MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-296F18
Chromosome	X (Build37)
Map Location	122,360,366 - 122,455,838
singlet/doublet	doublet
Overlap gene	none
Upstream gene	LOC100039828, EG434843, EG665463, EG665522, LOC100038969, LOC100038978, EG665579
Downstream gene	EG665611, EG626048, LOC100040410, LOC100039903, LOC665679, 4932411N23Rik, Gm381
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039828 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 821 ESTs, 7 Proteins

name	EG434843 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434843 MGI:3646126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG665463 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665463 MGI:3646874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG665522 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665522 MGI:3645463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 983 ESTs, 7 Proteins

name	LOC100038969 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 823 ESTs, 7 Proteins

name	LOC100038978 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 813 ESTs, 7 Proteins

name	EG665579 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665579 MGI:3649140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG665611 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665611 MGI:3646259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins

name	EG626048 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:626048 MGI:3645883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 937 ESTs, 7 Proteins

name	LOC100040410 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein

name	LOC100039903 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 86 ESTs

name	LOC665679 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665679
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 Proteins pseudo : _no_value

name	4932411N23Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:237029 MGI:3045322
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gm381 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:214308 MGI:2685227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins

name	LOC100039828 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272168 GeneID:100039828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 820 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 1 transcript_id : XM_001473276.1

name	LOC100039828 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272170 GeneID:100039828
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 402 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 2 transcript_id : XM_001473295.1

name	EG434843 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272172 GeneID:434843 MGI:3646126
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG434843 transcript_id : XM_486761.4

name	EG665463 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272173 GeneID:665463 MGI:3646874
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG665463 transcript_id : XM_977110.2

name	EG665522 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272221 GeneID:665522 MGI:3645463
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 983 ESTs, 7 Proteins product : predicted gene, EG665522 transcript_id : XM_977540.2

name	LOC100038969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272224 GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 404 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 2 transcript_id : XM_001472037.1

name	LOC100038969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272226 GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 483 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 3 transcript_id : XM_001472061.1

name	LOC100038969 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272222 GeneID:100038969
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 821 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 1 transcript_id : XM_001472007.1

name	LOC100038978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272228 GeneID:100038978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 9 mRNAs, 812 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 1 transcript_id : XM_001472084.1

name	LOC100038978 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272230 GeneID:100038978
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 401 ESTs, 7 Proteins product : similar to 40S ribosomal protein S12, transcript variant 2 transcript_id : XM_001472119.1

name	EG665579 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272232 GeneID:665579 MGI:3649140
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG665579 transcript_id : XM_977918.2

name	EG665611 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272237 GeneID:665611 MGI:3646259
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 981 ESTs, 7 Proteins product : predicted gene, EG665611 transcript_id : XM_978135.2

name	EG626048 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408243 GeneID:626048 MGI:3645883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 mRNAs, 936 ESTs, 7 Proteins product : predicted gene, EG626048, transcript variant 2 transcript_id : XM_890604.2

name	EG626048 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272238 GeneID:626048 MGI:3645883
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 420 ESTs, 7 Proteins product : predicted gene, EG626048, transcript variant 1 transcript_id : XM_001473380.1

name	LOC100040410 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272248 GeneID:100040410
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs, 1 Protein product : similar to RIKEN cDNA 3110007F17 gene transcript_id : XM_001474637.1

name	LOC100039903 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272240 GeneID:100039903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 86 ESTs product : hypothetical protein LOC100039903 transcript_id : XM_001473395.1

name	4932411N23Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31343243 GeneID:237029 MGI:3045322
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4932411N23 gene transcript_id : NM_177705.2

name	Gm381 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:20985343 GeneID:214308 MGI:2685227
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins product : gene model 381, (NCBI) transcript_id : XM_142110.1

name	LOC100039828 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272169 GeneID:100039828
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001473326.1

name	LOC100039828 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272171 GeneID:100039828
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_001473345.1

name	EG434843 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:51772387 GeneID:434843 MGI:3646126
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_486761.1

name	EG665463 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408152 GeneID:665463 MGI:3646874
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_982204.1

name	EG665522 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408225 GeneID:665522 MGI:3645463
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_982634.1

