MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-308E13
Chromosome	X (Build37)
Map Location	49,493,311 - 49,671,840
singlet/doublet	doublet
Overlap gene	Gpc4, Gpc3
Upstream gene	Mbnl3, LOC665866, LOC385356, Hs6st2, Usp26, LOC100040479, LOC665888, 1700080O16Rik, LOC100040495
Downstream gene	Kis2, LOC100041925, LOC665929, 6330534C20Rik, LOC624936, LOC546298, LOC100040569, Phf6, Hprt1, C430049B03Rik, Plac1, 4632404H22Rik, 4930432H15Rik, LOC385527
Link	Open Mouse BAC browser

Click to get alignment info.

name	Mbnl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171170 MGI:2444912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC385356 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 45 ESTs, 54 Proteins pseudo : _no_value

name	Hs6st2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50786 MGI:1354959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Usp26 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:83563 MGI:1933247
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040479 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs

name	LOC665888 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665888
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	1700080O16Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:74279 MGI:1921529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs

name	LOC100040495 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein

name	Gpc4 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14735 MGI:104902
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Gpc3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:14734 MGI:104903
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Kis2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:751866 MGI:3617487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041925 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 235 ESTs, 9 Proteins pseudo : _no_value

name	LOC665929 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665929
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 7 Proteins pseudo : _no_value

name	6330534C20Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:434778 MGI:3588225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC624936 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:624936
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 48 Proteins pseudo : _no_value

name	LOC546298 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:546298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 mRNAs, 2934 ESTs, 9 Proteins

name	LOC100040569 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs

name	Phf6 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70998 MGI:1918248
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Hprt1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:15452 MGI:96217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	C430049B03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72575 MGI:1924903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs

name	Plac1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:56096 MGI:1926287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4632404H22Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:78755 MGI:1926005
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	4930432H15Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:73866 MGI:1921116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385527 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385527
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 8 Proteins pseudo : _no_value

name	Mbnl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043949 GeneID:171170 MGI:2444912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : muscleblind-like 3 (Drosophila) transcript_id : NM_134163.4

name	Hs6st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116284407 GeneID:50786 MGI:1354959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 2 transcript_id : NM_001077202.1

name	Hs6st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116284405 GeneID:50786 MGI:1354959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 2 transcript_id : NM_015819.3

name	Usp26 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:13878220 GeneID:83563 MGI:1933247
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : ubiquitin specific peptidase 26 transcript_id : NM_031388.1

name	LOC100040479 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271539 GeneID:100040479
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 ESTs product : hypothetical protein LOC100040479 transcript_id : XM_001474763.1

name	1700080O16Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407367 GeneID:74279 MGI:1921529
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 2 ESTs product : RIKEN cDNA 1700080O16 gene transcript_id : XM_135858.3

name	LOC100040495 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271541 GeneID:100040495
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 Protein product : similar to 1700080O16Rik protein transcript_id : XM_001474805.1

name	Gpc4 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:6680058 GeneID:14735 MGI:104902
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 4 transcript_id : NM_008150.1

name	Gpc3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:31980679 GeneID:14734 MGI:104903
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : glypican 3 transcript_id : NM_016697.2

name	6330534C20Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:85702180 GeneID:434778 MGI:3588225
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 6330534C20 gene transcript_id : NM_001034059.1

name	LOC546298 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271562 GeneID:546298
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 33 mRNAs, 2934 ESTs, 9 Proteins product : similar to ribosomal protein S2 transcript_id : XM_001477049.1

name	LOC100040569 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271543 GeneID:100040569
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 7 ESTs product : hypothetical protein LOC100040569 transcript_id : XM_001474921.1

name	Phf6 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33563291 GeneID:70998 MGI:1918248
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : PHD finger protein 6 transcript_id : NM_027642.1

name	Hprt1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:96975137 GeneID:15452 MGI:96217
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : hypoxanthine guanine phosphoribosyl transferase 1 transcript_id : NM_013556.2

name	C430049B03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:94407371 GeneID:72575 MGI:1924903
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 mRNA, 3 ESTs product : RIKEN cDNA C430049B03 gene transcript_id : XM_980571.1

