13385744 CCDS:CCDS30392.1 GeneID:67564 MGI:1914814
definition	codon_start : 1 product : transmembrane protein 35 protein_id : NP_080515.1

name	Cenpi (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22122337 CCDS:CCDS30393.1 GeneID:102920 MGI:2147897
definition	GO_component : GO:0005694 - chromosome [Evidence IEA]; GO:0000775 - chromosome, pericentric region [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : FSH primary response 1 product : follicle-stimulating hormone primary response protein 1 protein_id : NP_666036.1

name	Drp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:45383916 CCDS:CCDS30394.1 GeneID:13497 MGI:107432
definition	GO_component : GO:0005856 - cytoskeleton [Evidence IEA]; GO:0005886 - plasma membrane [Evidence IDA] GO_function : GO:0005509 - calcium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0005198 - structural molecule activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : dystrophin related protein 2 protein_id : NP_034208.1

name	Taf7l (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:17921978 GeneID:74469 MGI:1921719
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0003700 - transcription factor activity [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q; TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50 kDa product : TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor protein_id : NP_083234.1

name	Timm8a1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7305577 GeneID:30058 MGI:1353433
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0042719 - mitochondrial intermembrane space protein transporter complex [Evidence IEA]; GO:0005739 - mitochondrion [Evidence IDA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006457 - protein folding [Evidence IEA]; GO:0045039 - protein import into mitochondrial inner membrane [Evidence IEA]; GO:0006605 - protein targeting [Evidence IEA]; GO:0006626 - protein targeting to mitochondrion [Evidence IEA]; GO:0015031 - protein transport [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : translocase of inner mitochondrial membrane 8 homolog a protein_id : NP_038926.1

name	Btk (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:7709994 CCDS:CCDS30396.1 GeneID:12229 MGI:88216
definition	GO_component : GO:0031410 - cytoplasmic vesicle [Evidence IDA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005524 - ATP binding [Evidence IEA]; GO:0016301 - kinase activity [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0004672 - protein kinase activity [Evidence IEA]; GO:0004713 - protein-tyrosine kinase activity [Evidence IDA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007249 - I-kappaB kinase/NF-kappaB cascade [Evidence IMP]; GO:0007242 - intracellular signaling cascade [Evidence IEA]; GO:0018108 - peptidyl-tyrosine phosphorylation [Evidence IDA]; GO:0006468 - protein amino acid phosphorylation [Evidence IDA] codon_start : 1 exception : mismatches in translation note : Bruton's tyrosine kinase; X-linked immune deficiency product : Bruton agammaglobulinemia tyrosine kinase protein_id : NP_038510.1

name	Rpl36a (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845295 GeneID:19982 MGI:1201789
definition	GO_component : GO:0005830 - cytosolic ribosome (sensu Eukaryota) [Evidence IEA] GO_function : GO:0003735 - structural constituent of ribosome [Evidence IEA] GO_process : GO:0007046 - ribosome biogenesis [Evidence IEA] codon_start : 1 note : ribosomal protein L44 product : ribosomal protein L36a protein_id : NP_063918.1

name	Gla (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:133778924 GeneID:11605 MGI:1347344
definition	GO_component : GO:0005764 - lysosome [Evidence IEA] GO_function : GO:0004557 - alpha-galactosidase activity [Evidence IDA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0016798 - hydrolase activity, acting on glycosyl bonds [Evidence IEA]; GO:0004553 - hydrolase activity, hydrolyzing O-glycosyl compounds [Evidence IEA] GO_process : GO:0005975 - carbohydrate metabolism [Evidence IEA]; GO:0008152 - metabolism [Evidence IEA] codon_start : 1 note : alpha-galactosidase product : alpha-galactosidase A protein_id : NP_038491.2

name	Hnrph2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9845253 CCDS:CCDS30397.1 GeneID:56258 MGI:1201779
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0030529 - ribonucleoprotein complex [Evidence IEA] GO_function : GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] codon_start : 1 note : heterogeneous nuclear ribonucleoprotein H' product : heterogeneous nuclear ribonucleoprotein H2 protein_id : NP_063921.1

name	Armcx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313420 CCDS:CCDS30398.1 GeneID:78248 MGI:1925498
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : armadillo repeat containing, X-linked 1 protein_id : NP_084342.1

name	LOC100040933 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272271 GeneID:100040933
definition	codon_start : 1 product : similar to Armadillo repeat containing, X-linked 6 protein_id : XP_001475559.1