name	LOC100038969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272223 GeneID:100038969
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001472057.1

name	LOC100038969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272225 GeneID:100038969
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_001472087.1

name	LOC100038969 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272227 GeneID:100038969
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 3 protein_id : XP_001472111.1

name	LOC100038978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272229 GeneID:100038978
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001472134.1

name	LOC100038978 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272231 GeneID:100038978
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_001472169.1

name	EG665579 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408233 GeneID:665579 MGI:3649140
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_983012.1

name	EG665611 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408240 GeneID:665611 MGI:3646259
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 protein_id : XP_983229.1

name	EG626048 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272239 GeneID:626048 MGI:3645883
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 1 protein_id : XP_001473430.1

name	EG626048 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:83003650 GeneID:626048 MGI:3645883
definition	codon_start : 1 product : similar to 40S ribosomal protein S12 isoform 2 protein_id : XP_895697.1

name	LOC100040410 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272249 GeneID:100040410
definition	codon_start : 1 product : similar to RIKEN cDNA 3110007F17 gene protein_id : XP_001474687.1

name	LOC100039903 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272241 GeneID:100039903
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001473445.1

name	4932411N23Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244162 CCDS:CCDS30382.1 GeneID:237029 MGI:3045322
definition	GO_component : GO:0005634 - nucleus [Evidence IEA]; GO:0005681 - spliceosome complex [Evidence IEA] GO_function : GO:0003677 - DNA binding [Evidence IEA] GO_process : GO:0007049 - cell cycle [Evidence IEA]; GO:0006397 - mRNA processing [Evidence IEA]; GO:0000398 - nuclear mRNA splicing, via spliceosome [Evidence IEA]; GO:0045449 - regulation of transcription [Evidence IEA] codon_start : 1 note : novel Myb-like DNA-binding domain containing protein product : hypothetical protein LOC237029 protein_id : NP_808373.1

name	Gm381 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:20985344 GeneID:214308 MGI:2685227
definition	codon_start : 1 product : similar to novel gene coding for a KH domain containing protein protein_id : XP_142110.1

name	LOC665679 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665679
definition	number : 2 pseudo : _no_value

name	LOC665679 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665679
definition	number : 1 pseudo : _no_value