name	Plac1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142360115 GeneID:56096 MGI:1926287
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : placental specific protein 1 transcript_id : NM_019538.4

name	4632404H22Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142348852 GeneID:78755 MGI:1926005
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4632404H22 gene transcript_id : NM_030167.2

name	4930432H15Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:131888240 GeneID:73866 MGI:1921116
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 4930432H15 gene transcript_id : NM_028671.2

name	Mbnl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527398 GeneID:171170 MGI:2444912
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045662 - negative regulation of myoblast differentiation [Evidence IDA] codon_start : 1 product : muscleblind-like 3 protein_id : NP_598924.1

name	Hs6st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116284408 GeneID:50786 MGI:1354959
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : heparan sulfate 6-O-sulfotransferase 2 isoform 1 protein_id : NP_001070670.1

name	Hs6st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116284406 GeneID:50786 MGI:1354959
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : heparan sulfate 6-O-sulfotransferase 2 isoform 2 protein_id : NP_056634.3

name	Usp26 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:13878221 CCDS:CCDS30122.1 GeneID:83563 MGI:1933247
definition	GO_function : GO:0004197 - cysteine-type endopeptidase activity [Evidence IEA]; GO:0008234 - cysteine-type peptidase activity [Evidence IEA]; GO:0016787 - hydrolase activity [Evidence IEA]; GO:0008233 - peptidase activity [Evidence IEA]; GO:0004221 - ubiquitin thiolesterase activity [Evidence IEA] GO_process : GO:0006512 - ubiquitin cycle [Evidence IEA]; GO:0006511 - ubiquitin-dependent protein catabolism [Evidence IEA] codon_start : 1 exception : mismatches in translation product : ubiquitin specific protease 26 protein_id : NP_113565.1

name	LOC100040479 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271540 GeneID:100040479
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474813.1

name	LOC100040495 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271542 GeneID:100040495
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474855.1

name	1700080O16Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407368 GeneID:74279 MGI:1921529
definition	codon_start : 1 product : hypothetical protein LOC74279 protein_id : XP_135858.2

name	Gpc4 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:6680059 CCDS:CCDS30124.1 GeneID:14735 MGI:104902
definition	GO_component : GO:0005578 - extracellular matrix (sensu Metazoa) [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] codon_start : 1 exception : mismatches in translation product : glypican 4 protein_id : NP_032176.1

name	Gpc3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:31980680 CCDS:CCDS30125.1 GeneID:14734 MGI:104903
definition	GO_component : GO:0005887 - integral to plasma membrane [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0048503 - GPI anchor binding [Evidence IEA] GO_process : GO:0008285 - negative regulation of cell proliferation [Evidence IGI]; GO:0045926 - negative regulation of growth [Evidence IMP]; GO:0009887 - organ morphogenesis [Evidence IMP]; GO:0030513 - positive regulation of BMP signaling pathway [Evidence IMP]; GO:0001658 - ureteric bud branching [Evidence IGI] codon_start : 1 product : glypican 3 protein_id : NP_057906.2

name	6330534C20Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:85702181 CCDS:CCDS30126.1 GeneID:434778 MGI:3588225
definition	codon_start : 1 product : hypothetical protein LOC434778 protein_id : NP_001029231.1

name	LOC546298 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271563 GeneID:546298
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001477099.1

name	LOC100040569 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271544 GeneID:100040569
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474971.1

name	Phf6 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33563292 CCDS:CCDS30127.1 GeneID:70998 MGI:1918248
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0005515 - protein binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0006355 - regulation of transcription, DNA-dependent [Evidence IEA]; GO:0006350 - transcription [Evidence IEA] codon_start : 1 product : PHD finger protein 6 protein_id : NP_081918.1

