MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-303M22
Chromosome	X (Build37)
Map Location	116,404,684 - 116,405,807
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100039551, Tgifx1, LOC665087
Downstream gene	LOC385417, Pabpc5, LOC236983, LOC674318, EG545741, LOC100039461, Pcdh11x
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100039551 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 6 Proteins

name	Tgifx1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245583 MGI:2387796
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665087 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665087
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 21 Proteins pseudo : _no_value

name	LOC385417 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385417
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	Pabpc5 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:93728 MGI:2136401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC236983 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:236983
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 17 Proteins pseudo : _no_value

name	LOC674318 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:674318
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	EG545741 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:545741 MGI:3648580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 234 ESTs, 25 Proteins

name	LOC100039461 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100039461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs

name	Pcdh11x (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:245578 MGI:2442849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100039551 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272158 GeneID:100039551
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 mRNAs, 7 ESTs, 6 Proteins product : similar to testis-expressed homeobox protein Tex1 transcript_id : XM_001472895.1

name	Tgifx1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:23346540 GeneID:245583 MGI:2387796
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : TGIF homeobox 1 transcript_id : NM_153109.1

name	Pabpc5 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142370786 GeneID:93728 MGI:2136401
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : poly A binding protein, cytoplasmic 5 transcript_id : NM_053114.2

name	EG545741 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149272160 GeneID:545741 MGI:3648580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 14 mRNAs, 233 ESTs, 25 Proteins product : predicted gene, EG545741, transcript variant 1 transcript_id : XM_001487781.1

name	EG545741 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94408117 GeneID:545741 MGI:3648580
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 13 mRNAs, 177 ESTs, 2 Proteins product : predicted gene, EG545741, transcript variant 2 transcript_id : XM_974196.1

name	LOC100039461 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149272149 GeneID:100039461
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 6 ESTs product : hypothetical protein LOC100039461 transcript_id : XM_001472925.1

name	Pcdh11x (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:124487050 GeneID:245578 MGI:2442849
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : protocadherin 11 X-linked transcript_id : NM_001081385.1

name	LOC100039551 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272159 GeneID:100039551
definition	codon_start : 1 product : similar to testis-expressed homeobox protein Tex1 protein_id : XP_001472945.1

name	Tgifx1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:23346541 CCDS:CCDS30368.1 GeneID:245583 MGI:2387796
definition	GO_function : GO:0003677 - DNA binding [Evidence IEA]; GO:0043565 - sequence-specific DNA binding [Evidence IEA] GO_process : GO:0006350 - transcription [Evidence IEA] codon_start : 1 note : TGF beta-induced transcription factor 2-like protein; testis expressed homeobox Tex1 product : TGIF homeobox 1 protein_id : NP_694749.1

name	Pabpc5 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29336045 CCDS:CCDS30369.1 GeneID:93728 MGI:2136401
definition	GO_component : GO:0005575 - cellular_component [Evidence ND] GO_function : GO:0003674 - molecular_function [Evidence ND]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0003723 - RNA binding [Evidence IEA] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : poly A binding protein cytoplasmic 5 product : poly A binding protein, cytoplasmic 5 protein_id : NP_444344.1

name	EG545741 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149272161 GeneID:545741 MGI:3648580
definition	codon_start : 1 product : similar to glyceraldehyde-3-phosphate-dehydrogenase isoform 1 protein_id : XP_001487831.1

name	EG545741 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94408118 GeneID:545741 MGI:3648580
definition	codon_start : 1 product : similar to glyceraldehyde-3-phosphate-dehydrogenase isoform 2 protein_id : XP_979290.1

name	LOC100039461 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149272150 GeneID:100039461
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001472975.1

name	LOC665087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665087
definition	number : 2 pseudo : _no_value

name	LOC665087 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665087
definition	number : 1 pseudo : _no_value

name	LOC385417 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385417
definition	number : 1 pseudo : _no_value

name	LOC385417 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385417
definition	number : 2 pseudo : _no_value

name	LOC385417 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385417
definition	number : 3 pseudo : _no_value

name	LOC236983 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:236983
definition	number : 1 pseudo : _no_value

name	LOC674318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674318
definition	number : 1 pseudo : _no_value

name	LOC674318 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:674318
definition	number : 2 pseudo : _no_value