name	LOC100040520 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272254 GeneID:100040520
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474202.1

name	Armcx6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:56090483 CCDS:CCDS30399.1 GeneID:278097 MGI:2147993
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] codon_start : 1 product : armadillo repeat containing, X-linked 6 protein_id : NP_001007579.1

name	Armcx3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21311833 CCDS:CCDS30400.1 GeneID:71703 MGI:1918953
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing, X-linked 3 protein_id : NP_082146.1

name	Armcx2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981055 CCDS:CCDS30401.1 GeneID:67416 MGI:1914666
definition	GO_component : GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : armadillo repeat containing, X-linked 2 protein_id : NP_080415.2

name	Nxf2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13752591 GeneID:83454 MGI:1933192
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005635 - nuclear envelope [Evidence IDA] [Evidence ISS]; GO:0005634 - nucleus [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006405 - RNA export from nucleus [Evidence IDA] [Evidence ISS]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear RNA export factor 2 protein_id : NP_112549.1

name	B930008K04Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:111185887 GeneID:215693 MGI:2442284
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : zinc finger, matrin type 1 protein_id : NP_780655.2

name	LOC100040635 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272261 GeneID:100040635
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474448.1

name	Tceal6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981279 CCDS:CCDS30402.1 GeneID:66104 MGI:1923939
definition	codon_start : 1 note : novel protein similar to transcription elongation factor A (SII)-like 5 Tceal5 product : transcription elongation factor A (SII)-like 6 protein_id : NP_079631.2

name	EG621322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004000 GeneID:621322 MGI:3643636
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890812.1

name	Pramel3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878223 CCDS:CCDS30403.1 GeneID:83565 MGI:1890657
definition	codon_start : 1 product : preferentially expressed antigen in melanoma-like 3 protein_id : NP_113567.1

name	EG621352 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408264 GeneID:621352 MGI:3647031
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890846.2

name	EG331529 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34304008 GeneID:331529 MGI:3647038
definition	codon_start : 1 exception : mismatches in translation product : hypothetical protein LOC331529 protein_id : NP_899143.1

name	EG621380 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004004 GeneID:621380 MGI:3648721
definition	codon_start : 1 product : hypothetical protein protein_id : XP_890879.1

name	EG666040 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408266 GeneID:666040 MGI:3648697
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986247.1

name	EG666045 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408268 GeneID:666045 MGI:3648700
definition	codon_start : 1 product : hypothetical protein protein_id : XP_986287.1

name	AV320801 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772414 GeneID:331531 MGI:3035227
definition	codon_start : 1 product : hypothetical protein LOC331531 protein_id : XP_284742.2

name	Nxf7 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:30794232 CCDS:CCDS30406.1 GeneID:170722 MGI:2159343
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence ISS]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006406 - mRNA export from nucleus [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0006810 - transport [Evidence IEA] codon_start : 1 note : nuclear export factor a; nuclear RNA export factor 6 product : nuclear RNA export factor 7 isoform 2 protein_id : NP_570958.1

name	4930534P07Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83004011 GeneID:75829 MGI:1923079
definition	codon_start : 1 product : hypothetical protein LOC75829 protein_id : XP_136073.2

name	1700008I05Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274121 GeneID:71841 MGI:1919091
definition	codon_start : 1 exception : mismatches in translation note : t-complex 11 product : t-complex 11 protein protein_id : NP_082228.1

name	1700129I15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:71274119 GeneID:78478 MGI:1925728
definition	GO_component : GO:0005737 - cytoplasm [Evidence IEA] GO_function : GO:0003779 - actin binding [Evidence IEA] GO_process : GO:0007010 - cytoskeleton organization and biogenesis [Evidence IEA] codon_start : 1 note : novel protein similar to thymosin, beta (Tmsb) product : thymosin beta-like protein 1 protein_id : NP_084382.1

name	Gprasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988908 CCDS:CCDS30409.1 GeneID:67298 MGI:1917418
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : G protein-coupled receptor associated sorting protein 1 protein_id : NP_001004359.1

name	Gprasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:53729355 CCDS:CCDS30409.1 GeneID:67298 MGI:1917418
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : G protein-coupled receptor associated sorting protein 1 protein_id : NP_001005385.1

name	Gprasp1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51988906 CCDS:CCDS30409.1 GeneID:67298 MGI:1917418
definition	GO_function : GO:0005488 - binding [Evidence IEA] codon_start : 1 product : G protein-coupled receptor associated sorting protein 1 protein_id : NP_080357.4