name	Hprt1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:96975138 GeneID:15452 MGI:96217
definition	EC_number : 2.4.2.8 GO_component : GO:0005737 - cytoplasm [Evidence IEA] [Evidence IDA] GO_function : GO:0004422 - hypoxanthine phosphoribosyltransferase activity [Evidence IDA] [Evidence IMP]; GO:0042802 - identical protein binding [Evidence IPI]; GO:0000287 - magnesium ion binding [Evidence IEA]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA]; GO:0016757 - transferase activity, transferring glycosyl groups [Evidence IEA] GO_process : GO:0046083 - adenine metabolism [Evidence IMP] [Evidence IGI]; GO:0006168 - adenine salvage [Evidence IMP]; GO:0007610 - behavior [Evidence IMP]; GO:0021954 - central nervous system neuron development [Evidence IMP]; GO:0021895 - cerebral cortex neuron differentiation [Evidence IMP]; GO:0019835 - cytolysis [Evidence IMP]; GO:0048813 - dendrite morphogenesis [Evidence IMP]; GO:0042417 - dopamine metabolism [Evidence IMP]; GO:0007625 - grooming behavior [Evidence IGI]; GO:0006178 - guanine salvage [Evidence IMP]; GO:0046100 - hypoxanthine metabolism [Evidence IMP] [Evidence IC]; GO:0046651 - lymphocyte proliferation [Evidence IMP]; GO:0009116 - nucleoside metabolism [Evidence IEA]; GO:0045964 - positive regulation of dopamine metabolism [Evidence IMP]; GO:0006164 - purine nucleotide biosynthesis [Evidence IMP]; GO:0006166 - purine ribonucleoside salvage [Evidence IMP] [Evidence IGI]; GO:0001975 - response to amphetamine [Evidence IMP]; GO:0021756 - striatum development [Evidence IMP] codon_start : 1 product : hypoxanthine guanine phosphoribosyl transferase 1 protein_id : NP_038584.2

name	C430049B03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:94407372 GeneID:72575 MGI:1924903
definition	codon_start : 1 product : hypothetical protein LOC72575 protein_id : XP_985665.1

name	Plac1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:9506575 CCDS:CCDS30128.1 GeneID:56096 MGI:1926287
definition	codon_start : 1 note : ectoplacental cone, invasive trophoblast giant cells, extraembryonic ectoderm and chorion sequence 26 product : placental specific protein 1 protein_id : NP_062411.1

name	4632404H22Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21313466 CCDS:CCDS30129.1 GeneID:78755 MGI:1926005
definition	codon_start : 1 product : hypothetical protein LOC78755 protein_id : NP_084443.1

name	4930432H15Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:21312034 GeneID:73866 MGI:1921116
definition	codon_start : 1 product : hypothetical protein LOC73866 protein_id : NP_082947.1

name	LOC665866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665866
definition	number : 2 pseudo : _no_value

name	LOC665866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665866
definition	number : 1 pseudo : _no_value

name	LOC665888 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665888
definition	number : 1 pseudo : _no_value

name	LOC665929 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665929
definition	number : 1 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 1 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 2 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 3 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 4 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 5 pseudo : _no_value

name	LOC624936 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:624936
definition	number : 6 pseudo : _no_value

name	LOC385527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385527
definition	number : 1 pseudo : _no_value

name	LOC385527 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385527
definition	number : 2 pseudo : _no_value

name	LOC385356 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271538 GeneID:385356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 45 ESTs, 54 Proteins product : similar to smooth muscle gamma-actin pseudo : _no_value transcript_id : XR_031901.1

name	Kis2 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:114796628 GeneID:751866 MGI:3617487
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : Kaplan integration site 2 transcript_id : NR_003188.1

name	LOC100041925 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271561 GeneID:100041925
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 235 ESTs, 9 Proteins product : similar to ribosomal protein S17 pseudo : _no_value transcript_id : XR_033016.1

