MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-295K11
Chromosome	X (Build37)
Map Location	144,440,776 - 144,614,294
singlet/doublet	doublet
Overlap gene	LOC666184, LOC100039511, LOC666812, LOC100039519
Upstream gene	Htr2c, Il13ra2, V1rb10, Lrch2, LOC100039462, LOC666789, LOC434863, EG623995, EG624023
Downstream gene	LOC434864, EG624096, LOC100039545, LOC666837, LOC100039553, LOC100034729, LOC666861, EG666864, LOC434866, EG666868, EG624260, LOC434865, EG624310, Ott
Link	Open Mouse BAC browser

Click to get alignment info.

name	Htr2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15560 MGI:96281
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Il13ra2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:16165 MGI:1277954
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	V1rb10 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:113867 MGI:2148521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Lrch2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:210297 MGI:2147870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039462 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039462
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 12 Proteins pseudo : _no_value

name	LOC666789 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666789
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	LOC434863 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 9 Proteins

name	EG623995 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:623995 MGI:3642951
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	EG624023 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC666184 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 15 ESTs, 4 Proteins

name	LOC100039511 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039511
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 Proteins pseudo : _no_value

name	LOC666812 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666812
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	LOC100039519 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039519
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434864 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG624096 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624096 MGI:3643280
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins pseudo : _no_value

name	LOC100039545 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins pseudo : _no_value

name	LOC666837 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666837
definition	note : lysyl-tRNA synthetase pseudogene pseudo : _no_value

name	LOC100039553 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039553
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100034729 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC666861 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:666861
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG666864 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666864 MGI:3648921
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 mRNAs, 17 ESTs, 8 Proteins

name	EG666868 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:666868 MGI:3644011
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	EG624260 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624260 MGI:3646683
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC434865 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 11 mRNAs, 16 ESTs, 4 Proteins

name	EG624310 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	Ott (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:18422 MGI:107573
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Htr2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142373665 GeneID:15560 MGI:96281
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : 5-hydroxytryptamine (serotonin) receptor 2C transcript_id : NM_008312.3

name	Il13ra2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142345552 GeneID:16165 MGI:1277954
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : interleukin 13 receptor, alpha 2 transcript_id : NM_008356.2

name	V1rb10 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:118200340 GeneID:113867 MGI:2148521
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : vomeronasal 1 receptor, B10 transcript_id : NM_053240.2

name	Lrch2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487174 GeneID:210297 MGI:2147870
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : leucine-rich repeats and calponin homology (CH) domain containing 2 transcript_id : NM_001081173.1

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408343 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 5 mRNAs, 17 ESTs, 5 Proteins product : ovary testis transcribed-like, transcript variant 1 transcript_id : XM_486785.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272432 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 1 Protein product : ovary testis transcribed-like, transcript variant 3 transcript_id : XM_897719.3

name	LOC434863 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272434 GeneID:434863
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 3 mRNAs, 16 ESTs, 5 Proteins product : ovary testis transcribed-like transcript_id : XM_001473108.1

name	EG624023 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272425 GeneID:624023 MGI:3644694
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624023 transcript_id : XM_888549.3

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408346 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 4 transcript_id : XM_982169.1

name	LOC666184 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408350 GeneID:666184
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 15 ESTs, 2 Proteins product : ovary testis transcribed-like, transcript variant 2 transcript_id : XM_982089.1

name	LOC434864 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:126032330 GeneID:434864
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001081648.1

name	LOC100034729 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:131887312 GeneID:100034729
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed-like transcript_id : NM_001082966.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272441 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_001487784.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272443 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 16 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 3 transcript_id : XM_001487786.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272445 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_001487787.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272447 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 2 transcript_id : XM_001487785.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272451 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 17 ESTs, 4 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 5 transcript_id : XM_001487788.1

name	LOC434866 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272449 GeneID:434866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 17 ESTs, 1 Protein product : novel protein similar to ovary testis transcribed (Ott), transcript variant 6 transcript_id : XM_001487789.1