name	Gprasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272266 GeneID:245607 MGI:2442071
definition	codon_start : 1 product : similar to G-protein coupled receptor-associated sorting protein 2 (GASP-2) protein_id : XP_001474840.1

name	Gprasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272268 GeneID:245607 MGI:2442071
definition	codon_start : 1 product : similar to G-protein coupled receptor-associated sorting protein 2 (GASP-2) protein_id : XP_001474868.1

name	Gprasp2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985637 GeneID:245607 MGI:2442071
definition	codon_start : 1 product : similar to G-protein coupled receptor-associated sorting protein 2 (GASP-2) isoform 1 protein_id : XP_142154.1

name	Bhlhb9 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:37718979 CCDS:CCDS30410.1 GeneID:70237 MGI:1917487
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0005488 - binding [Evidence IEA]; GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 product : basic helix-loop-helix domain containing, class B9 protein_id : NP_937804.1

name	Bex2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6753184 CCDS:CCDS30413.1 GeneID:12069 MGI:1338017
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 product : brain expressed X-linked 2 protein_id : NP_033879.1

name	Nxf3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:66571305 GeneID:245610 MGI:2685230
definition	GO_component : GO:0005737 - cytoplasm [Evidence IDA]; GO:0005622 - intracellular [Evidence IEA] GO_function : GO:0003729 - mRNA binding [Evidence IDA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IPI] GO_process : GO:0016973 - poly(A)+ mRNA export from nucleus [Evidence IPI]; GO:0006810 - transport [Evidence IEA] codon_start : 1 product : nuclear RNA export factor 3 protein_id : NP_001019312.1

name	Bex4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:47059053 CCDS:CCDS30414.1 GeneID:406217 MGI:3606746
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] codon_start : 1 note : brain expressed, X-linked 4; brain expressed X-linked 4 product : Bex4 protein protein_id : NP_997622.1

name	Tceal8 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31981215 CCDS:CCDS30415.1 GeneID:66684 MGI:1913934
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : transcription elongation factor A (SII)-like 8 protein_id : NP_079979.2

name	LOC100040849 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040849
definition	number : 1 pseudo : _no_value

name	LOC669370 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:669370
definition	number : 1 pseudo : _no_value

name	LOC100040987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040987
definition	number : 2 pseudo : _no_value

name	LOC100040987 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040987
definition	number : 1 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 3 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 2 pseudo : _no_value

name	EG621246 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621246
definition	number : 1 pseudo : _no_value

name	EG621467 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621467
definition	number : 1 pseudo : _no_value

name	EG621467 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621467
definition	number : 2 pseudo : _no_value

name	EG621467 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:621467
definition	number : 3 pseudo : _no_value

name	LOC100041110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041110
definition	number : 1 pseudo : _no_value

name	LOC100041110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041110
definition	number : 2 pseudo : _no_value

name	LOC100041110 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041110
definition	number : 3 pseudo : _no_value

name	LOC674122 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272247 GeneID:674122
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 ESTs, 2 Proteins product : hypothetical LOC674122 pseudo : _no_value transcript_id : XR_031509.1

name	LOC665936 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272269 GeneID:665936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 2 Proteins product : hypothetical LOC665936 pseudo : _no_value transcript_id : XR_032258.1

name	LOC665941 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272252 GeneID:665941
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 ESTs, 3 Proteins product : similar to 60S ribosomal protein L34 pseudo : _no_value transcript_id : XR_031574.1

name	LOC637800 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272274 GeneID:637800
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST, 6 Proteins product : similar to hCG2016250 pseudo : _no_value transcript_id : XR_032324.1

name	2900062L11Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272235 GeneID:76976 MGI:1924226
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2900062L11 gene pseudo : _no_value transcript_id : XR_035168.1

name	6530401D17Rik (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:149272236 GeneID:76219 MGI:1923469
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6530401D17 gene pseudo : _no_value transcript_id : XR_035169.1