clone name	MSMg01-235C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159H08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-386D17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-334N14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-416P22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-159H08
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-161F02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-467H20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-050D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497J20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231P11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158E19
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-367M15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-049G16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-180L04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-123C04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350C21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-291B21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-273P07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-280I07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-350O18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-158J15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-531K14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-160G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-460I16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-419A06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-208J03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-543L18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-470D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-340B08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-278D01
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-479P19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-144A12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-532I05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-210E05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-493M07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-422O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-046J19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-062I11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-444M04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-416A23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-514M14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-491G14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-194F10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-060H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-076G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-223P09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191F17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-161E06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-089I05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-019N02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-260M13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-112A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-054E10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186D10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-005K21
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-190O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-201C03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222O08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-303M22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-321M02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-210A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-256E01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-189D01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-276M15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004C01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341G22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082B09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-172O09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175F04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-069B08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-211N08
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-029I02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-300B02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-345O20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-065L05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-173N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-238L14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-093M18
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-303M22.b	B6Ng01-303M22.g
ACC	GA097518	GA097519
length	1,130	1,153
definition	B6Ng01-303M22.b	B6Ng01-303M22.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattcttaaatttcctggattgattttatgaattcattttgatgtaaaa aggctgtagacaatgttcaaatataatcaacagatttggaattgtactca cctagttatcattattatatacaatttacagatctaggcttgggaaatat gtagaagcatctgcattatactttttctaagaattatgtacagccagaat cagtgttgtaaaaggactcaaagcttttgctatgagactagaagcagata tttgactacaaacatcattgttctacaacctgaaacctagaaaacttatg attattgataacttatacattgttgaccatttacttaggttatttctaaa aatgaaaagcatatttgatcctatcatttgtagagatgttaaaatatgga agtgtagattttctttttctttttttgtgttttcacaggacaagctttca gtgaaaaaaataagattaattaattttaggtcttttgtaatcaagagagc ttggtgaagaaaacagtcatgattctatgaaatactaacttttaagtttc tttaaaatgtaaatatgcaaattagacaattacttttagtcacatatgaa atcagatctaatgattaaatctagaagtcatatatgtagcatagtaatta acgacaaagatacttatatgctttctaagtaggcattcattataccagta caaatattcctcatattaagctctaatcagatcatagcatttatgtttta atctgtgatttttttaaaaatatttttattaggtattttccaaatatact ttttcaatgctacccccaaaagtcccccataaccccccccccactcccct acccacccactcatacttttttggctctggcattcccctgtactgggggc atataaagattggaaagtccaatgggcctctctttccagtgatgtccgac