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408362 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 1 transcript_id : XM_486789.4

name	LOC434865 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:94408364 GeneID:434865
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 16 ESTs, 2 Proteins product : novel protein similar to ovary testis transcribed (Ott), transcript variant 4 transcript_id : XM_897890.2

name	EG624310 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272430 GeneID:624310 MGI:3644796
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : predicted gene, EG624310 transcript_id : XM_888852.2

name	Ott (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33859585 GeneID:18422 MGI:107573
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ovary testis transcribed transcript_id : NM_011022.1

name	Htr2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31542977 CCDS:CCDS30459.1 GeneID:15560 MGI:96281
definition	GO_component : GO:0009897 - external side of plasma membrane [Evidence ISS]; GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004993 - serotonin receptor activity [Evidence ISS]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0048016 - inositol phosphate-mediated signaling [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 exception : mismatches in translation note : 5-HT2C receptor; snoRNA MBI-36 product : 5-hydroxytryptamine (serotonin) receptor 2C protein_id : NP_032338.2

name	Il13ra2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680405 CCDS:CCDS30460.1 GeneID:16165 MGI:1277954
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence IEA] GO_function : GO:0004907 - interleukin receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] GO_process : GO:0007166 - cell surface receptor linked signal transduction [Evidence IEA] codon_start : 1 product : interleukin 13 receptor, alpha 2 protein_id : NP_032382.1

name	V1rb10 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:118200341 GeneID:113867 MGI:2148521
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0016503 - pheromone receptor activity [Evidence IEA]; GO:0004872 - receptor activity [Evidence IEA] [Evidence ISS]; GO:0001584 - rhodopsin-like receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence IEA]; GO:0019236 - response to pheromone [Evidence IEA]; GO:0007606 - sensory perception of chemical stimulus [Evidence TAS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 product : vomeronasal 1 receptor, B10 protein_id : NP_444470.2

name	Lrch2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:124487175 GeneID:210297 MGI:2147870
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 product : leucine-rich repeats and calponin homology (CH) domain containing 2 protein_id : NP_001074642.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772467 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 1 protein_id : XP_486785.1

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272433 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 isoform 3 protein_id : XP_902812.3

name	LOC434863 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272435 GeneID:434863
definition	codon_start : 1 product : hypothetical protein LOC434863 protein_id : XP_001473158.1

name	EG624023 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272426 GeneID:624023 MGI:3644694
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893642.3

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408347 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 4 protein_id : XP_987263.1

name	LOC666184 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408351 GeneID:666184
definition	codon_start : 1 product : hypothetical protein LOC666184 isoform 2 protein_id : XP_987183.1

name	LOC434864 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:126032331 GeneID:434864
definition	codon_start : 1 product : hypothetical protein LOC434864 protein_id : NP_001075117.1

name	LOC100034729 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:131887313 GeneID:100034729
definition	codon_start : 1 product : hypothetical protein LOC100034729 protein_id : NP_001076435.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272442 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001487834.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272446 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 4 protein_id : XP_001487837.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272444 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 3 protein_id : XP_001487836.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272448 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001487835.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272452 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 5 protein_id : XP_001487838.1

name	LOC434866 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272450 GeneID:434866
definition	codon_start : 1 product : hypothetical protein isoform 6 protein_id : XP_001487839.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:51772471 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 1 protein_id : XP_486789.1

name	LOC434865 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:94408365 GeneID:434865
definition	codon_start : 1 product : hypothetical protein LOC434865 isoform 4 protein_id : XP_902983.2

name	EG624310 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272431 GeneID:624310 MGI:3644796
definition	codon_start : 1 product : similar to AU022751 protein protein_id : XP_893945.2

name	Ott (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33859586 GeneID:18422 MGI:107573
definition	codon_start : 1 product : ovary testis transcribed protein_id : NP_035152.1

