MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-304K16
Chromosome	X (Build37)
Map Location	15,809,761 - 15,810,908
singlet/doublet	singlet
Overlap gene	none
Upstream gene	none
Downstream gene	LOC100043949, LOC100043950, Cypt6, LOC100038939, LOC668993, Maoa, Maob, Ndph, LOC100043063, Efhc2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100043949 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043949
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein pseudo : _no_value

name	LOC100043950 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043950
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Cypt6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:66742 MGI:3616444
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100038939 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100038939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	LOC668993 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:668993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 22 Proteins pseudo : _no_value

name	Maoa (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17161 MGI:96915
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Maob (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:109731 MGI:96916
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Ndph (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:17986 MGI:102570
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100043063 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100043063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	Efhc2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74405 MGI:1921655
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Cypt6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:114842378 GeneID:66742 MGI:3616444
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : cysteine-rich perinuclear theca 6 transcript_id : NM_025738.2

name	LOC100038939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270941 GeneID:100038939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038939, transcript variant 1 transcript_id : XM_001471577.1

name	LOC100038939 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270939 GeneID:100038939
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypothetical protein LOC100038939, transcript variant 2 transcript_id : XM_001471579.1

name	Maoa (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:84579838 GeneID:17161 MGI:96915
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoamine oxidase A transcript_id : NM_173740.2

name	Maob (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:27370153 GeneID:109731 MGI:96916
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : monoamine oxidase B transcript_id : NM_172778.1

name	Ndph (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:61098076 GeneID:17986 MGI:102570
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Norrie disease homolog transcript_id : NM_010883.2

name	LOC100043063 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149270999 GeneID:100043063
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : hypothetical protein LOC100043063 transcript_id : XM_001477606.1

name	Efhc2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348726 GeneID:74405 MGI:1921655
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : EF-hand domain (C-terminal) containing 2 transcript_id : NM_028916.2

name	Cypt6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:114842379 GeneID:66742 MGI:3616444
definition	GO_component : GO:0001669 - acrosome [Evidence IDA] codon_start : 1 note : basic protein CKT1R3; cysteine-rich postacrosomal PT protein; cysteine-rich perinuclear theca protein 5; cysteine-rich perinuclear theca protein 1; cysteine-rich perinuclear theca protein 6; cysteine-rich postacrosomal perinuclear theca protein; cysteine-rich perinuclear theca 1 product : cysteine-rich perinuclear theca 5 protein_id : NP_080014.2

name	LOC100038939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270942 GeneID:100038939
definition	codon_start : 1 product : hypothetical protein isoform 1 protein_id : XP_001471627.1

name	LOC100038939 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149270940 GeneID:100038939
definition	codon_start : 1 product : hypothetical protein isoform 2 protein_id : XP_001471629.1

name	Maoa (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:84579839 CCDS:CCDS30033.1 GeneID:17161 MGI:96915
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA]; GO:0005739 - mitochondrion [Evidence TAS] [Evidence IDA] GO_function : GO:0008131 - amine oxidase activity [Evidence IEA]; GO:0016491 - oxidoreductase activity [Evidence IEA] GO_process : GO:0006584 - catecholamine metabolism [Evidence IEA]; GO:0042420 - dopamine catabolism [Evidence IDA]; GO:0006118 - electron transport [Evidence IEA]; GO:0042135 - neurotransmitter catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : monoamine oxidase A protein_id : NP_776101.2

name	Maob (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27370154 GeneID:109731 MGI:96916
definition	GO_component : GO:0016020 - membrane [Evidence IEA]; GO:0005743 - mitochondrial inner membrane [Evidence IDA] codon_start : 1 exception : mismatches in translation product : amine oxidase (flavin-containing) protein_id : NP_766366.1

name	Ndph (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6754808 CCDS:CCDS30034.1 GeneID:17986 MGI:102570
definition	GO_process : GO:0001890 - placenta development [Evidence IMP] codon_start : 1 product : Norrie disease homolog protein_id : NP_035013.1

name	LOC100043063 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271000 GeneID:100043063
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477656.1

name	Efhc2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58037365 GeneID:74405 MGI:1921655
definition	codon_start : 1 exception : mismatches in translation product : EF-hand domain (C-terminal) containing 2 protein_id : NP_083192.1