clone name	MSMg01-133F11
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-313C10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-342F14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-337G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-117B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-508B05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-364A15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-183M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-096N04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-315C20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343L19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-426J10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-122H03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-363C13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-117G06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-504E04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-335K18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-237C22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-519G02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-384D16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157F09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-260N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-148F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-125J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334N08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-170D18
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-519G02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-082H07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-275C23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-156M05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-065B01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-062A13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-072C21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-427L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-100A09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-443F05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-542A09
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-181J21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438H19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-485E01
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-440O17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-449L11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044B06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078K19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063A06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-128F20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-334G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-083F16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-036D12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192H04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-094N12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256B03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-347M16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125J19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-113E20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-226J16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-086K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-280E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296H09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179M06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-173K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-294L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-169I19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-044I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210K04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-340O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-163F09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-215F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179C21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-012P01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-227I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226D02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-274G01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214K24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-349C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-009L11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-239M19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-336M15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-185A07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256L15
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-294L04.b	B6Ng01-294L04.g
ACC	GA090760	GA090761
length	1,055	1,131
definition	B6Ng01-294L04.b	B6Ng01-294L04.g
singlet/doublet	singlet	singlet
BLAST hit	unique	unique
Map location.	(131,709,843 - 131,710,903)	(131,887,393 - 131,888,556)