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 1 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 2 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 3 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 4 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 5 pseudo : _no_value

name	LOC100039462 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039462
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 1 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 2 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 3 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 4 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 5 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 6 pseudo : _no_value

name	LOC666789 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666789
definition	number : 7 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 2 pseudo : _no_value

name	EG623995 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:623995
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 1 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 2 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 3 pseudo : _no_value

name	LOC100039511 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039511
definition	number : 4 pseudo : _no_value

name	LOC666812 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666812
definition	number : 1 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 2 pseudo : _no_value

name	LOC100039519 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039519
definition	number : 1 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 2 pseudo : _no_value

name	EG624096 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624096
definition	number : 1 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 2 pseudo : _no_value

name	LOC100039553 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100039553
definition	number : 1 pseudo : _no_value

name	LOC666861 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666861
definition	number : 1 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 2 pseudo : _no_value

name	EG666864 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666864
definition	number : 1 pseudo : _no_value

name	EG666868 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:666868
definition	number : 1 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 2 pseudo : _no_value

name	EG624260 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624260
definition	number : 1 pseudo : _no_value

name	LOC100039545 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149272427 GeneID:100039545
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 mRNAs, 15 ESTs, 2 Proteins product : similar to Ott protein pseudo : _no_value transcript_id : XR_031018.1