clone name	MSMg01-289D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-132K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-138A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143O15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-454K07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-469M12
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-494B18
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-133A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-204J09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-145L15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-145L14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-492H19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-440D03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-347N11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-457M09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-450P01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-513B03
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-158M13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-521K22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-530F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-071N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-087A15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-152C24
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-301D14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449P18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-295O07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-391J13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-315L23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-439M13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-546P05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-481A19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-530G23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-502N13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485M19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-160H13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-508B18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-415P16
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509H19
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-073L01
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-541J08
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-498F13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-091J23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-094K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-097A10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-453L05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-304B21
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-271C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-078F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308O07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-316B22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019L05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-065F02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-215N10
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-216J02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-245E16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308D10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103L01
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-345E11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-175M03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-324H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153K10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-323F18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-214C07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199B07
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-103E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-137O01
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-022P15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-143L08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-302L20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254C11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-110B08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-112B21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-226P08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-308E13
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-158G23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-025K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-199A23
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-071A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-145E12
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-081E18
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-237F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-303F19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-031H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-133B02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-097J03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-077G03
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-086J10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156L21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-052M10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-150H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-119E21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332I16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019G18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-052L09
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-149C06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-171P17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-126E09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-107H11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-056N19
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-177P23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-219N06
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-066N04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102F16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-102F22
singlet/doublet	singlet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-308E13.b	B6Ng01-308E13.g
ACC	GA100825	GA100826
length	1,096	1,068
definition	B6Ng01-308E13.b	B6Ng01-308E13.g
singlet/doublet	doublet	doublet
BLAST hit	unique	unique
Map location.	(49,670,737 - 49,671,840)	(49,493,311 - 49,494,392)
sequence	gaattccaaatttgaggccaaatctgggatacatagcaagaccttatgtc aaatccaatgtataaatatgtattgacaatatgcttagccaactgtaacc atggttcagacagctgagcagagggtagcagctatagaaaatgctgggtt atgaatggtctttcccactctgcatatgtgaatccatgtgtgacaggcag atgcttcaggtttagagcccggctgtgtggacagtggatgaaacagtcag atttgtgttttaatatttgacattgctaatcactattctgagccacaggc ttattttttaaagctgacaggatagtatcctttgcaaatgacaaacagtt catcaacaacactaagccctttgtgttacctgtgcttgtgtaccggtctc tcctaatcttcttttttataaagtaaatactaagtctgagagatattgta aatagtgagagaacaaaagagctatagtgtgaaatggaattagcctgatt ggatttctgagggaaagtcaatgctgcactaaatccatatccatttattg gcaattcttcctcagacccattgtctttctttcaaccctcttcttcattc tcttccaaagcaatagttttcctggtttgaatttgttttgttagtgtgtg aggacgagactcctcaggagctgtccatgtgaaattactaggaaacctgt cacaatcacctttccatgctgggtttctctccaaaatgaacataattgaa gacctaaagtgctagctacctccttggcaaaattttacagcctgttttgc aaggctcaccttagtttagcaggctatccaataacactggagacatttat gaaagggtcagaaatggcctctcgaaataagctactgatcttaaccaggg tcatccaaaagagtttcagcagggctggagagatggctcatttggtaaga acacttgctactctttcagaggtctagatccagttctcaacacacacatg tctcacaaccacaatagctccatttaggaatatcaggagcatctactgct ctgcaggcaccagcatgcacgtgctgcacataggacacatgcatct	gaattcatgctagatgaaaacttgagaaccagatgatccataaccatttt cctcaacactttcatgtggtcacaatagcttggttcttcttgagacaagt ccttttcctggactcttctatgctagcaacaaccctgaatgtttccagta aacatacacgtttactgtacaaacagtgctgactgtaagaagtagatgag gagttgtagtgtgcacttaattggggagcacaaatggccccagaagtcca tacttttgagacttcacaggaaaaagaccttttctctacccaccagtgtt aggtctttgcctgctgtggttttagtccatttgatgtagagggaaagaca tgcttcaaagcctaatggccctgatgttctaagatcaaagtacaaaagcc aatgatgctttggtcacacaaaggtactccttgttactattttttttctt ctaaatgggaaagaaaatgagttttcagggggtaggggcacaaaaaaaaa gaaaatgagtttttaaatcaagttaataaagatttacttagtccctgacc ttatatgcaaggcatgatgagggactgtaaaactgaataagacataatgc ctgaattcaaggagctctttcagaggcaattaaaaaaataaaaagtccct acccaccccactttttgaaccagggatctgttgtagcccaggctagcttg aactcactttgtagtcaagaatcaccttgaactcccgaccttctgactca tcctcctcagtgctgggaacacaggtttcagccagcacacctgacacaac agccaattttaaaataagataaaatgtattgccttgaggactagggctat gtccaccttcctcatttttaaatcttagtaattagcatttaggcggggcc tgtagtggatacctaatgtattcttacacagaaatgatgaacaagtcact aatcaaatcatttactctctcctagaaattgatatgagcaagacttgcta accatggtatgtgacaacatatgagagattctttttgaccagcagatcat ctaggatgaatgagcact