sequence	gaattcaaactctgcacaaaataagattcagtggtttcaaagaagataca aatagcaggtgaaggaatgtagctaaggaaatagagatgcaaactagaaa tatacatgagaacatcagcaagaaaacacgtttgaaaacaaagaataaaa atataaaaatattagagctaaaaaatcaaacaacaacaaaaaaaaaacag gtagaaaagttcaccgggaaactgcatcatttaacctaatgaatattggg actagaaggaagagtcaaggaaactctccatttaaacatcaatatcatac aaagaaataaataataaagtgaaactctgagaaaacatagctcaggttag gtcttgctcacagcatgctcacagcctatagcaaaattattatgatcaaa ctggtttcctatcagtgccaaaaggagcctcatgatacagaaatcaatag aggtaatacagcccttagacacatttagaggagagattgtaggattatat gaaaaatgaaacagtgcagaaaggtatgcttgcttaaatatgtcgcattc ctaaaaatggaaggatgcactgaaaaggccttgagaaaagctagagatct gcttgtgacagcagccctgaagagtctcagagcacacctcaacttaaaat ggttctatataacaaacgtgtagtgcacattacactaaactgtgaaagca gaaaccatttcatctaaagtcaatggataagagaatgggacctgctctct aaacccctttattctgcttgaaggctttgcctacagcagtaatgcaaagt gaagaagtaaatgggctacaaacataaaggagaaggttaagtaatctctc tgtgggtaaatgataagctcctacacttaagagtaccaacagttgaacac aagcactaagtgtgctttaacacgttcaccaagaaaagcagtatgcacag caacataaaagactgtcgagttcatattcaccagaaactttgctactgag aaattaagcagaaatgcatcccatgcagtgttttcaacttcaacacctat aaaga	gaattcagtttgcatatccttgacttacttagaaatgatgtatgccacat cagtaattagcaatttacacagggctaaggaaatgccttttttatccagt tgcctcccacacaagcacaccagtgcatacgtgtaaaaagatgagcacca aagtcactccaggacttaaaggaggaatgaagagtcttagttacatgacc agacagtctaacaaattagtggattctgggttcaatgaaagatcctgcct cagaaaacatgtttaaaagtggtttaagaaaataccagatagcaatgccc tgctcccacatgcatatacagaagcatatgtatcttccccctcacatgaa catggaatcaaagagattttacttgtatcgttaatttcttgagacaacag actgcattgcaaaggcatgctaaagataaaaaatagcacttgtccctttc acatattgaaatgccaaaatgactacatttaaagtactgagtaacaaaga gaacagaagtaacaacttatacacaatgtttttctgctgaaatatcctag taaaagcaatcacttatatcttttttttttttttttactttttaaagtaa aatcatactcagttgtagtctgaccatactcaaaaagcaatacaattttg ttttagtagtaatactggcagataagtcaaactatattttaagggcttaa cacaataagaaatctgtcaaggcagttaacatgttttattaattttcctt tggtggaaagagattgtatttatacattagtaaggaaaacatgttaaatt atgctataatttatgtgtcatatctcccttgtgatacaacatttaatttt gttcatattttttgtaatgcttgcattatgagatagtgcaccaaacttta aatatccatttaaatgccattgtatgatcatttccttacttgtttccaat tttaaattacagggtttggactttcttattaaataaaatgttggttattg aaatacatatctgttctttgactttgtttttcgttttacctttccaatct gactctataatatccgatagctgatcttatgcttcagcatcatctcacta gtgataacggacaagcactgggaaaggtgca
quality values	Open. Hide. 58 31 26 38 62 38 22 31 62 62 62 62 62 62 47 51 51 32 62 62 62 62 62 62 62 59 44 62 59 59 62 51 59 28 28 32 28 24 23 28 32 38 62 62 62 59 49 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 59 62 59 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 43 54 62 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 43 62 62 47 41 62 62 62 62 62 62 47 47 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 54 54 54 51 54 58 58 58 58 58 58 58 45 54 58 58 58 54 58 58 52 58 54 54 58 58 58 58 58 58 54 58 58 58 54 54 58 58 52 48 39 58 54 42 58 49 54 46 58 58 49 58 58 49 51 58 41 58 58 58 49 32 50 58 58 58 51 50 47 58 47 58 58 54 45 49 51 58 58 51 58 54 58 52 58 48 50 39 53 58 52 53 58 58 43 54 58 58 54 53 58 50 53 53 53 51 41 39 51 30 46 53 50 52 41 58 58 53 52 49 48 58 51 50 58 58 50 50 58 36 25 58 50 53 52 51 50 50 40 58 52 50 58 58 50 52 51 58 52 49 41 53 58 41 53 49 39 58 51 40 52 53 49 54 45 54 51 49 41 54 52 54 46 54 51 39 53 53 32 54 51 37 42 50 40 51 54 49 40 37 53 53 45 37 54 39 49 42 36 28 32 42 54 54 31 27 24 44 32 54 17 34 34 33 36 54 36 33 35 38 41 54 42 42 37 33 45 34 21 54 32 42 49 35 42 42 33 31 32 53 32 34 32 41 31 53 53 53 32 22 6 14 31 52 52 52 34 31 52 32 31 40 32 43 40 45 31 32 35 32 33 45 32 31 47 42 39 31 41 35 36 28 51 31 23 31 29 47 30 31 40 47 41 31 43 33 31 22 51 27 30 26 35 31 51 42 34 38 36 30 35 18 17 23 7 37 35 35 26 33 29 26 31 38 32 29 30 34 31 42 31 40 41 25 24 32 48 33 23 31 34 28 31 29 29 31 32 34 31 34 32 32 22 29 34 30 25 32 19 41 16 31 35 26 32 19 32 27 29 36 25 22 29 30 27 27 21 31 11 31 25 43 28 38 32 21 9 7 9 38 21 29 21 36 48 32 23 20 32 24 33 22 28 37 34 12 7 33 9 25 31 38 48 48 34 31 31 32 31 33 25 33 33 27 24 31 31 32 29 19 10 24 10 19 9 43 43 17 10 43 6 23 33 21 32 17 25 16 21 25 32 19 12 4 10 33 22 14 15 30 18 11 22 39 29 23 29 48 22 28 27 32 15 21 28 33 31 19 30 48 27 10 21 11 23 24 19 13 12 32 34 14 22 26 14 24 9 17 34 23 14 19 28 27 24 19 9 27 13 47 40 25 14 4 5 3 7 4 3 6 4 6 5 10 23 12 7 6 4 34 14 8 5	Open. Hide. 62 47 56 47 62 47 41 62 62 62 62 51 42 27 32 27 50 36 34 45 56 62 59 59 62 59 62 62 62 59 62 62 62 62 62 59 62 59 59 62 62 62 59 62 62 59 62 62 62 62 62 62 62 59 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 54 62 62 62 59 59 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 54 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 54 54 58 42 58 42 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 51 54 52 51 58 58 58 58 47 54 58 58 58 58 54 58 58 58 54 58 51 51 58 51 58 51 54 58 58 58 58 58 58 58 58 58 58 58 49 49 58 58 58 58 49 42 50 50 48 44 48 48 58 42 50 50 42 42 44 58 49 50 48 48 48 48 43 43 44 40 39 42 50 53 50 49 35 50 50 49 54 46 23 44 40 50 50 46 49 53 21 58 58 58 58 39 43 37 58 50 40 37 26 51 52 54 54 54 50 40 49 49 44 35 25 38 50 32 41 40 44 31 40 44 52 53 54 32 40 31 51 29 40 54 32 51 45 32 34 44 36 46 40 34 30 40 54 54 30 40 47 27 54 35 37 45 51 35 46 40 32 40 28 33 37 37 51 42 54 46 34 24 37 33 47 32 32 23 29 32 53 30 40 31 34 53 31 42 32 32 31 45 29 52 49 34 32 30 34 37 21 20 52 51 32 28 34 28 51 31 43 51 22 36 45 31 51 46 31 51 28 31 13 30 41 24 31 29 47 30 23 31 24 31 10 42 31 31 34 42 22 28 24 46 27 46 46 31 31 28 31 46 15 27 31 47 42 32 31 28 27 33 35 32 31 34 33 36 34 46 31 13 15 43 26 39 23 31 23 31 31 29 32 31 35 39 27 12 21 39 16 26 31 16 31 31 16 25 22 31 38 48 34 32 36 31 44 43 19 32 18 24 26 27 25 11 6 43 43 44 43 17 18 12 28 27 18 27 16 13 18 42 32 33 28 22 13 12 31 32 21 34 22 33 27 16 32 25 32 9 24 12 48 31 22 30 48 25 15 47 20 10 9 19 13 34 15 21 43 8 33 39 31 7 24 10 32 16 18 9 20 10 22 7 27 27 28 9 9 3 31 21 21 20 5 9 12 13 3 6 21 12 47 15 7 15 9 16 11 47 40 9 21 13 12 13 10 15 16 7 15 34 17 27 40 24 5 15 15 7 13 34 24 9 9 5 7 7 16 19 40 8 12 12 29 22 21 16 24 5 16 6 6 24 6 18 5 18 8 15 28 11 12 5 4 4 14 7 12 18 8 13 17 15 14 5 26 14 15 23 11 14 28 16 14 11 29 29 25 14 11 6 14 28 28 17 6 7 7 22 28 3 3 3 4 7 9 20 6 20 22 9 6 7 12 5 2 1 2 2 3 3 3 3 5 13 4 14 4 13 5 5 1 2 3 8 7 12 9 7 2 3 4 6 4 6 18 3 2 3 3 7 19 7 10 5 12 8 2 2 1 4 2 3 3 4 6 17 16 3 3 1 5 1 2 1 1 4 20 22 20 11 29 7 21 13 6 7 6 6