name	LOC100043949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043949
definition	number : 3 pseudo : _no_value

name	LOC100043949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043949
definition	number : 2 pseudo : _no_value

name	LOC100043949 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043949
definition	number : 1 pseudo : _no_value

name	LOC100043950 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100043950
definition	number : 1 pseudo : _no_value

name	LOC668993 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149270998 GeneID:668993
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 10 ESTs, 22 Proteins product : similar to casein kinase II alpha subunit pseudo : _no_value transcript_id : XR_033273.1

clone name	MSMg01-410M24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-167O06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-482C10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-172E21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-303F07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-083D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349N24
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-437C09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413K11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-343C07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-234F16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-325D21
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-546G08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-513H05
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-425J15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-438M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-359P16
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-518F06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439L04
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-372G18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-086N13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-540B20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-404E10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-413P17
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-106E02
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492E13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-547L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-332L07
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-524M20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-518C06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-394G05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-429A11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-004G03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-222L22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-291B16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-120I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-243J20
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-009B15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-262K13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-063O18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-152K09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-319H12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-185N05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-151H10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-128N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-034I17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-170G17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-018H24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-129C23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-151B14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-003B01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-334N14
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-304K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-306D16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-257C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-123A02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-049F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-192N17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-218F12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-097C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097B04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-063L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204O05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-342P02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-269C13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-237I05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-263F01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-153N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-228P11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-197N15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-072E19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-205E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-034O10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-066P04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-139L23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-110N22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-304K16.b	B6Ng01-304K16.g