clone name	MSMg01-423C12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-498L21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-482I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-103J02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-388A24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-157L09
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-366B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376L16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-134J14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-195B06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-376D15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531F24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-119B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539E01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-319O11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-080M22
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-209C17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-414M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175M06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-090H04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-081E04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-328P16
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-350H24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-356A02
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-361E24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-416F21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-346B20
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-506I17
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-527N13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-509F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-175L02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-512H21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-348E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-269G19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-048L03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-462E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-327K12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-047B23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-047C24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-263F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-351G12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-011L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-137J15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-341E19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-187E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276M05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-277B12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-235H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-258H19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-042K12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-026H01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-234F19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-161M23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-329I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-232D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138L15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-261G07
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-271K15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-253E10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-144O21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291K17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-256G05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-206I04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-171J21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-073K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060K23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163C13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-080K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-100C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-218J17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148B17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-232E09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-157J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167E14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066J04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-295K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-006M14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-084F24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226I09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291P10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-319C09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-178H08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-140B10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308G13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-146F03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-192K22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-076K01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-282G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-163D19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-015C18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-044B20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-261N11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-130F13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-276G09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-331P24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160E03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-309L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-047E08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262I24
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-115F21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-109K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-046P03
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-295K11.b	B6Ng01-295K11.g
ACC	GA091466	GA091467
length	1,138	1,153
definition	B6Ng01-295K11.b	B6Ng01-295K11.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(144,440,776 - 144,441,910)	(144,613,143 - 144,614,294)