clone name	MSMg01-368K04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-159B13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-195N23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-524F05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-304N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-079F14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-098J13
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-140A21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-158N04
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-181N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-357B18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-412F23
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453F03
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-453O14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-518L08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262O21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-101C05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-368J06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-386G14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-500N14
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-511L11
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-523O04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-494M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-466K24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-118B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-007L18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-127A21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-207F02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-005D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-146D09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-022N09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-241L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-309J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-162I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-060M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-284O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-248C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-150G19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150P17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252I20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-296F18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-214D12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043O12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-051J22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031I01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-093L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-155D13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-145O02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-289M06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100P13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-252B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-125G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-184B16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-071K03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-160B11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-104P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-148L04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-166J21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153O13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-037C22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-295C08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-118P21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-012I23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133K14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-254P16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-002B14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-249D04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-064G24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036L01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-224G17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-088H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102G04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-333H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-047B17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-271H05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-288N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-013K11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-342I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-001C12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003H16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-181I19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019A13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193J11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228K12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-240M17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246N01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-260K06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-267E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-267P22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-272E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-330K03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-333H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-179O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-038H13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-179O06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-010L06
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-011C18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-198N04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-043L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-049M20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-243F14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-245P07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077G08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-088H04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-108I14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-297M20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-141E11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004I09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210J12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004C20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-024N22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-036I23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-246F12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246F23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-275P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-104A01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-004E13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201J14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-100H23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-014J09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-322P16