ACC	GA098165	GA098166
length	1,164	1,155
definition	B6Ng01-304K16.b	B6Ng01-304K16.g
singlet/doublet	---	singlet
BLAST hit	no hit data	unique
sequence	gaattctcaatagaggaatctcaaatgattgaaaaaaaaaaaaaacttaa ggaaatgttcaacatctttagccatcatggaagtgcaattcaatggaggt acaattcaaaacttctttgagattctatctattctacaggttcaatgcaa tccccatcaaaattccaactcaattcttcaacgaattagaaggagcaatt tgcaaattcatcgggaataacaaaaaacctaggatagcaaaaagtcttct caaggataaaagaacctctggtggaatcaccatgcctgacctaaagcttt actacagagcaattgtgataaaaactgcatggtactggtatagagacaga caagtagaccaatggaatagaattgaagacccagaaatgaacccacacac ctatggtcacttgatcttcgacaagggagctaaaaccatccagtggaaga aagacagcattttcaacaattggtgctggcacaactggttgttatcatgt agaagaatgcaaatcgatccatacttatctccttgtactaaggtcaaatc taagtggatcaaagaacttcacataaaaccagagacactgaaacttatag aggagaaagtggggaaaagccttgaagatgtgggctcaggggaaaaattc ctgaacagaacagcaatggcatgtgctgtaagatcgagaattgacaaatg ggacctaatgaaactccaaagtttctgcaaggcaaaagacaccgtcaata agacaaaaagaccaccaacagattgggaaaggatctttacctatcctaaa tcagatagggggctaatatccaacatatataaagaactcaagaaggtgga cttcagaaaatcgaacaaccccatcaaaaaatggggctcagaactgaaca aagaattctcacctgaggaataccgaatggcagagagcacctgaaaaatg ttcacatccttaatcatcagggaaatgcaaatcaaacacctgagattcca cctgtcagatagtaagatcactaacacagttgacatctcatgtgactgac agcaagggaacatttctcatgcatgggagtctactaatacactaagaatc aatatgtagtttctcgagatgatcaatcacctcaagatcagctatatcga ttctctggcacgct	gaattctagtgctgaagaatttcttagcctttgtaccagtagtctgttga agagatctctcaccctcccttgttatctgaaagaactacatactaatgtc atcagggcactggtttgagacaaagatagaatgtagatggggattcatga gaaggggcagaggtagatgtgaagtttatagaaggcatgagaaaatcttc gagggacggatggctacagaatgcaggaaatgagattagcttgatacctc tcaccttactaggacttctgggaaaagaggagcatgcctcctcttgggac atttggacattggttgacaggacattctccgtttcttcttcagcttggat tttgtggctgctcctgccttagcactaggcttgcaggctttcttggccac ccatgccatattggagctctctcagggactggccccaaagctctgagcat cctgcttatctccctgtcagtacaatggtgagacacactccacagttttg agtggtcagaaaagtcctcgctagccaatggcagctaaggagtggctgag acctcacaaagctctgttttttgaggatatcttacctatcgcagatatgg tttgaaggcttgcaagtgcataggtcatgtaatgtgtgcctgctaccatg ggccctgaatctatgctcattaatcctgtaattcttttaaaatataatct cccagttaaaccctttcctttatacattgactggtcatgacatctcttca cagcaaatgaaaaataacttagactgatgagcaatgggaagttgatatga taaaaatgtcatatctatgtacataaaattatcacagaattaatttttat ggaaaatgaacattgctgaatggtattatgcagaatgaaaatgacaaaaa agaatcagtaaaatttgaggacacatcaacagaatttgtcccacttaatc taagataagatattctgtattttatgttacgtgtggaaggaatcatgtct gcgtgcatttcatgcagagctccatgagggcagaaaagggtattagaatc atatgtactgaattaatagaattatctgttgtgttttcacatatgtgctt gagaataaaatcctaggaattcaaagcaaacctgtttattcctaattgca tatat
quality values	Open. Hide. 34 31 27 31 62 62 62 31 32 54 62 47 62 62 62 62 62 20 38 62 62 59 62 62 62 62 62 35 46 62 62 23 19 23 23 23 18 23 27 27 34 48 43 43 54 59 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 59 62 62 62 62 62 62 62 62 59 59 62 62 49 59 62 43 33 43 48 56 59 59 59 62 62 62 59 59 50 49 49 59 59 62 62 62 62 62 59 62 62 62 59 62 59 62 62 62 56 56 56 56 59 62 59 59 40 54 56 59 62 59 59 62 59 59 59 62 62 62 54 59 59 62 62 62 62 54 62 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 54 62 59 59 59 62 59 59 59 62 59 62 62 59 62 62 62 62 59 36 62 62 59 62 62 59 62 56 59 59 59 51 51 41 30 34 28 50 35 50 34 38 48 46 56 59 54 62 62 59 59 62 62 62 50 50 50 56 50 56 59 59 50 62 54 56 54 62 62 62 62 62 62 56 56 56 59 59 59 59 56 56 51 59 62 54 54 62 62 59 56 54 50 62 59 59 62 50 50 43 56 59 46 62 59 62 62 62 62 59 62 62 59 62 62 62 62 59 62 59 62 62 62 62 56 59 56 50 56 50 48 43 49 43 40 50 41 51 62 56 62 62 59 62 62 62 56 54 62 62 59 62 62 62 62 62 62 62 59 56 62 62 62 56 59 62 62 62 62 62 62 62 62 56 62 59 59 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 56 45 49 59 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 51 56 56 51 56 56 62 47 62 62 62 62 62 56 54 62 62 62 62 62 62 47 51 56 56 50 51 62 62 62 62 56 62 62 62 62 56 43 62 56 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 47 50 62 52 52 62 62 62 62 52 46 41 46 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 52 58 58 52 58 40 44 58 58 54 58 58 58 58 54 52 54 54 54 47 54 52 