sequence	gaattcttgtacaagattgaaaataccctagaggtcaaatttgagtctta ttccccaggagccatcttcctgtgtgttttgttttttgtttttgttgttg ttgttgttttgaaagaagtctctccctgagacttgtaatttattgattag gctagattgactgtccagtaagtcccagggcttctcctgtcttttttcct tctaaaagttcataatttatataccctttggttcaaacattttcaagttt tctgttaatttgctttgtgtgtgttcagggcttgtgtgtcatgttacagt gtacctgtggtagtcagagtttgacttagagtagctgctcctctcctttc aacatggaggtcacaagggtcaggcatggcaagaactgtatttacacact aaaccatctcacaggtcctcacaaaagggaaggttgtgaggttccagttc aggtcctaaaacttgcatggcaagtgtttaccaactgtgacatatggatc ctgccatcaaacagaagctataagaaaaaaaacagaagtatttctgtccc cttctattttattgtctagctagcaggatctaaaaaataaataaaccatt ttataaaaattaaagggatgtcactgttaaaatacttgatatattttcaa gaatcaattttaaatatttctttttagtcatcagacatttctaatatggg aacgtagataccatttttaataatcattttcctttcatttcaattgaaat attgctgaatttatttatttttctttcacatttttgagataatttgatgt gtagaagcccatgtgccttacccttctaagtgctgagattgtgcttatca ctggtaatgccaggatcatccatcagtttagattgtacatttgtttgctt cagattaatattttccatatattttaacagttttcgacattataattaca ctatttctcccttccctttcttcctaccaaacctaccatattactcctct ttgctgttccaagtataattgtactctttatcattaaatagttgttccac taaacttctctttcctacccatcacaagggtattgttaatgtgttatggt gtattccttaaaatataatgaaacattgaaaagctcta	gaattccagacccctaagccccttaccccatgaaaaaccctagcttttga gtatcctggtcgacatcctttatctcctgtgtgggatgcatgtgagtcca gagctctgtaattaaactacctagtctaattacagcaagatggtcctccg tgatttttggggggtgcacaccgaatcgggaattgagtgagggtatcccc actaggttctatcagggtatgactcaggggttcctaaaggagtatagaat gcacaatatggttttataattggaaagggtaattaagaccatatcttaaa ggatttttaaacttaaatgtacttcccattcaaattggaaggaaattata catttgaagtacatgttttagctacatttctgatatattcctgtctggtc ctgaaattgtgctgtagctaagagtccatgtaaataactcttatcttctt gacctagcctcattacatttgattacctacacatatttgaggatattatt aggtttccaatccattttcctgggcatcaaactcagattctcatgcttac aagcatacactatgtcccagaactcagcctagacagtagtcagttcatgt tccagtggattacatgagcctggtattgaagttttttaaaaacagtttgt ctcttttgaagaatactccaggtaggactgtgtatatgcaaaatcccagc actgttaaaggcagaataatggggcatttcctgtcatcctgagccacaat gggtgtctccagccagcaggctttaaaggaaacacgttcctaaaaaccaa tccaaacaaatgaaattatcacatccctgaatgagcattacctggcagct tatatctacaatttcatgtctaaaactgcagaagcagaacgattgcattg gaaattcaggctcagtgaatactggattttaggacagcttttgaccaagt tattttttttcaagacaggttgccctttcactctgtagcttcatataaaa attagagggtaataaacgaagcatgacagacaacacataaacaacgcagc ataatttcaaatgaagtcagaaaaatggtaataggtaaagtgtttctttg cctcccaacctctcaatgtaaccaatggaaaagatgcataaattaccggt gaa
quality values	Open. Hide. 47 26 28 20 58 54 58 58 38 52 48 43 27 47 62 41 26 62 49 62 62 62 47 47 62 62 62 62 62 62 62 62 62 49 26 32 22 19 22 43 45 44 43 62 56 49 62 62 62 62 59 62 62 62 62 62 59 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 48 43 43 54 59 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 59 59 62 62 62 59 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 59 62 62 62 59 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 52 62 62 62 62 62 62 47 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 58 52 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 51 54 54 58 58 54 58 54 58 58 54 58 58 58 58 58 58 58 58 58 58 25 58 42 41 54 54 54 58 58 58 58 58 52 58 58 54 54 54 58 58 54 49 51 58 58 58 47 58 53 50 58 58 58 53 52 54 51 58 58 47 49 58 51 31 58 53 54 53 53 58 58 58 54 52 58 58 51 52 52 52 58 58 58 41 33 53 54 51 51 58 49 58 53 53 58 53 58 51 46 53 46 53 45 58 58 41 41 58 51 53 52 46 58 58 58 46 58 58 58 50 53 53 53 53 40 52 49 37 41 58 39 40 53 58 53 52 53 50 53 50 53 45 51 58 58 51 38 39 51 53 53 39 46 42 39 54 42 41 41 58 58 58 39 35 51 42 54 49 49 54 45 53 54 54 54 35 54 38 54 49 49 33 47 54 41 49 31 32 54 54 49 39 54 41 42 45 39 54 47 39 49 42 51 37 40 54 52 40 37 54 47 40 37 54 54 54 42 53 49 54 47 40 35 37 42 42 54 54 54 52 52 53 39 53 35 39 45 32 52 44 47 37 34 53 53 53 32 39 41 46 53 33 34 52 53 40 37 51 41 52 31 37 32 35 32 24 46 32 46 42 51 33 41 35 31 45 45 31 42 31 45 21 31 17 42 51 34 45 31 26 29 31 31 34 35 39 31 29 34 31 30 33 31 42 25 42 31 21 32 30 25 37 34 36 43 36 30 43 43 36 31 33 47 31 42 35 37 24 31 37 21 31 31 31 41 48 33 22 20 48 41 36 31 32 31 31 26 31 37 27 41 29 32 32 31 26 46 46 32 25 34 32 27 31 38 38 37 48 48 38 30 22 19 20 29 31 44 48 22 31 11 38 28 31 24 25 21 21 30 14 25 26 31 32 22 26 32 32 21 43 30 29 19 22 43 25 13 13 15 43 25 15 40 26 26 18 21 22 20 14 20 14 13 20 39 30 11 17 14 23 16 21 27 27 23 12 28 20 18 20 19 26 16 9 21 47 27 28 20 18 22 21 27 9 16 11 18 28 15 10 7 6 6 18 5 27 12 28 26 10 18 16 40 13 11 8 3 4 13 14 15 34 25 7 10 10 19 9 28 13 7 7 7 7 15 11 11 27 20 11 9 5 17 13 2 3 27 18 11 28 7 12 24 30 24 15 16 18 8 11 7 7 14 28 20 9 6 6 7 17 6 6 4 4 7 11 10 23 9 12 14 3 4 7 8 16 5 6 5 20 9 16 6 5 24 25 17 6 6 5 6 8 17 8 14 13 23 19 6 13 5 6 8 4 28 17 23 8 3 4 5 3 3	Open. Hide. 62 47 30 38 62 62 41 24 56 54 62 62 62 32 32 18 16 15 21 21 21 22 38 44 62 56 62 62 62 59 62 44 35 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 54 45 56 43 54 50 38 59 56 62 62 62 59 62 62 62 62 62 62 62 62 54 59 62 62 62 62 59 59 62 62 62 62 62 62 62 54 62 62 62 62 59 59 59 62 62 62 62 62 62 59 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 59 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 59 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 56 62 62 62 62 59 62 54 42 54 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 43 62 62 62 62 62 56 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 52 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 45 62 62 62 62 62 62 62 62 58 54 58 58 58 58 58 58 58 58 58 54 54 52 54 58 58 58 58 58 58 58 58 58 58 58 54 47 58 58 58 54 52 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 52 54 46 58 58 58 54 58 58 58 58 58 58 58 54 37 52 52 54 52 58 49 58 50 58 58 53 53 53 58 58 58 51 52 42 58 47 48 58 58 48 47 51 58 53 58 39 42 58 52 58 58 58 50 58 58 58 49 58 58 46 46 39 46 41 58 58 46 47 51 41 46 58 46 39 41 52 50 50 51 58 58 50 58 58 52 58 58 52 39 39 58 49 58 58 35 46 58 58 58 58 51 28 58 54 58 58 41 39 41 50 58 58 51 53 58 53 49 58 58 58 58 40 50 58 39 58 49 37 52 49 52 58 53 39 39 54 41 53 52 51 46 25 49 54 45 54 53 36 52 39 51 49 44 24 42 51 52 42 39 36 49 42 39 50 34 35 49 52 34 53 37 54 46 32 49 31 39 40 49 39 40 51 39 33 54 54 54 37 30 35 33 54 33 29 46 37 54 42 53 32 42 33 51 42 53 35 19 52 51 32 45 40 34 37 44 36 36 25 42 42 53 36 39 53 29 32 32 41 32 32 33 31 9 34 31 35 51 24 28 49 34 32 32 37 47 46 32 29 32 33 37 35 33 41 39 21 40 36 37 37 31 42 31 33 31 31 31 24 51 36 31 25 51 51 31 41 31 51 21 21 31 29 36 31 29 32 22 37 38 51 51 36 35 51 31 34 38 41 16 26 30 31 30 30 43 31 36 35 42 31 30 26 42 37 31 29 34 36 31 37 28 22 36 29 27 33 48 26 31 18 28 42 29 31 31 28 48 48 37 30 36 38 33 21 19 39 30 14 31 22 24 44 26 25 12 31 12 32 30 29 18 27 15 8 18 6 41 16 26 19 16 8 18 17 32 38 34 21 12 28 29 32 32 18 8 21 21 25 25 17 31 48 48 8 8 12 22 32 16 5 5 13 31 48 48 33 15 31 20 17 25 29 6 13 6 6 14 43 48 48 43 43 48 30 12 7 25 20 26 16 21 11 29 7 22 29 31 47 43 11 33 10 8 10 19 15 12 20 34 24 30 15 20 32 37 29 17 24 19 31 20 12 3 16 16 16 8 19 5 20 8 34 10 9 18 13 9 6 34 15 18 10 15 18 14 26 23 8 8 5 3 6 12 9 16 15 20 11 8 28 7 31 11 40 8 20 15 12 8 11 27 8 7 11 14 11 7 17 10 29 16 14 16 22 8 15 10 14 7 3 1 11 7 6 11 26 28 22 21 5 12 16 5 14 7 18 7 24 18 4 5 26 9 6 8 16 4 21 5 6 12 22 12 10 6 7 7 11 25 3 5 2 7 4 10 4 7 12 7 7 1 3 4 4 4 12 15 6 12 4 6 6 17 26 10 5 5 23 4 6 9 10 18 16 17 5 2 3 3 6 8 6 7 10 8 17 3