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-296F18.b	B6Ng01-296F18.g
ACC	GA091990	GA091991
length	1,098	1,177
definition	B6Ng01-296F18.b	B6Ng01-296F18.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(122,360,366 - 122,360,981)	(122,454,645 - 122,455,838)
sequence	gaattctgtttacaagtattttattgagtatttttaaatcgatgtttata agggcaattggtccaaaattctctttctttgttgagtctttttgtgactt aagtatcacattgactgtatccccataaagtaaattttgtcaactttcct tctgtttttatctggttaaataatttgtgtatcagtattagcactatttg aaagtatggtataatcctgctctaaaactatctgaccttgtctagttttg tttgggagatattaaatgacaggttatatttcctttggctataggactat tcaagttgatcttgattcagctttagcaaattgtatctattgagaaaatt gtcctttttattttttctattttggttttccatgtttctggagtacaggt ttttgaagtgaaacccaatgatcccggtgtctgttgttatatcttcctct tcatttctaattttgttaatttgtatgctttctctctctttcttttagtt agttttgaaaaaaggtttgtccatcctgatgattttctcaaagaaccaaa tatttgttgcctgattctttgtcttgttctctttgatttttttattgatt ttagttttgagtttgattatttcctgctgtctatttagctttggtggctg tgcttctatttgaaacagagttttctgacatgctgttaattggtgggtat gagatctctacaatttcttatgaatacactcataactatgaaccttcatc ttagctctgttttcattgtaccccatttacttggaattttgtgcaattca ttgaattctagaaaatctttaattcctctttcctttttaaatttccttct aattgccctgatggttgaaagctgatggcttctggaagcttaaaactttc tggcttattttgtggttaaatttgcccacctctgatgattaatacctgtg gtttaatagtggagtattgagttagacacactgcttccctgctaagtgct aaaagttcttaacttgtgtagccaggagaaattcacattcaccaagaaaa aagtacctcaccttcaaagagacttagactcattctagggagaagaga	gaattctttacatgattacaaaagaggtcgaatatacatgatatagactt tagttgaattgaacttttataaagagaactttgataaaaaataatattta ctctatgggtgctttcaaaaaatagaatggtttgcatggaacaagttagt attggaaggattaaaagttccaagctatccttggttacatactaagtttg ggccagcctaggctatatgacaacctgtctgaaaataggaaattactgga accagtagtttatctttatgaatcctgtactttggagactgaatcatgag caatatcagacgtacaaggactatcagtgccagaaagtataaacagaatt tcccaaacaaaaataatttaagagttatacttaggggcttgattatgttg ccacggaataaaagcactttgagatgagagtggtcagtaatgaggagtga gtattgctcttgcacaggactcacgttgggtagctcgcagtcaccttcag cttgagcttcaggaggcctctagcacctgtgggcatgtgcatttacttac atatgtatgtatgtaccaacacacacacacacacacacacaaacttaaat aatagggaaacgtactttgcatctatcagtttaaaggaagtttgatttga atgtacttaaaagaggtgcctcataaccaaagtatgaaatctgctagtct tccacaaattaggtgactcagagccactagtcaaataaattacaccctag acatgggcatccatgaggtccactggataagtgtggatagagattgatgg tagagctattggattatgtaaggggaggcttaaataaaactgagagattc acagactcatgtgatataagctggcttttgttgtgtgttggtattatata gtattataatcccttacttgctttcaagacatatttcatatagttcagac tgtcctttatcctcacttaatagcttcaatatgactatgaaccactgata ctcttgcttccttccagaacagcttaggatttaaagagagttactagcat gctctacttgaatgcagtttagagatcaaacccaagctttatgcattgag aatagtactctacgatttctacttcgcagctgcagcttcctgttaagaac agtccaagagcacaagcattttcttat
quality values	Open. Hide. 58 31 34 26 58 58 42 47 46 62 45 46 43 16 47 62 62 43 47 62 62 43 62 49 62 49 62 62 62 62 47 56 56 46 29 34 38 46 62 59 62 62 59 62 62 62 59 62 62 62 37 49 49 49 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 62 62 58 58 58 45 49 58 58 58 58 58 54 54 58 45 41 58 58 58 58 58 58 52 58 58 58 58 58 54 58 58 58 58 54 58 54 58 58 58 58 58 58 58 58 58 58 54 42 58 54 54 58 58 58 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 41 58 58 58 58 58 54 51 58 58 58 46 49 58 58 58 58 58 58 58 58 58 58 58 40 58 58 58 58 46 41 51 51 51 58 58 58 54 51 58 51 58 54 51 52 49 53 47 58 50 53 52 58 58 58 58 47 44 45 58 54 50 58 58 53 51 54 53 53 53 51 50 49 58 58 37 48 58 50 50 53 52 58 46 58 58 58 49 51 52 51 51 40 23 54 58 58 58 51 49 35 26 41 52 58 58 32 33 58 58 51 38 42 41 53 58 40 33 32 50 53 53 49 50 49 29 28 44 54 39 52 53 51 41 35 49 42 45 38 39 53 34 53 54 53 40 52 38 32 39 53 42 53 45 53 51 37 52 49 52 40 34 53 45 52 41 52 26 44 41 52 42 51 23 54 54 34 42 32 45 42 54 34 37 31 54 54 32 33 53 54 37 33 37 42 33 34 53 53 41 24 49 49 45 40 33 47 34 29 52 33 30 31 35 39 53 45 34 34 41 41 32 29 32 25 52 52 47 31 30 37 31 47 24 13 41 34 38 27 32 31 35 21 51 16 17 38 39 51 46 41 30 41 51 30 31 51 41 32 31 31 31 31 25 29 33 29 32 32 29 48 32 27 43 38 32 35 41 28 31 32 42 48 31 31 31 32 31 37 25 42 31 26 33 31 38 33 32 33 27 33 27 31 24 36 28 46 46 34 32 36 48 33 24 31 33 33 24 26 21 31 31 48 46 27 23 17 31 31 14 25 31 44 18 23 41 26 10 21 44 29 23 22 19 31 32 29 32 31 22 34 30 14 34 18 28 32 34 32 28 21 31 24 25 21 14 33 22 29 21 23 30 28 23 21 25 26 16 31 20 13 30 15 21 20 23 17 19 5 6 9 9 29 19 23 31 8 8 6 17 20 36 33 19 25 21 31 16 34 10 18 30 21 28 17 34 34 26 24 19 14 23 29 19 7 23 8 21 27 13 7 23 11 17 13 14 28 6 8 9 20 7 16 34 18 15 14 9 10 13 24 15 13 9 8 7 5 9 9 5 11 47 28 28 47 15 13 12 5 6 5 6 10 8 8 7 11 24 19 10 17 17 8 15 17 8 10 17 14 8 5 18 9 18 8 6 20 11 12 20 10 11 21 10 23 6 5 5 4 2 3 6	Open. Hide. 62 44 39 59 62 62 62 62 59 62 59 36 51 34 29 27 44 46 46 43 51 54 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 54 49 54 54 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 49 46 38 62 62 62 62 62 62 62 62 62 54 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 58 54 42 49 45 58 58 58 58 58 54 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 52 58 58 58 58 58 58 58 58 58 54 58 58 58 48 58 44 50 58 54 50 58 54 58 58 58 58 58 58 58 51 58 51 58 50 58 51 58 52 58 49 49 47 47 51 53 53 58 53 53 58 47 43 58 54 58 58 58 58 47 48 51 54 50 54 58 58 50 54 49 50 53 50 58 50 54 49 43 50 58 58 41 33 58 50 58 58 50 48 33 51 58 58 58 47 38 58 58 47 51 51 41 46 35 40 35 50 51 31 58 58 50 40 51 26 46 50 53 40 50 51 38 39 50 50 40 44 40 31 58 42 43 52 50 42 53 50 58 39 50 54 51 54 37 50 44 49 37 53 53 37 52 33 23 53 45 54 35 39 39 35 11 35 45 45 46 29 51 42 39 28 51 23 39 49 30 47 52 39 32 42 52 40 54 52 40 37 54 40 33 45 40 42 22 31 49 53 42 53 23 31 31 30 35 42 51 52 39 37 42 39 51 32 42 34 35 12 47 29 35 31 30 31 29 34 52 53 31 32 46 31 41 41 28 51 29 34 33 40 31 53 40 41 26 32 40 32 32 31 31 24 38 31 38 31 31 45 33 31 37 36 31 29 33 31 31 27 36 31 26 30 24 51 51 33 32 18 42 25 37 38 30 51 36 35 32 51 51 18 28 31 30 46 17 42 33 18 6 31 21 15 27 31 32 43 28 37 38 28 32 35 27 27 31 29 31 31 26 22 26 43 26 25 46 21 41 41 39 23 32 39 29 19 15 28 16 14 10 23 37 39 21 31 22 19 25 16 30 32 30 32 29 30 18 27 24 20 22 25 8 9 37 15 23 14 31 26 17 16 38 31 29 38 26 29 31 18 19 22 9 11 13 21 32 44 31 21 35 30 31 31 34 19 31 31 20 32 21 29 20 13 12 9 6 32 18 43 32 21 11 7 7 13 27 20 19 30 15 8 20 21 32 22 32 10 15 14 21 11 21 32 17 32 29 21 9 12 4 8 19 25 4 4 14 25 21 21 18 11 13 19 11 31 5 5 7 19 27 24 6 10 25 11 7 21 9 9 27 17 9 19 13 10 9 10 6 8 9 19 10 26 11 23 38 26 17 18 9 15 11 4 4 8 27 10 17 6 28 7 19 7 20 5 8 4 14 13 18 11 10 11 11 8 8 16 14 9 22 28 14 4 4 8 5 7 11 9 7 26 7 8 11 6 14 7 3 3 13 16 7 8 11 16 8 4 5 5 4 6 7 23 16 5 5 2 4 6 12 12 11 7 10 13 4 17 6 11 21 5 5 6 11 14 22 5 3 1 6 9 14 6 7 8 9 5 5 2 6 4 7 4 5 3 6 11 6 15 6 9 5 18 6 3 3 3 3 5 7 9 3 3 8 4 5 7 4 5 2 3 2 24 4 6 16 4 7 12