52 54 54 54 58 52 52 52 52 52 52 58 54 54 58 54 54 58 58 58 52 54 54 58 58 58 54 58 49 58 54 54 58 58 41 58 49 54 58 58 37 49 42 48 50 53 53 50 49 50 51 52 51 54 54 58 49 41 50 58 40 46 50 50 48 50 51 50 50 44 48 51 48 51 51 58 51 53 58 51 58 50 58 58 46 49 51 58 58 58 51 58 58 58 50 50 48 44 50 50 49 49 50 37 51 32 49 50 58 54 51 50 53 52 49 28 51 58 50 58 58 58 58 40 41 51 38 50 51 54 58 39 39 53 37 58 40 40 53 38 52 52 37 46 54 54 40 30 47 54 45 50 50 44 54 37 38 41 32 51 35 50 40 38 32 54 32 39 52 53 32 29 31 49 29 38 54 49 44 33 31 22 31 35 45 52 53 44 51 31 40 51 32 38 21 47 47 32 53 54 40 38 40 45 37 25 32 32 47 19 32 53 52 53 32 36 30 28 21 40 34 31 45 31 38 45 31 38 31 45 31 29 40 53 53 43 32 37 24 31 29 31 40 31 26 33 31 35 37 26 30 33 51 31 37 51 31 30 51 18 31 28 30 51 31 23 25 31 31 31 31 29 31 34 29 46 23 38 32 28 12 27 21 25 26 48 46 46 33 21 31 19 30 31 31 38 31 33 17 24 23 28 33 31 43 31 43 29 47 31 29 32 26 25 31 30 21 18 31 38 30 5 9 13 31 34 23 18 13 15 29 21 14 46 47 48 26 31 24 12 39 34 34 23 19 30 38 31 39 18 31 29 32 44 47 41 41 29 21 29 44 44 31 14 31 31 32 17 32 25 15 31 38 26 26 29 21 28 23 16 31 24 31 27 20 32 31 28 21 14 12 14 16 16 21 33 27 31 31 21 15 10 19 21 22 17 19 12 30 21 37 6 13 6 21 10 14 20 16 21 29 43 47 43 31 28 19 18 30 15 15 4 12 31 23 20 16 21 11 29 28 28 20 28 24 15 21 34 10 22 34 16 26 28 21 17 27 19 28 14 17 34 20 6 5 5 5 4 17 29 9 21 11 13 19 24 14 10 14 13 23 13 22 16 6 20 3 5 4 6 3 6 13 29 20 20 20 27 20 26 13 22 9 11 3 3 2 7 16 23 10 16 20 13 18 20 16 10 5 2 3 4 9 13 14 10 16 20 16 18 6 7 22 29 14 3 7 8 13 20 30 19 13 11 12 2 3 4 13 4 10 23 28 7 12 6 11 7 7 5 3 3 3 5 4 3 3 4 18 18 9 9 15 3 12 5 6 10 4 6 13 10 17 5 6 4 5 21 5 8 3 1 3 8 2 5 8 3 3 2 4 8 9 15 8 4 14 6 6 4 11 6 6 22 17 16 5 8 10 5 5 9 16 8 3 1 3 4 5 4 4 4 4 10 2 2 3 2 1 1 2	Open. Hide. 62 47 51 47 62 62 62 54 62 62 34 18 18 18 19 13 18 36 24 29 28 28 45 39 38 54 54 62 62 62 62 62 62 59 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 38 49 43 43 46 36 56 49 48 43 49 42 49 54 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 54 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 54 54 54 49 49 54 54 36 49 43 50 34 50 59 46 35 33 48 51 62 62 62 62 62 62 59 59 62 54 54 62 59 62 62 41 41 43 35 34 40 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 59 62 62 62 62 62 62 62 56 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 54 54 54 62 62 62 62 54 54 62 62 54 62 62 62 62 59 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 59 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 43 46 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 38 22 22 20 36 22 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 47 62 62 38 43 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 52 54 58 54 58 58 58 58 58 58 58 58 58 58 52 54 58 54 58 58 58 58 54 54 58 58 58 58 54 58 58 58 54 58 41 47 58 58 58 58 54 54 54 58 58 54 58 54 58 58 52 58 58 45 54 58 58 54 27 38 39 58 58 58 52 54 39 52 54 51 54 58 58 58 58 58 58 58 58 58 58 46 51 40 58 45 26 50 51 53 54 44 47 39 38 48 51 54 58 51 58 54 46 51 51 46 58 58 58 50 58 58 58 51 51 35 46 42 58 58 58 48 50 50 49 52 58 49 50 51 51 39 58 51 52 53 53 58 53 51 58 51 58 50 53 54 58 43 41 44 58 58 54 30 31 42 41 50 58 58 51 44 39 39 43 50 52 35 40 52 42 53 52 58 52 52 41 38 51 49 54 50 52 52 51 44 54 41 49 27 41 51 53 37 54 39 44 32 54 54 42 42 35 49 39 39 49 53 47 40 34 22 15 44 54 44 25 33 25 42 27 15 35 54 40 45 53 33 54 40 52 39 30 45 32 44 32 46 31 32 26 49 33 18 40 34 37 51 33 34 29 52 39 45 53 45 53 39 24 32 31 40 33 31 49 41 31 52 52 51 49 51 19 21 36 32 33 53 42 53 32 32 24 32 53 33 36 32 34 15 33 25 41 22 36 49 45 42 35 32 32 43 31 30 28 31 31 31 42 43 42 47 51 51 30 32 43 31 31 31 31 30 39 42 31 30 31 32 30 22 31 23 41 28 51 48 29 29 33 28 31 32 19 24 19 25 24 25 30 31 21 29 27 47 47 48 42 31 31 31 31 31 48 46 40 23 31 32 20 25 18 22 16 30 31 31 31 36 37 32 28 32 26 22 25 44 31 32 31 29 16 11 46 32 27 31 31 47 46 34 27 29 30 30 36 46 47 46 46 32 23 32 25 34 32 24 33 19 21 47 47 20 15 48 33 24 17 14 10 11 9 9 17 18 42 33 16 16 27 15 21 27 23 22 44 24 8 17 31 38 17 17 19 30 29 23 18 32 34 32 23 22 13 21 19 18 33 18 24 12 7 7 24 32 32 33 22 23 27 48 48 23 10 10 22 16 20 32 24 10 16 20 17 18 22 13 8 16 12 13 25 19 15 15 22 21 14 13 17 28 27 12 15 20 27 20 30 47 27 27 16 24 26 24 19 10 14 7 20 7 5 18 10 13 14 23 13 34 19 8 14 16 17 34 22 11 4 34 17 5 5 4 15 8 5 7 19 19 27 24 11 8 7 7 8 11 5 17 16 7 17 17 15 7 4 6 12 8 7 17 12 6 12 11 13 5 11 7 5 8 5 5 5 29 28 20 10 7 7 7 6 4 11 13 11 14 14 5 9 8 11 4 17 14 11 12 28 28 7 1 11 13 4 8 6 8 21 11 19 10 6 3 20 3 1 1 3 3 17 4 4 5 5 3 3 2 3 4 11 4 8 6 16 17 4 5 6 12 5 4 4 8 10 7