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_144440776_144441910
seq2: B6Ng01-295K11.b_44_1181

seq1  GAATTCTTGTACAAGATTGAAAATACCCTAGAGGTCAAATTTGAGTCTTA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTGTACAAGATTGAAAATACCCTAGAGGTCAAATTTGAGTCTTA  50

seq1  TTCCCCAGGAGCCATCTTCCTGTGTGTTTTGTTTTTTGTTTTTGTTGTTG  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTCCCCAGGAGCCATCTTCCTGTGTGTTTTGTTTTTTGTTTTTGTTGTTG  100

seq1  TTGTTGTTTTGAAAGAAGTCTCTCCCTGAGACTTGTAATTTATTGATTAG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGTTGTTTTGAAAGAAGTCTCTCCCTGAGACTTGTAATTTATTGATTAG  150

seq1  GCTAGATTGACTGTCCAGTAAGTCCCAGGGCTTCTCCTGTCTTTTTTCCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTAGATTGACTGTCCAGTAAGTCCCAGGGCTTCTCCTGTCTTTTTTCCT  200

seq1  TCTAAAAGTTCATAATTTATATACCCTTTGGTTCAAACATTTTCAAGTTT  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTAAAAGTTCATAATTTATATACCCTTTGGTTCAAACATTTTCAAGTTT  250

seq1  TCTGTTAATTTGCTTTGTGTGTGTTCAGGGCTTGTGTGTCATGTTACAGT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTGTTAATTTGCTTTGTGTGTGTTCAGGGCTTGTGTGTCATGTTACAGT  300

seq1  GTACCTGTGGTAGTCAGAGTTTGACTTAGAGTAGCTGCTCCTCTCCTTTC  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACCTGTGGTAGTCAGAGTTTGACTTAGAGTAGCTGCTCCTCTCCTTTC  350

seq1  AACATGGAGGTCACAAGGGTCAGGCATGGCAAGAACTGTATTTACACACT  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATGGAGGTCACAAGGGTCAGGCATGGCAAGAACTGTATTTACACACT  400

seq1  AAACCATCTCACAGGTCCTCACAAAAGGGAAGGTTGTGAGGTTCCAGTTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAACCATCTCACAGGTCCTCACAAAAGGGAAGGTTGTGAGGTTCCAGTTC  450

seq1  AGGTCCTAAAACTTGCATGGCAAGTGTTTACCAACTGTGACATATGGATC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCCTAAAACTTGCATGGCAAGTGTTTACCAACTGTGACATATGGATC  500

seq1  CTGCCATCAAACAGAAGCTATAAGAAAAAAAACAGAAGTATTTCTGTCCC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGCCATCAAACAGAAGCTATAAGAAAAAAAACAGAAGTATTTCTGTCCC  550

seq1  CTTCTATTTTATTGTCTAGCTAGCAGGATCTAAAAAATAAATAAACCATT  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCTATTTTATTGTCTAGCTAGCAGGATCTAAAAAATAAATAAACCATT  600

seq1  TTATAAAAATTAAAGGGATGTCACTGTTAAAATACTTGATATATTTTCAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATAAAAATTAAAGGGATGTCACTGTTAAAATACTTGATATATTTTCAA  650

seq1  GAATCAATTTTAAATATTTCTTTTTAGTCATCAGACATTTCTAATATGGG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATCAATTTTAAATATTTCTTTTTAGTCATCAGACATTTCTAATATGGG  700

seq1  AACGTAGATACCATTTTTAATAATCATTTTCCTTTCATTTCAATTGAAAT  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACGTAGATACCATTTTTAATAATCATTTTCCTTTCATTTCAATTGAAAT  750