taggccatcttttgatacatatgaagctagagtaatgagctcccgggtac tggttagttcataattttgtttcacctataggttgcagatcctttagctc cttgggtactttcttctagctcctcattgggggccctgtgatcaatagat gactggtgagccatcaactttctgtgtttg	gaattcaatgaaaatgatcaaacatccctagttaaatagaatcagtcatc attaaaaaactcacaaagacaacaaaaaaaataaagccagggtcaggtag ttctctcgtctttcaatgaagagataatccaaatagaaataaaagcaata ttgcctgattgatattatatgatcacatatgctgatacagaaaccacata aggactcaacaaagaaacagattatatgccaatttccccccatgaacata gatgcaaaaatgcttaattaaataggtgcaaactggatccaacaacacat taacaggatcatccaccatgatcaatagactacatcccagagatgcagga attattcaatattttaaaaatcagtaaatataatccaccatataaagaaa acaaacaaataaacaaaccaaataatcatcttgctagttgcagaaaaaag ctttcaaaaaatccaacactcttacaaaacaaaactcttgaagagattat ggataaaataaatatacctaaacataataaaaacttgaagaaaactcctg tactttggctttggaggagtaaccattgccagagatagcctgagaacttt gtggtgtttcagtcttcagagagctacagagaagatccagacactgagat gtggtagtctaccttttgcacctcccaacacgtgcaccctctttttaatt gagtattagtgtggaagctttgtcattttttatgcatgtattggttcatt cattcatataaaaataaaggcaattaacagcaaacatagctaatatcaaa taaaatagagagaaacacaaagtaattccactaaaattatgaacaagaca tgggttgtacactctctctacatctattcaatacagtgcttgaagctgta gctagtgcaataagacagctaactgataaatattgaatagaagaagtcta aatatcattataccacatgatatgatagtaaaaatgtgaccctaaatttt ttaccagaaattcatacagctaaaaaaaccacaaccaccaacaacacaaa aagaaacaaaacaaaaaaaaaaaaaccgctttagtgaatgggtagtccaa ggataaatgaaaaaaattcattaagcttcttaattaaatacaaagatttt gat
quality values	Open. Hide. 58 26 25 28 58 58 58 58 58 58 58 54 58 58 58 62 62 62 62 41 30 62 62 41 47 62 62 54 62 48 54 56 51 39 50 37 31 56 62 62 62 62 49 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 59 62 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 42 62 62 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 47 58 58 58 46 58 54 58 58 58 58 58 58 58 58 58 52 58 58 58 58 52 58 58 58 58 58 58 58 49 42 58 54 58 58 58 58 58 58 54 54 58 52 54 54 58 58 58 58 58 53 53 58 54 58 58 58 49 58 58 58 50 58 58 48 51 58 46 54 58 49 58 51 58 58 58 50 58 54 51 58 58 51 58 49 50 58 51 58 58 43 41 41 58 51 52 51 58 53 52 49 52 58 53 58 58 49 49 46 50 53 51 51 49 49 53 53 54 53 54 58 53 39 53 52 58 54 53 53 54 58 52 58 58 50 53 53 50 53 58 53 58 51 58 53 54 49 44 50 52 58 41 50 58 54 41 53 52 58 53 42 54 39 33 58 58 50 46 37 50 44 49 49 51 53 53 53 51 44 54 54 53 42 37 32 49 45 42 45 32 51 27 45 53 53 40 39 52 50 49 53 42 42 34 34 47 50 41 50 32 54 49 52 52 44 39 34 39 53 42 42 42 52 40 47 41 54 39 45 52 42 39 34 51 52 42 38 30 42 35 42 42 45 53 31 35 37 37 54 53 42 40 52 41 49 52 35 34 52 52 40 53 47 34 45 41 28 49 49 49 51 52 45 37 53 53 52 32 42 35 31 49 49 49 52 53 32 45 25 17 23 30 30 26 51 46 30 31 31 30 51 45 43 30 40 31 36 31 51 47 51 31 36 31 31 31 42 30 34 37 13 41 41 41 31 26 51 51 43 43 33 21 46 46 37 31 32 36 33 37 32 46 42 46 46 46 46 46 46 30 30 32 33 24 46 46 32 26 30 24 33 24 30 28 46 26 32 28 39 34 31 34 36 32 32 48 48 48 46 36 31 37 30 32 31 32 26 33 19 26 37 30 29 46 46 19 27 36 26 31 32 31 29 46 39 44 25 16 27 38 34 36 28 47 31 29 24 21 31 18 26 7 43 21 33 34 19 19 24 21 17 20 43 32 15 22 31 31 31 38 35 48 35 18 30 33 28 31 34 33 21 30 22 27 30 17 34 24 29 21 19 13 11 17 29 26 24 32 48 48 21 13 32 24 24 22 13 23 22 30 28 30 31 20 31 19 17 32 37 28 25 18 23 26 24 23 17 26 29 11 26 10 3 16 15 5 17 28 27 21 21 8 8 27 14 17 16 11 6 4 7 23 20 40 47 7 17 7 29 7 23 3 6 29 21 16 12 14 11 11 6 6 27 26 23 13 26 16 28 17 7 34 23 18 12 27 10 7 19 3 5 8 20 12 4 12 7 17 28 14 7 7 6 9 17 23 13 22 18 19 8 18 17 6 11 8 22 27 29 26 9 2 16 11 6 10 4 6 12 15 18 4 7 12 10 7 23 17 16 23 12 12 15 5 4 4 5 4 8 6 13 12 8 4 6 7 17 16 5 4 1 2 5 6 4 16 4 4	Open. Hide. 62 47 56 47 62 47 42 54 62 62 49 51 42 51 44 49 25 44 44 50 56 56 62 62 62 49 49 62 59 62 59 62 59 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 49 49 62 62 49 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 62 62 62 62 62 62 62 62 62 54 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 53 58 58 58 58 58 58 58 58 54 58 54 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 58 54 45 41 54 58 54 58 58 58 52 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 49 58 58 58 58 58 54 51 58 58 58 51 51 58 54 58 54 58 54 50 51 58 58 50 51 49 51 58 58 52 51 58 54 41 58 58 31 54 49 50 48 54 50 58 58 58 49 44 50 52 58 50 39 41 53 52 54 58 53 58 58 20 51 53 52 51 58 58 58 52 58 54 39 58 52 58 51 53 39 53 52 54 53 53 53 52 50 54 34 54 45 49 51 40 51 39 45 54 40 54 54 39 41 40 53 51 32 53 54 31 37 49 51 54 46 34 38 37 54 37 54 51 42 53 45 50 53 45 42 44 54 54 49 49 46 53 42 32 52 54 49 30 54 25 21 38 51 37 52 53 53 51 47 32 51 54 54 46 53 52 54 54 54 42 32 40 42 46 51 47 32 52 32 32 53 45 43 40 53 28 51 33 41 38 27 38 38 49 46 47 32 34 36 45 53 53 51 49 32 45 37 47 31 24 43 52 37 34 31 30 36 36 31 45 41 34 45 37 31 25 41 45 42 35 33 43 31 35 51 46 46 29 43 31 37 29 45 51 20 30 35 36 45 31 35 42 36 38 42 31 46 37 31 32 42 31 32 31 42 31 32 37 32 36 31 28 47 30 27 24 47 47 37 31 42 38 46 38 42 30 31 48 31 30 30 33 32 46 23 27 31 31 32 31 41 32 39 19 24 32 30 48 48 26 21 41 28 31 28 37 31 29 26 33 32 31 17 19 26 20 47 15 33 21 37 24 26 31 21 32 37 32 37 38 37 31 21 31 31 26 42 38 34 32 30 30 37 19 30 30 22 19 30 34 23 36 32 37 31 27 25 42 23 26 31 31 21 33 21 33 38 31 28 24 32 27 19 17 18 15 23 20 21 18 15 24 32 30 21 24 20 26 32 29 26 23 48 31 23 12 6 7 9 27 23 16 14 32 28 29 25 26 25 20 27 32 33 22 43 11 12 23 32 27 21 19 14 5 5 5 20 12 10 21 11 22 17 22 20 14 16 20 28 16 28 27 28 27 34 34 34 27 13 25 16 26 28 13 34 15 23 9 40 15 26 38 34 34 38 26 18 13 16 7 5 3 21 14 8 10 20 20 28 17 25 8 27 27 27 16 28 29 26 29 26 17 13 11 3 3 2 7 14 14 11 7 12 9 14 8 3 11 14 3 4 3 19 20 17 17 22 9 3 10 19 3 9 15 15 13 17 28 28 28 17 17 29 28 17 17 28 26 12 9 7 6 9 17 29 17 8 7 5 6 2 2 1 3 17 9 2 5 2 3 1 5 10 7 8 5 8 2 2 12 11 9 5 12 17 17 29 17 25 13 5 6 7 18 4 4 4 7 8 20 6 7 11 5 15 13 5 6 5 4 16 9 12 2 1 3 13 3 1 1 14 11 9 4 5 2 2