quality values	Open. Hide. 58 26 23 35 58 58 28 15 54 58 58 62 47 38 62 62 47 39 41 22 62 62 54 62 49 62 62 62 37 29 47 26 14 20 14 11 14 14 22 27 35 29 38 34 50 56 59 62 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 49 51 43 32 34 45 43 56 62 49 42 54 62 62 59 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 59 59 62 59 62 62 62 62 62 59 59 59 62 62 62 59 59 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 37 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 56 62 62 62 62 52 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 48 54 62 62 58 45 45 58 58 58 58 58 58 37 49 49 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 58 58 54 47 58 58 58 54 45 52 58 58 58 54 58 58 58 54 49 52 58 47 58 58 58 58 58 58 58 54 52 46 49 40 58 43 52 58 58 58 58 54 58 58 58 53 53 58 58 49 40 51 51 58 58 58 53 58 58 51 51 58 48 50 47 58 52 58 54 53 51 50 50 29 49 58 52 53 53 53 51 51 50 53 58 58 58 50 58 58 58 46 50 58 58 58 48 58 46 58 58 58 39 58 58 52 51 51 48 41 53 53 58 50 58 50 58 53 53 58 47 31 52 58 41 36 40 51 40 44 43 42 45 20 58 51 32 50 52 53 52 40 50 39 53 50 46 41 51 58 40 50 51 37 50 42 43 18 50 54 51 40 27 49 44 54 44 41 32 45 29 53 45 42 34 43 50 51 54 51 32 37 21 37 49 37 41 40 54 54 31 54 50 45 45 52 37 38 51 31 54 54 35 37 45 52 30 36 32 52 33 41 47 37 42 35 35 26 29 9 47 53 39 54 37 34 52 53 43 42 32 30 35 40 34 40 52 32 28 37 32 26 40 27 25 28 51 51 21 19 51 49 32 33 45 26 32 32 25 22 42 34 53 51 38 29 33 33 26 28 32 28 33 31 31 27 33 43 30 31 17 42 51 31 31 23 30 8 7 15 19 40 34 31 25 42 28 38 31 25 30 40 22 27 31 39 42 31 20 31 26 25 31 47 43 29 34 27 21 46 13 33 47 33 33 38 31 18 46 48 31 37 42 38 30 28 30 37 30 32 21 31 46 25 31 21 28 25 31 31 23 27 35 33 26 25 31 22 27 17 28 32 16 26 34 44 41 32 38 32 38 32 38 25 44 44 31 18 32 20 37 44 25 31 35 23 33 11 23 43 19 30 35 21 22 25 15 31 21 25 14 30 32 33 34 33 26 32 48 29 28 24 21 25 25 24 38 11 20 17 22 17 26 15 21 25 31 32 31 32 14 48 24 15 9 9 20 26 26 14 19 14 18 27 31 32 13 24 22 12 24 8 10 19 26 21 7 16 6 4 4 3 6 11 20 4 9 7 6 7 11 15 7 6 19 19 12 9 23 8 7 20 27 20 26 21 9 17 14 4 47 24 8 11 10 13 11 17 8 20 16 6 16 9 24 5 10 5 18 16 21 20 23 15 3 3 2 4 13 16 14 15 13 14 9 10 13 12 18 11 18 20 7 8 13 9 16 8 9 11 20 10 15 16 10 7 6 6 5 4 4 5 4 5 11 12 6 8 16 15 6 7 5	Open. Hide. 62 44 44 44 62 59 44 49 62 43 43 17 13 21 22 25 23 25 25 27 23 32 32 34 27 59 59 62 62 62 59 62 59 62 62 59 59 62 59 59 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 59 51 49 31 34 48 50 54 54 54 49 42 54 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 54 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 59 59 54 49 54 62 62 62 62 62 62 59 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 46 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 54 54 58 58 58 58 54 58 58 58 54 58 58 58 58 58 58 58 54 42 58 58 58 58 58 58 58 54 58 58 58 58 58 54 36 39 41 41 58 58 54 52 58 58 58 47 58 58 58 49 54 58 58 45 54 58 58 53 58 58 54 34 58 58 51 49 58 58 58 48 58 58 58 51 51 58 51 49 49 37 51 58 58 58 58 58 52 58 58 58 58 42 50 58 50 52 54 50 58 51 50 54 58 53 58 58 58 50 50 35 58 25 58 50 40 44 38 46 53 58 58 58 58 58 52 39 51 58 41 49 50 37 51 52 58 43 51 40 52 58 30 50 49 43 41 43 36 50 54 54 54 54 54 46 41 38 49 54 39 53 54 54 32 37 37 50 54 52 52 50 36 49 37 54 54 40 40 36 49 49 49 40 39 47 54 52 52 40 47 45 53 45 39 41 54 54 44 49 37 45 34 38 42 41 51 37 51 31 37 41 33 47 46 47 53 33 33 40 32 40 34 53 47 34 39 19 47 45 53 52 45 47 38 33 34 34 31 45 53 53 41 37 38 37 32 31 29 21 53 31 31 51 46 37 33 37 30 30 45 30 22 46 33 51 42 36 35 35 32 22 13 31 45 29 30 32 23 46 32 31 41 30 28 30 29 33 31 32 34 36 26 30 32 23 47 47 46 33 48 48 38 31 27 33 26 32 30 36 48 47 32 31 42 23 32 43 33 37 22 26 32 33 30 37 31 26 31 18 27 26 12 48 31 31 43 31 29 30 29 30 30 26 31 41 31 31 31 41 28 26 30 38 48 47 48 38 31 43 17 22 32 26 21 34 23 32 30 21 17 22 31 32 38 35 31 44 25 28 10 20 16 25 41 44 27 14 21 32 31 29 25 20 28 23 24 6 17 32 28 15 32 16 17 19 34 22 27 22 34 28 17 20 15 26 17 15 30 17 33 48 32 27 18 16 6 30 16 25 8 8 20 26 32 32 32 34 32 22 32 15 13 9 34 20 13 21 24 28 40 27 18 23 28 28 27 28 25 13 27 11 21 6 15 31 17 11 11 20 20 15 13 16 12 8 4 5 5 8 3 16 14 30 30 20 23 28 11 9 7 15 20 24 20 16 5 16 20 16 14 8 16 5 9 11 7 4 11 16 21 11 12 4 8 4 20 16 16 16 8 28 28 17 22 10 21 7 15 7 6 8 5 5 9 1 11 16 18 16 12 5 9 9 4 9 10 23 15 3 3 3 2 4 6 4 7