seq1  ATTGCTGAATTTATTTATTTTTCTTTCACATTTTTGAGATAATTTGATGT  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGCTGAATTTATTTATTTTTCTTTCACATTTTTGAGATAATTTGATGT  800

seq1  GTAGAAGCCCATGTGCCTTACCCTTCTAAGTGCTGAGATTGTGCTTATCA  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAAGCCCATGTGCCTTACCCTTCTAAGTGCTGAGATTGTGCTTATCA  850

seq1  CTGGTAATGCCAGGATCATCCATCAGTTTAGATTGTACATTTGTTTGCTT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGTAATGCCAGGATCATCCATCAGTTTAGATTGTACATTTGTTTGCTT  900

seq1  CAGATTAATATTTTCCATATATTTTAACAGTTTTCGACATTATAATTACA  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGATTAATATTTTCCATATATTTTAACAGTTTTCGACATTATAATTACA  950

seq1  CTATTTCTCCCTTCCCTTTCTTCCTACCAAACCTACCATATTACTCCTCT  1000
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTATTTCTCCCTTCCCTTTCTTCCTACCAAACCTACCATATTACTCCTCT  1000

seq1  TTGCTGTTTCCAAGTAT-ATTGTACTCTTTATTCATTAAATAGTTGT--C  1047
      |||||| |||||||||| ||||||||||||| |||||||||||||||  |
seq2  TTGCTG-TTCCAAGTATAATTGTACTCTTTA-TCATTAAATAGTTGTTCC  1048

seq1  ACTAAACTCCTTCTTTCCCTACCCCATCACA--GGTA-TGTATATGTGTT  1094
      |||||||| | ||||| |||| |||||||||  |||| |||  |||||||
seq2  ACTAAACTTC-TCTTT-CCTA-CCCATCACAAGGGTATTGTTAATGTGTT  1095

seq1  AATGTGTATTCC-TAAAATATAAATGAAACA-TGAAAAG-TCTA  1135
      |  ||||||||| |||||||| ||||||||| ||||||| ||||
seq2  ATGGTGTATTCCTTAAAATAT-AATGAAACATTGAAAAGCTCTA  1138

seq1: chrX_144613143_144614294
seq2: B6Ng01-295K11.g_70_1222 (reverse)

seq1  TTCAC--GTAATTTATGCATCTTT--CATTGG-TACATTGAGAGTTTGGG  45
      |||||  |||||||||||||||||  |||||| ||||||||||| |||||
seq2  TTCACCGGTAATTTATGCATCTTTTCCATTGGTTACATTGAGAGGTTGGG  50

seq1  A-GCAAAG-AACACTTACCCTATTACCA-TTTTCTGACCTTTCATTTGAA  92
      | |||||| |||||||  |||||||||| |||||||||  ||||||||||
seq2  AGGCAAAGAAACACTTTACCTATTACCATTTTTCTGAC--TTCATTTGAA  98

seq1  ATTATGCTGCGTTTGTTTATGTGTTTGTCTGTTCATTGCTTCGTTTATTT  142
      ||||||||||| ||||||||||| ||||||| ||| ||||||||||||| 
seq2  ATTATGCTGCG-TTGTTTATGTG-TTGTCTG-TCA-TGCTTCGTTTATTA  144

seq1  ACCTCTTAATTTTTTATATGAAGCTACAGAGTGAAGGGGCAACCTGTCTT  192
       |||||  | ||||||||||||||||||||||||| ||||||||||||||
seq2  CCCTCT--AATTTTTATATGAAGCTACAGAGTGAAAGGGCAACCTGTCTT  192

seq1  G-AAAAAAATACTTTGGTCAAAAGCCTGTCCTAAAATCCAGTATTCACTG  241
      | |||||||||  ||||||||||| |||||||||||||||||||||||||
seq2  GAAAAAAAATAACTTGGTCAAAAG-CTGTCCTAAAATCCAGTATTCACTG  241

seq1  AGCCTGAA-TTCCAATGCAATCGTTCTGCTTCTGCAGTTTTAGACATGAA  290
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  AGCCTGAATTTCCAATGCAATCGTTCTGCTTCTGCAGTTTTAGACATGAA  291