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_15809761_15810908
seq2: B6Ng01-304K16.g_67_1221 (reverse)

seq1  ATATATGCATTTA-GAATAAACAGTTTTCCTTTTGAAT--CT-GGGTTTT  46
      ||||||||| ||| |||||||||| ||| | |||||||  || || ||||
seq2  ATATATGCAATTAGGAATAAACAGGTTTGC-TTTGAATTCCTAGGATTTT  49

seq1  ATTCTC-AGCACATATGTGAAAACAC-ACAGATAATTCTA-TAATTCAGT  93
      |||||| ||||||||||||||||||| ||||||||||||| |||||||| 
seq2  ATTCTCAAGCACATATGTGAAAACACAACAGATAATTCTATTAATTCAG-  98

seq1  TACATATGA-TCTAATACCCTTTTCTGCCCTCATGGAGCTCTGCATGAAA  142
      ||||||||| ||||||||||||||||||||||||||||||||||||||||
seq2  TACATATGATTCTAATACCCTTTTCTGCCCTCATGGAGCTCTGCATGAAA  148

seq1  TGCACGCAGACATGATTCC-TCCACACGTAACATAAAATACAGAATATCT  191
      ||||||||||||||||||| ||||||||||||||||||||||||||||||
seq2  TGCACGCAGACATGATTCCTTCCACACGTAACATAAAATACAGAATATCT  198

seq1  TATCTTAGATTAAGTGGGACAAATTCTGTTGATGTGTCCTCAAATTTTAC  241
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATCTTAGATTAAGTGGGACAAATTCTGTTGATGTGTCCTCAAATTTTAC  248

seq1  TGATTCTTTTTTGTCATTTTCATTCTGCATAATACCATTCAGCAATGTTC  291
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGATTCTTTTTTGTCATTTTCATTCTGCATAATACCATTCAGCAATGTTC  298