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_122360366_122360981
seq2: B6Ng01-296F18.b_533_1144

seq1  TCTTTCTTTTAGTTAGTTTTGAAAAAAGGTTTGTCCATCCTGATGATTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCTTTCTTTTAGTTAGTTTTGAAAAAAGGTTTGTCCATCCTGATGATTTT  50

seq1  CTCAAAGAACCAAATATTTGTTGCCTGATTCTTTGTCTTGTTCTCTTTGA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTCAAAGAACCAAATATTTGTTGCCTGATTCTTTGTCTTGTTCTCTTTGA  100

seq1  TTTTTTTATTGATTTTAGTTTTGAGTTTGATTATTTCCTGCTGTCTATTT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTTTTATTGATTTTAGTTTTGAGTTTGATTATTTCCTGCTGTCTATTT  150

seq1  AGCTTTGGTGGCTGTGCTTCTATTTGAAACAGAGTTTTCTGACATGCTGT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCTTTGGTGGCTGTGCTTCTATTTGAAACAGAGTTTTCTGACATGCTGT  200

seq1  TAATTGGTGGGTATGAGATCTCTACAATTTCTTATGAATACACTCATAAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTGGTGGGTATGAGATCTCTACAATTTCTTATGAATACACTCATAAC  250

seq1  TATGAACCTTCATCTTAGCTCTGTTTTCATTGTACCCCATTTACTTGGAA  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATGAACCTTCATCTTAGCTCTGTTTTCATTGTACCCCATTTACTTGGAA  300

seq1  TTTTGTGCAATTCATTGAATTCTAGAAAATCTTTAATTCCTCTTTCCTTT  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTGTGCAATTCATTGAATTCTAGAAAATCTTTAATTCCTCTTTCCTTT  350

seq1  TTAAATTTCCTTCTAATTGCCCTGATGGTTGAAAGCTGATGGCTTCTGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAAATTTCCTTCTAATTGCCCTGATGGTTGAAAGCTGATGGCTTCTGGA  400

seq1  AGCTTAAAATTTTCTGGCTTATTTTGTGGTTAAATTTGCCCAACTCTGAT  450
      ||||||||| |||||||||||||||||||||||||||||||| |||||||
seq2  AGCTTAAAACTTTCTGGCTTATTTTGTGGTTAAATTTGCCCACCTCTGAT  450

seq1  GATTAATACCTGTGGTTTAATAGTGGAGTATTGAGTTAGGACACAGTGCC  500
      |||||||||||||||||||||||||||||||||||||| |||||| || |
seq2  GATTAATACCTGTGGTTTAATAGTGGAGTATTGAGTTA-GACACACTG-C  498