seq1  ATTGTAGATATAAGCTGCCAGGTAATGCTCATTCAGGGATGTGATAATTT  340
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTGTAGATATAAGCTGCCAGGTAATGCTCATTCAGGGATGTGATAATTT  341

seq1  CATTTGTTTGGATTGGTTTTTAGGAACGTGTTTCCTTTAAAGCCTGCTGG  390
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTTGTTTGGATTGGTTTTTAGGAACGTGTTTCCTTTAAAGCCTGCTGG  391

seq1  CTGGAGACACCCATTGTGGCTCAGGATGACAGGAAATGCCCCATTATTCT  440
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGGAGACACCCATTGTGGCTCAGGATGACAGGAAATGCCCCATTATTCT  441

seq1  GCCTTTAACAGTGCTGGGATTTTGCATATACACAGTCCTACCTGGAGTAT  490
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCCTTTAACAGTGCTGGGATTTTGCATATACACAGTCCTACCTGGAGTAT  491

seq1  TCTTCAAAAGAGACAAACTGTTTTTAAAAAACTTCAATACCAGGCTCATG  540
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTCAAAAGAGACAAACTGTTTTTAAAAAACTTCAATACCAGGCTCATG  541

seq1  TAATCCACTGGAACATGAACTGACTACTGTCTAGGCTGAGTTCTGGGACA  590
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATCCACTGGAACATGAACTGACTACTGTCTAGGCTGAGTTCTGGGACA  591

seq1  TAGTGTATGCTTGTAAGCATGAGAATCTGAGTTTGATGCCCAGGAAAATG  640
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGTGTATGCTTGTAAGCATGAGAATCTGAGTTTGATGCCCAGGAAAATG  641

seq1  GATTGGAAACCTAATAATATCCTCAAATATGTGTAGGTAATCAAATGTAA  690
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGGAAACCTAATAATATCCTCAAATATGTGTAGGTAATCAAATGTAA  691

seq1  TGAGGCTAGGTCAAGAAGATAAGAGTTATTTACATGGACTCTTAGCTACA  740
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGAGGCTAGGTCAAGAAGATAAGAGTTATTTACATGGACTCTTAGCTACA  741

seq1  GCACAATTTCAGGACCAGACAGGAATATATCAGAAATGTAGCTAAAACAT  790
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCACAATTTCAGGACCAGACAGGAATATATCAGAAATGTAGCTAAAACAT  791

seq1  GTACTTCAAATGTATAATTTCCTTCCAATTTGAATGGGAAGTACATTTAA  840
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTACTTCAAATGTATAATTTCCTTCCAATTTGAATGGGAAGTACATTTAA  841

seq1  GTTTAAAAATCCTTTAAGATATGGTCTTAATTACCCTTTCCAATTATAAA  890
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTTAAAAATCCTTTAAGATATGGTCTTAATTACCCTTTCCAATTATAAA  891

seq1  ACCATATTGTGCATTCTATACTCCTTTAGGAACCCCTGAGTCATACCCTG  940
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCATATTGTGCATTCTATACTCCTTTAGGAACCCCTGAGTCATACCCTG  941

seq1  ATAGAACCTAGTGGGGATACCCTCACTCAATTCCCGATTCGGTGTGCACC  990
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATAGAACCTAGTGGGGATACCCTCACTCAATTCCCGATTCGGTGTGCACC  991

seq1  CCCCAAAAATCACGGAGGACCATCTTGCTGTAATTAGACTAGGTAGTTTA  1040
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCAAAAATCACGGAGGACCATCTTGCTGTAATTAGACTAGGTAGTTTA  1041

seq1  ATTACAGAGCTCTGGACTCACATGCATCCCACACAGGAGATAAAGGATGT  1090
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTACAGAGCTCTGGACTCACATGCATCCCACACAGGAGATAAAGGATGT  1091

seq1  CGACCAGGATACTCAAAAGCTAGGGTTTTTCATGGGGTAAGGGGCTTAGG  1140
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CGACCAGGATACTCAAAAGCTAGGGTTTTTCATGGGGTAAGGGGCTTAGG  1141

seq1  GGTCTGGAATTC  1152
      ||||||||||||
seq2  GGTCTGGAATTC  1153

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information