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_131709843_131710903
seq2: B6Ng01-294L04.b_49_1103

seq1  GAATTCAAACTCTGCACAAAATAAGATTCAGTGGTTTCAAAGAAGATACA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  GAATTCAAACTCTGCACAAAATAAGATTCAGTGGTTTCAAAGAAGATAC-  49

seq1  AAATAGCAGGTGAAGGAATGTAGCTAAGGAAATAGAGATGCAAACTAGAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAATAGCAGGTGAAGGAATGTAGCTAAGGAAATAGAGATGCAAACTAGAA  99

seq1  ATATACATGAGAACATCAGCAAGAAAACACGTTTGAAAACAAAGAATAAA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATATACATGAGAACATCAGCAAGAAAACACGTTTGAAAACAAAGAATAAA  149

seq1  AATATAAAAATATTAGAGCTAAAAAATCAAACAACAACAAAAAAAAAACA  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATATAAAAATATTAGAGCTAAAAAATCAAACAACAACAAAAAAAAAACA  199

seq1  GGTAGAAAAGTTCACCGGGAAACTGCATGATTTAACCTAATGAATATTGG  250
      |||||||||||||||||||||||||||| |||||||||||||||||||||
seq2  GGTAGAAAAGTTCACCGGGAAACTGCATCATTTAACCTAATGAATATTGG  249

seq1  GACTAGAAGGAAGAGTCAAGGAAACTCTCCATTTAAACATCAATATCATA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACTAGAAGGAAGAGTCAAGGAAACTCTCCATTTAAACATCAATATCATA  299

seq1  CAAAGAAATAAATAATAAAGTGAAACTCTGAGAAAACATAGCTCAGGTTA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAGAAATAAATAATAAAGTGAAACTCTGAGAAAACATAGCTCAGGTTA  349

seq1  GGTCTTGCTCACAGCATGCTCACAGCCTATAGCAAAATTATTATGATCAA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGTCTTGCTCACAGCATGCTCACAGCCTATAGCAAAATTATTATGATCAA  399

seq1  ACTGGTTTCCTATCAGTGCCAAAAGGAGCCTCATGATACAGAAATCAATA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGGTTTCCTATCAGTGCCAAAAGGAGCCTCATGATACAGAAATCAATA  449

seq1  GAGGTAATACAGCCCTTAGACACATTTAGAGGAGAGATTGTAGGATTATA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGGTAATACAGCCCTTAGACACATTTAGAGGAGAGATTGTAGGATTATA  499