seq1  TTCCCTGCTAAGTGCTAAAAGTTCTTTAAACTTGTGTAGCCA-GAGAAAT  549
      ||||||||||||||||||||||||||  |||||||||||||| |||||||
seq2  TTCCCTGCTAAGTGCTAAAAGTTCTT--AACTTGTGTAGCCAGGAGAAAT  546

seq1  TCACATTCA-CAAG-AAAAAGTA-CTCACTTCAAAAGAAGGATTTAGACT  596
      ||||||||| |||| |||||||| ||||| |  |||||  || |||||| 
seq2  TCACATTCACCAAGAAAAAAGTACCTCACCTTCAAAGA--GACTTAGAC-  593

seq1  TTATTTCTAGGAGAG-AGAGA  616
       |  ||||||| ||| |||||
seq2  -TCATTCTAGG-GAGAAGAGA  612

seq1: chrX_122454645_122455838
seq2: B6Ng01-296F18.g_67_1243 (reverse)

seq1  ATAAGAAA-----TGTTGTCTTGGACTTGTCCTTAACAGGAAGGCTTGCA  45
      ||||||||     |||  |||||||| ||| ||||||||||||   ||||
seq2  ATAAGAAAATGCTTGTGCTCTTGGAC-TGTTCTTAACAGGAAG--CTGCA  47

seq1  GCTGCAGAAGTAGAATTGGTAGAGTACTTTATTCTC-ATGCATGAAGCCT  94
      ||||| ||||||||| | |||||||||  ||||||| |||||| ||| ||
seq2  GCTGC-GAAGTAGAAATCGTAGAGTAC--TATTCTCAATGCATAAAG-CT  93

seq1  TGGGTTTGATCTCTAAAACTGCA-TCAAGTAGGGCATGCTGGTACCTCTC  143
      |||||||||||||| |||||||| |||||||| ||||||| ||| |||||
seq2  TGGGTTTGATCTCT-AAACTGCATTCAAGTAGAGCATGCTAGTAACTCTC  142

seq1  TTT-AATCCT-AGCTGTTCTGGAAAGTGAAAGCAGGAGTATCAGTGGTTC  191
      ||| |||||| |||||||||||||   | ||||| |||||||||||||||
seq2  TTTAAATCCTAAGCTGTTCTGGAA---GGAAGCAAGAGTATCAGTGGTTC  189

seq1  ATAGTCATATTG-AGCTATTAAGTGA-GATAAAGGACAGTCTGAACTATA  239
      |||||||||||| ||||||||||||| |||||||||||||||||||||||
seq2  ATAGTCATATTGAAGCTATTAAGTGAGGATAAAGGACAGTCTGAACTATA  239

seq1  TGAAATATGTC-TCAAAGTATGTAA-GGATTATAATACTATATAATACCA  287
      ||||||||||| | |||| | |||| ||||||||||||||||||||||||
seq2  TGAAATATGTCTTGAAAGCAAGTAAGGGATTATAATACTATATAATACCA  289

seq1  ACACACAAACAAAAGCCAGCTTATATCACATGAGTCTGTGAATCTATCAG  337
      |||||| |||||||||||||||||||||||||||||||||||||| ||||
seq2  ACACAC-AACAAAAGCCAGCTTATATCACATGAGTCTGTGAATCTCTCAG  338

seq1  TTTTATTTAAGCCTCCCCTTACATAATCCAATAGCTCTACCATCAATCTC  387
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTTATTTAAGCCTCCCCTTACATAATCCAATAGCTCTACCATCAATCTC  388

seq1  TATCCACATTTATCCAGTGGACCTCATGGATGCCCATGTCTAGGGTGTAA  437
      |||||||| |||||||||||||||||||||||||||||||||||||||||
seq2  TATCCACACTTATCCAGTGGACCTCATGGATGCCCATGTCTAGGGTGTAA  438

seq1  TTTATTTGACTAGTGGCTCTGAGTCACCTAATTTGTGGAAGACTAGCAGA  487
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTATTTGACTAGTGGCTCTGAGTCACCTAATTTGTGGAAGACTAGCAGA  488