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_49670737_49671840
seq2: B6Ng01-308E13.b_46_1141 (reverse)

seq1  AGATGCATGTGT-CTATGTGCAGCACGTGCATGCTTGGTGCCTGCAGAGG  49
      |||||||||||| ||||||||||||||||||||| |||||||||||||| 
seq2  AGATGCATGTGTCCTATGTGCAGCACGTGCATGC-TGGTGCCTGCAGAG-  48

seq1  CCAGTAGATGGCTCCTGATA-TCCTAAAATTGGAGCTATTGTGGTTGTGA  98
       |||||||| |||||||||| |||||||  ||||||||||||||||||||
seq2  -CAGTAGAT-GCTCCTGATATTCCTAAA--TGGAGCTATTGTGGTTGTGA  94

seq1  GACATTGTGTTGGTGTTGAGAACTGGATCTAGACCCTCTGAAAGAGTAGC  148
      |||| |||||  ||||||||||||||||||||| ||||||||||||||||
seq2  GACA-TGTGT--GTGTTGAGAACTGGATCTAGA-CCTCTGAAAGAGTAGC  140

seq1  AAGTGTTCTTACCAAATGAGCCATCTCTCCAGCCCTGCTGAAACTCTTTT  198
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAGTGTTCTTACCAAATGAGCCATCTCTCCAGCCCTGCTGAAACTCTTTT  190

seq1  GGATGACCCTGGTTAAGATCAGTAGCTTATTTCGAGAGGCCATTTCTGAC  248
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GGATGACCCTGGTTAAGATCAGTAGCTTATTTCGAGAGGCCATTTCTGAC  240

seq1  CC-TTCATAAATGTCTCCAGTGTTATTGGATAGCCCTGCTAAACTAAGGT  297
      || |||||||||||||||||||||||||||||| ||||||||||||||||
seq2  CCTTTCATAAATGTCTCCAGTGTTATTGGATAG-CCTGCTAAACTAAGGT  289

seq1  GAGCCTTGCAAAACAGGCTGTAAAATTTTGCCAAGGAGGTAGCTAGCACT  347
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGCCTTGCAAAACAGGCTGTAAAATTTTGCCAAGGAGGTAGCTAGCACT  339

seq1  TTAGGTCTTCAATTATGTTCATTTTGGAGAGAAACCCAGCATGGAAAGGT  397
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTAGGTCTTCAATTATGTTCATTTTGGAGAGAAACCCAGCATGGAAAGGT  389

seq1  GATTGTGACAGGTTTCCTAGTAATTTCACATGGACAGCTCCTGAGGAGTC  447
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATTGTGACAGGTTTCCTAGTAATTTCACATGGACAGCTCCTGAGGAGTC  439

seq1  TCGTCCTCACACACTAACAAAACAAATTCAAACCAGGAAAACTATTGCTT  497
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCGTCCTCACACACTAACAAAACAAATTCAAACCAGGAAAACTATTGCTT  489

seq1  TGGAAGAGAATGAAGAAGAGGGTTGAAAGAAAGACAATGGGTCTGAGGAA  547
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGAAGAGAATGAAGAAGAGGGTTGAAAGAAAGACAATGGGTCTGAGGAA  539

seq1  GAATTGCCAATAAATGGATATGGATTTAGTGCAGCATTGACTTTCCCTCA  597
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTGCCAATAAATGGATATGGATTTAGTGCAGCATTGACTTTCCCTCA  589

seq1  GAAATCCAATCAGGCTAATTCCATTTCACACTATAGCTCTTTTGTTCTCT  647
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAATCCAATCAGGCTAATTCCATTTCACACTATAGCTCTTTTGTTCTCT  639

seq1  CACTATTTACAATATCTCTCAGACTTAGTATTTACTTTATAAAAAAGAAG  697
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACTATTTACAATATCTCTCAGACTTAGTATTTACTTTATAAAAAAGAAG  689

seq1  ATTAGGAGAGACCGGTACACAAGCACAGGTAACACAAAGGGCTTAGTGTT  747
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATTAGGAGAGACCGGTACACAAGCACAGGTAACACAAAGGGCTTAGTGTT  739

seq1  GTTGATGAACTGTTTGTCATTTGCAAAGGATACTATCCTGTCAGCTTTAA  797
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTGATGAACTGTTTGTCATTTGCAAAGGATACTATCCTGTCAGCTTTAA  789

seq1  AAAATAAGCCTGTGGCTCAGAATAGTGATTAGCAATGTCAAATATTAAAA  847
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AAAATAAGCCTGTGGCTCAGAATAGTGATTAGCAATGTCAAATATTAAAA  839

seq1  CACAAATCTGACTGTTTCATCCACTGTCCACACAGCCGGGCTCTAAACCT  897
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CACAAATCTGACTGTTTCATCCACTGTCCACACAGCCGGGCTCTAAACCT  889

seq1  GAAGCATCTGCCTGTCACACATGGATTCACATATGCAGAGTGGGAAAGAC  947
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAGCATCTGCCTGTCACACATGGATTCACATATGCAGAGTGGGAAAGAC  939

seq1  CATTCATAACCCAGCATTTTCTATAGCTGCTACCCTCTGCTCAGCTGTCT  997
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CATTCATAACCCAGCATTTTCTATAGCTGCTACCCTCTGCTCAGCTGTCT  989