seq1  TGAAAAATGAAACAGTGCAGAAAGGTATGCTTGCTTAAATATGTCGCATT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAAAATGAAACAGTGCAGAAAGGTATGCTTGCTTAAATATGTCGCATT  549

seq1  CCTAAAAATGGAAGGATGCACTGAAAAGGCCTTGAGAAAAGCTAGAGATC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAAAAATGGAAGGATGCACTGAAAAGGCCTTGAGAAAAGCTAGAGATC  599

seq1  TGCTTGTGACAGCAGCCCTGAAGAGTCTCAGAGCACACCTCAACTTAAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTGTGACAGCAGCCCTGAAGAGTCTCAGAGCACACCTCAACTTAAAA  649

seq1  TGGTTCTATATAACAAACGTGTAGTGCACATTACACTAAACTGTGAAAGC  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTTCTATATAACAAACGTGTAGTGCACATTACACTAAACTGTGAAAGC  699

seq1  AGAAACCATTTCATCTAAAGTCAATGGATAAGAGAATGGGACCTGCTCTC  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAAACCATTTCATCTAAAGTCAATGGATAAGAGAATGGGACCTGCTCTC  749

seq1  TAAACCCCTTTATTCTGCTTGAAGGCTTTGCCTACAGCAGTAATGCAAAG  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAACCCCTTTATTCTGCTTGAAGGCTTTGCCTACAGCAGTAATGCAAAG  799

seq1  TGAAGAAGTAAATGGGCTACAAACATAAAGGAGAAGGTTAAGTAATCTCT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAAGAAGTAAATGGGCTACAAACATAAAGGAGAAGGTTAAGTAATCTCT  849

seq1  CTGTGGGTAAATGATAAGCTCCTACACTTAAGAGTACCAACAGTTGAACA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGTGGGTAAATGATAAGCTCCTACACTTAAGAGTACCAACAGTTGAACA  899

seq1  CAAGCACTAAGGTGTGCTTTAACACGTTCACCAAGAAAAGCAGTATGCAC  950
      |||||||||| |||||||||||||||||||||||||||||||||||||||
seq2  CAAGCACTAA-GTGTGCTTTAACACGTTCACCAAGAAAAGCAGTATGCAC  948

seq1  AGCAACATAAAGAACTGTCGAGTTCATATTCACCAGAAACTTTGCTACTG  1000
      |||||||||||  |||||||||||||||||||||||||||||||||||||
seq2  AGCAACATAAAAGACTGTCGAGTTCATATTCACCAGAAACTTTGCTACTG  998

seq1  AGAAATTAAGCAGAAATGCAATCCCATGCAGTGTTTTCAAAACTTAAAAC  1050
      ||||||||||||||||||| ||||||||||||||||||  |||||  |||
seq2  AGAAATTAAGCAGAAATGC-ATCCCATGCAGTGTTTTC--AACTT-CAAC  1044

seq1  ACCTATAAAGA  1061
      |||||||||||
seq2  ACCTATAAAGA  1055

seq1: chrX_131887393_131888556
seq2: B6Ng01-294L04.g_69_1199

seq1  GAATTCAGTTTGCATATCCTTGACTTACTTAGAAATGATGTATGCCACAT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCAGTTTGCATATCCTTGACTTACTTAGAAATGATGTATGCCACAT  50

seq1  CAGTAATTAGCAATTTACACAGGGCTAAGGAAATGCCTTTTTTATCCAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTAATTAGCAATTTACACAGGGCTAAGGAAATGCCTTTTTTATCCAGT  100

seq1  TGCCTCCCACACAAGCACACCAGTGCATACGTGTAAAAAGATGAGCACCA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCCTCCCACACAAGCACACCAGTGCATACGTGTAAAAAGATGAGCACCA  150

seq1  AAGTCACTCCAGGACTTAAAGGAGGAATGAAGAGTCTTAGTTACATGACC  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTCACTCCAGGACTTAAAGGAGGAATGAAGAGTCTTAGTTACATGACC  200

seq1  AGACAGTCTAACAAATTAGTGGATTCTGGGTTCAATGAAAGATCCTGCCT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAGTCTAACAAATTAGTGGATTCTGGGTTCAATGAAAGATCCTGCCT  250

seq1  CAGAAAACATGTTTAAAAGTGGTTTAAGAAAATACCAGATAGCAATGCCC  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGAAAACATGTTTAAAAGTGGTTTAAGAAAATACCAGATAGCAATGCCC  300