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_116404684_116405807
seq2: B6Ng01-303M22.b_46_1175

seq1  GAATTCTTAAATTTCCTGGATTGATTTTATGAATTCATTTTGATGTAAAA  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTTAAATTTCCTGGATTGATTTTATGAATTCATTTTGATGTAAAA  50

seq1  AGGCTGTAGACAATGTTCAAATATAATCAACAGATTTGGAATTGTACTCA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGCTGTAGACAATGTTCAAATATAATCAACAGATTTGGAATTGTACTCA  100

seq1  CCTAGTTATCATTATTATATACAATTTACAGATCTAGGCTTGGGAAATAT  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTAGTTATCATTATTATATACAATTTACAGATCTAGGCTTGGGAAATAT  150

seq1  GTAGAAGCATCTGCATTATACTTTTTCTAAGAATTATGTACAGCCAGAAT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTAGAAGCATCTGCATTATACTTTTTCTAAGAATTATGTACAGCCAGAAT  200

seq1  CAGTGTTGTAAAAGGACTCAAAGCTTTTGCTATGAGACTAGAAGCAGATA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGTGTTGTAAAAGGACTCAAAGCTTTTGCTATGAGACTAGAAGCAGATA  250

seq1  TTTGACTACAAACATCATTGTTCTACAACCTGAAACCTAGAAAACTTATG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGACTACAAACATCATTGTTCTACAACCTGAAACCTAGAAAACTTATG  300

seq1  ATTATTGATAACTTATACATTGTTGACCATTTACTTAGGTTATTTCTAAA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTATTGATAACTTATACATTGTTGACCATTTACTTAGGTTATTTCTAAA  350