seq1  ATTTTCCATAAAAATTAATTCTGTGATAATTTTATGTACATAGATATGAC  341
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTCCATAAAAATTAATTCTGTGATAATTTTATGTACATAGATATGAC  348

seq1  ATTTTTATCATATCAACTTCCCATTGCTCATCAGTCTAAGTTATTTTTCA  391
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTTTTATCATATCAACTTCCCATTGCTCATCAGTCTAAGTTATTTTTCA  398

seq1  TTTGCTGTGAAGAGATGTCATGACCAGTCAATGTATAAAGGAAAGGGTTT  441
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTTGCTGTGAAGAGATGTCATGACCAGTCAATGTATAAAGGAAAGGGTTT  448

seq1  AACTGGGAGATTATATTTTAAAAGAATTACAGGATTAATGAGCATAGATT  491
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGGGAGATTATATTTTAAAAGAATTACAGGATTAATGAGCATAGATT  498

seq1  CAGGGCCCATGGTAGCAGGCACACATTACATGACCTATGCACTTGCAAGC  541
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAGGGCCCATGGTAGCAGGCACACATTACATGACCTATGCACTTGCAAGC  548

seq1  CTTCAAACCATATCTGCGATAGGTAAGATATCCTCAAAAAACAGAGCTTT  591
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTTCAAACCATATCTGCGATAGGTAAGATATCCTCAAAAAACAGAGCTTT  598

seq1  GTGAGGTCTCAGCCACTCCTTAGCTGCCATTGGCTAGCGAGGACTTTTCT  641
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTGAGGTCTCAGCCACTCCTTAGCTGCCATTGGCTAGCGAGGACTTTTCT  648

seq1  GACCACTCAAAACTGTGGAGTGTGTCTCACCATTGTACTGACAGGGAGAT  691
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GACCACTCAAAACTGTGGAGTGTGTCTCACCATTGTACTGACAGGGAGAT  698

seq1  AAGCAGGATGCTCAGAGCTTTGGGGCCAGTCCCTGAGAGAGCTCCAATAT  741
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGCAGGATGCTCAGAGCTTTGGGGCCAGTCCCTGAGAGAGCTCCAATAT  748

seq1  GGCATGGGTGGCCAAGAAAGCCTGCAAGCCTAGTGCTAAGGCAGGAGCAG  791
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGCATGGGTGGCCAAGAAAGCCTGCAAGCCTAGTGCTAAGGCAGGAGCAG  798

seq1  CCACAAAATCCAAGCTGAAGAAGAAACGGAGAATGTCCTGTCAACCAATG  841
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCACAAAATCCAAGCTGAAGAAGAAACGGAGAATGTCCTGTCAACCAATG  848

seq1  TCCAAATGTCCCAAGAGGAGGCATGCTCCTCTTTTCCCAGAAGTCCTAGT  891
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCAAATGTCCCAAGAGGAGGCATGCTCCTCTTTTCCCAGAAGTCCTAGT  898

seq1  AAGGTGAGAGGTATCAAGCTAATCTCATTTCCTGCATTCTGTAGCCATCC  941
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGGTGAGAGGTATCAAGCTAATCTCATTTCCTGCATTCTGTAGCCATCC  948

seq1  GTCCCTCGAAGATTTTCTCATGCCTTCTATAAACTTCACATCTACCTCTG  991
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCCTCGAAGATTTTCTCATGCCTTCTATAAACTTCACATCTACCTCTG  998

seq1  CCCCTTCTCATGAATCCCCATCTACATTCTATCTTTGTCTCAAACCAGTG  1041
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCCTTCTCATGAATCCCCATCTACATTCTATCTTTGTCTCAAACCAGTG  1048

seq1  CCCTGATGACATTAGTATGTAGTTCTTTCAGATAACAAGGGAGGGTGAGA  1091
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCCTGATGACATTAGTATGTAGTTCTTTCAGATAACAAGGGAGGGTGAGA  1098

seq1  GATCTCTTCAACAGACTACTGGTACAAAGGCTAAGAAATTCTTCAGCACT  1141
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATCTCTTCAACAGACTACTGGTACAAAGGCTAAGAAATTCTTCAGCACT  1148

seq1  AGAATTC  1148
      |||||||
seq2  AGAATTC  1155

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information