seq1  TGCTCCCACATGCATATACAGAAGCATATGTATCTTCCCCCTCACATGAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTCCCACATGCATATACAGAAGCATATGTATCTTCCCCCTCACATGAA  350

seq1  CATGGAATCAAAGAGATTTTACTTGTATCGTTAATTTCTTGAGACAACAG  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATGGAATCAAAGAGATTTTACTTGTATCGTTAATTTCTTGAGACAACAG  400

seq1  ACTGCATTGCAAAGGCATGCTAAAGATAAAAAATAGCACTTGTCCCTTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTGCATTGCAAAGGCATGCTAAAGATAAAAAATAGCACTTGTCCCTTTC  450

seq1  ACATATTGAAATGCCAAAATGACTACATTTAAAGTACTGAGTAACAAAGA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACATATTGAAATGCCAAAATGACTACATTTAAAGTACTGAGTAACAAAGA  500

seq1  GAACAGAAGTAACAACTTATACACAATGTTTTTCTGCTGAAATATCCTAG  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACAGAAGTAACAACTTATACACAATGTTTTTCTGCTGAAATATCCTAG  550

seq1  TAAAAGCAATCACTTATATCTTTTTTTTTTTTTTTTACTTTTTAAAGTAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAAAAGCAATCACTTATATCTTTTTTTTTTTTTTTTACTTTTTAAAGTAA  600

seq1  AATCATACTCAGTTGTAGTCTGACCATACTCAAAAAGCAATACAATTTTG  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATCATACTCAGTTGTAGTCTGACCATACTCAAAAAGCAATACAATTTTG  650

seq1  TTTTAGTAGTAATACTGGCAGATAAGTCAAACTATATTTTAAGGGCTTAA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTAGTAGTAATACTGGCAGATAAGTCAAACTATATTTTAAGGGCTTAA  700

seq1  CACAATAAGAAATCTGTCAAGGCAGTTAACATGTTTTATTAATTTTCCTT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAATAAGAAATCTGTCAAGGCAGTTAACATGTTTTATTAATTTTCCTT  750

seq1  TGGTGGAAAGAGATTGTATTTATACATTAGTAAGGAAAACATGTTAAATT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGTGGAAAGAGATTGTATTTATACATTAGTAAGGAAAACATGTTAAATT  800

seq1  ATGCTATAATTTATGTGTCATATCTCCCTTGTGATACAACATTTAATTTT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATGCTATAATTTATGTGTCATATCTCCCTTGTGATACAACATTTAATTTT  850

seq1  GTTCATATTTTTTGTAATGCTTGCATTATGAGATAGTGCACCAAACTTTA  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTCATATTTTTTGTAATGCTTGCATTATGAGATAGTGCACCAAACTTTA  900

seq1  AATATCCATTAAAATGCCATTGTAATGATCAATTTCCCTTACCTTGTTTC  950
      |||||||||| |||||||||||| |||||||  || ||||| ||||||||
seq2  AATATCCATTTAAATGCCATTGT-ATGATCA--TTTCCTTA-CTTGTTTC  946

seq1  CAATTTTAAAATTACAGGGTTTTGGAACTTTC-TATTAAATAAAATGTTG  999
      ||||||| ||||||||||||||  | |||||| |||||||||||||||||
seq2  CAATTTT-AAATTACAGGGTTT--GGACTTTCTTATTAAATAAAATGTTG  993

seq1  TTATTTGAAATTAACATTATCTGTTTCTTTGAACTTTTGTTTTTCGTTTT  1049
       |  |||||||  ||| |||||| ||||||||   |||||||||||||||
seq2  GTTATTGAAAT--ACA-TATCTG-TTCTTTGA--CTTTGTTTTTCGTTTT  1037

seq1  TACTTTTCCCCATCTGACTCTTATTATATATTCTCGAATAAGCTGGGTTC  1099
        ||||  || |||||||||      |||| | ||  || ||||  | ||
seq2  ACCTTT--CCAATCTGACTC------TATAATATCCGAT-AGCT--GATC  1076

seq1  TTATGCTCTCAGCAGTGCAATCCTCACTAGTGTGATAACAGGAGCAGAGC  1149
      ||||||| ||||||   ||   |||||||  |||||||| ||| || |||
seq2  TTATGCT-TCAGCA--TCA--TCTCACTA--GTGATAAC-GGA-CA-AGC  1116

seq1  ACTGGGAAAGGTGCA  1164
      |||||||||||||||
seq2  ACTGGGAAAGGTGCA  1131

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information