seq1  AATGAAAAGCATATTTGATCCTATCATTTGTAGAGATGTTAAAATATGGA  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGAAAAGCATATTTGATCCTATCATTTGTAGAGATGTTAAAATATGGA  400

seq1  AGTGTAGATTTTCTTTTTCTTTTTTTGTGTTTTCACAGGACAAGCTTTCA  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGTAGATTTTCTTTTTCTTTTTTTGTGTTTTCACAGGACAAGCTTTCA  450

seq1  GTGAAAAAAATAAGATTAATTAATTTTAGGTCTTTTGTAATCAAGAGAGC  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAAAAAAATAAGATTAATTAATTTTAGGTCTTTTGTAATCAAGAGAGC  500

seq1  TTGGTGAAGAAAACAGTCATGATTCTATGAAATACTAACTTTTAAGTTTC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTGGTGAAGAAAACAGTCATGATTCTATGAAATACTAACTTTTAAGTTTC  550

seq1  TTTAAAATGTAAATATGCAAATTAGACAATTACTTTTAGTCACATATGAA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTAAAATGTAAATATGCAAATTAGACAATTACTTTTAGTCACATATGAA  600

seq1  ATCAGATCTAATGATTAAATCTAGAAGTCATATATGTAGCATAGTAATTA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCAGATCTAATGATTAAATCTAGAAGTCATATATGTAGCATAGTAATTA  650

seq1  ACGACAAAGATACTTATATGCTTTCTAAGTAGGCATTCATTATACCAGTA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACGACAAAGATACTTATATGCTTTCTAAGTAGGCATTCATTATACCAGTA  700

seq1  CAAATATTCCTCATATTAAGCTCTAATCAGATCATAGCATTTATGTTTTA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAATATTCCTCATATTAAGCTCTAATCAGATCATAGCATTTATGTTTTA  750

seq1  ATCTGTGATTTTTTTAAAAATATTTTTATTAGGTATTTTCCAAATATAC-  799
      ||||||||||||||||||||||||||||||||||||||||||||||||| 
seq2  ATCTGTGATTTTTTTAAAAATATTTTTATTAGGTATTTTCCAAATATACT  800

seq1  TTTTCAATGCTA-CCCCAAAAGTCCCCCATAA-CCCCCCCCCACTCCCCT  847
      |||||||||||| ||||||||||||||||||| |||||||||||||||||
seq2  TTTTCAATGCTACCCCCAAAAGTCCCCCATAACCCCCCCCCCACTCCCCT  850

seq1  ACCCACCCACTCATACTTTTTTGGCTCTGGCATTCCCCTGTACT-GGGGC  896
      |||||||||||||||||||||||||||||||||||||||||||| |||||
seq2  ACCCACCCACTCATACTTTTTTGGCTCTGGCATTCCCCTGTACTGGGGGC  900

seq1  ATATAAAGATTGG-AAGTCCAATGGGCCTCTCTTTCCAGTGATGTCCGAC  945
      ||||||||||||| ||||||||||||||||||||||||||||||||||||
seq2  ATATAAAGATTGGAAAGTCCAATGGGCCTCTCTTTCCAGTGATGTCCGAC  950

seq1  TAGGCCATCTTTTGATACATATGAAGCTAGAGTAATGAGCTCCCGGGTAC  995
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGGCCATCTTTTGATACATATGAAGCTAGAGTAATGAGCTCCCGGGTAC  1000

seq1  TGGTTAGTTCATAATTTTGTTCCACCTATAGGTTGCAGATCCCTTTAGCT  1045
      ||||||||||||||||||||| |||||||||||||||||| |||||||||
seq2  TGGTTAGTTCATAATTTTGTTTCACCTATAGGTTGCAGAT-CCTTTAGCT  1049

seq1  CCTTGGGTACTTTC-TCTAGCTCCTCCATTGGGGGCCCTGTGATCCAATA  1094
      |||||||||||||| |||||||||| |||||||||||||||||| |||||
seq2  CCTTGGGTACTTTCTTCTAGCTCCT-CATTGGGGGCCCTGTGAT-CAATA  1097

seq1  GATGACT-GTGAG-CATCCAC-TTCTGTGTTTG  1124
      ||||||| ||||| |||| || |||||||||||
seq2  GATGACTGGTGAGCCATCAACTTTCTGTGTTTG  1130

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information