seq1  TTTCATACTTTGGTTATGAGGCACCTCTTTTAAGTACATTTAAATCAAAC  537
      |||||||||||||||||||||||||||||||||||||||| |||||||||
seq2  TTTCATACTTTGGTTATGAGGCACCTCTTTTAAGTACATTCAAATCAAAC  538

seq1  TTCCTTTAAACTGATAGATGCAAGGTACTTTTCCCTATTATTTAAGTTTG  587
      ||||||||||||||||||||||| |||| |||||||||||||||||||  
seq2  TTCCTTTAAACTGATAGATGCAAAGTACGTTTCCCTATTATTTAAGTT--  586

seq1  TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTGGTACATACATACGTA  637
                ||||||||||||||||||||||||||||||||||||| ||
seq2  ----------TGTGTGTGTGTGTGTGTGTGTGTTGGTACATACATACATA  626

seq1  TGTAAGTAAATGCACATGAACACAGGTGCTAGAGGCCTCCTGAAGCTCAA  687
      ||||||||||||||||||  ||||||||||||||||||||||||||||||
seq2  TGTAAGTAAATGCACATGCCCACAGGTGCTAGAGGCCTCCTGAAGCTCAA  676

seq1  GCTGAAGGTGACTGCGAGCTACCCAACGTGAGTCCTGTGCAAGAGCAATA  737
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCTGAAGGTGACTGCGAGCTACCCAACGTGAGTCCTGTGCAAGAGCAATA  726

seq1  CTCACTCCTCATTACTGACCACTCTCATCTCAAAGTGCTTTTATTCTGTA  787
      |||||||||||||||||||||||||||||||||||||||||||||| || 
seq2  CTCACTCCTCATTACTGACCACTCTCATCTCAAAGTGCTTTTATTCCGTG  776

seq1  GCAACATAATCAAACCCCTAAGTATAACTCTTAAATTATTTTTGTTTGGG  837
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  GCAACATAATCAAGCCCCTAAGTATAACTCTTAAATTATTTTTGTTTGGG  826

seq1  AAATTCTGTTTATACTTTCTGGCACTGTTAGTCCTTGTACTTCTGATATT  887
      ||||||||||||||||||||||||||| |||||||||||| |||||||||
seq2  AAATTCTGTTTATACTTTCTGGCACTGATAGTCCTTGTACGTCTGATATT  876

seq1  GCTCATGATTCAGTCTCCAAAGTACAGGATTCATAAAGATAAAGATAAAC  937
      ||||||||||||||||||||||||||||||||      ||||||||||||
seq2  GCTCATGATTCAGTCTCCAAAGTACAGGATTC------ATAAAGATAAAC  920

seq1  TACTGGTTCCAGTAATTTCCTATTTTCAGACAGATTGTCATATAGCCTAG  987
      ||||||||||||||||||||||||||||||||| ||||||||||||||||
seq2  TACTGGTTCCAGTAATTTCCTATTTTCAGACAGGTTGTCATATAGCCTAG  970

seq1  GCTGGCCCAAACTTAGTATGTAACCAAGGATAGCTTGGAACTTCTAATCC  1037
      ||||||||||||||||||||||||||||||||||||||||||| ||||||
seq2  GCTGGCCCAAACTTAGTATGTAACCAAGGATAGCTTGGAACTTTTAATCC  1020

seq1  TTCCAATACTAACTTGTTCCATGCAAACCATTCTATTTTTTGAAAGCACA  1087
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  TTCCAATACTAACTTGTTCCATGCAAACCATTCTATTTTTTGAAAGCACC  1070

seq1  CATAGAGTAAATATTATTTCTTCTCAAAGTTCTCTTTATAAAAGTTCAAT  1137
      ||||||||||||||||||| || |||||||||||||||||||||||||||
seq2  CATAGAGTAAATATTATTTTTTATCAAAGTTCTCTTTATAAAAGTTCAAT  1120

seq1  TCAACTAAAGTCTATGTCATGTATATTCAACCTCTTTTGTAATCATGTAA  1187
      ||||||||||||||| |||||||||||| |||||||||||||||||||||
seq2  TCAACTAAAGTCTATATCATGTATATTCGACCTCTTTTGTAATCATGTAA  1170

seq1  AGAATTC  1194
      |||||||
seq2  AGAATTC  1177

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information