seq1  GAACCATGGTTACAGTTGGCTAAGCATATTGTCAATACATATTTATACAT  1047
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAACCATGGTTACAGTTGGCTAAGCATATTGTCAATACATATTTATACAT  1039

seq1  TGGATTTGACATAAGGTCTTGCTATGTATCCCAGATTTGGCCTCAAATTT  1097
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGGATTTGACATAAGGTCTTGCTATGTATCCCAGATTTGGCCTCAAATTT  1089

seq1  GGAATTC  1104
      |||||||
seq2  GGAATTC  1096

seq1: chrX_49493311_49494392
seq2: B6Ng01-308E13.g_67_1134

seq1  GAATTCATGCTAGATGAAAACTTGAGAACCAGATGATCCATAACCATTTT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCATGCTAGATGAAAACTTGAGAACCAGATGATCCATAACCATTTT  50

seq1  CCTCAACACTTTCATGTGGTCACAATAGCTTGGTTCTTCTTGAGACAAGT  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCAACACTTTCATGTGGTCACAATAGCTTGGTTCTTCTTGAGACAAGT  100

seq1  CCTTTTCCTGGACTCTTCTATGCTAGCAACAACCCTGAATGTTTCCAGTA  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTTTTCCTGGACTCTTCTATGCTAGCAACAACCCTGAATGTTTCCAGTA  150

seq1  AACATACACGTTTACTGTACAAACAGTGCTGACTGTAAGAAGTAGATGAG  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACATACACGTTTACTGTACAAACAGTGCTGACTGTAAGAAGTAGATGAG  200

seq1  GAGTTGTAGTGTGCACTTAATTGGGGAGCACAAATGGCCCCAGAAGTCCA  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAGTTGTAGTGTGCACTTAATTGGGGAGCACAAATGGCCCCAGAAGTCCA  250

seq1  TACTTTTGAGACTTCACAGGAAAAAGACCTTTTCTCTACCCACCAGTGTT  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TACTTTTGAGACTTCACAGGAAAAAGACCTTTTCTCTACCCACCAGTGTT  300

seq1  AGGTCTTTGCCTGCTGTGGTTTTAGTCCATTTGATGTAGAGGGAAAGACA  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGGTCTTTGCCTGCTGTGGTTTTAGTCCATTTGATGTAGAGGGAAAGACA  350

seq1  TGCTTCAAAGCCTAATGGCCCTGATGTTCTAAGATCAAAGTACAAAAGCC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TGCTTCAAAGCCTAATGGCCCTGATGTTCTAAGATCAAAGTACAAAAGCC  400

seq1  AATGATGCTTTGGTCACACAAAGGTACTCCTTGTTACTATTTTTTTTCTT  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AATGATGCTTTGGTCACACAAAGGTACTCCTTGTTACTATTTTTTTTCTT  450

seq1  CTAAATGGGAAAGAAAATGAGTTTTCAGGGGGTAGGGGCACAAAAAAAAA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTAAATGGGAAAGAAAATGAGTTTTCAGGGGGTAGGGGCACAAAAAAAAA  500

seq1  GAAAATGAGTTTTTAAATCAAGTTAATAAAGATTTACTTAGTCCCTGACC  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAAAATGAGTTTTTAAATCAAGTTAATAAAGATTTACTTAGTCCCTGACC  550

seq1  TTATATGCAAGGCATGATGAGGGACTGTAAAACTGAATAAGACATAATGC  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TTATATGCAAGGCATGATGAGGGACTGTAAAACTGAATAAGACATAATGC  600

seq1  CTGAATTCAAGGAGCTCTTTCAGAGGCAATTAAAAAAATAAAAAGTCCCT  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTGAATTCAAGGAGCTCTTTCAGAGGCAATTAAAAAAATAAAAAGTCCCT  650

seq1  ACCCACCCCACTTTTTGAACCAGGGATCTGTTGTAGCCCAGGCTAGCTTG  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACCCACCCCACTTTTTGAACCAGGGATCTGTTGTAGCCCAGGCTAGCTTG  700

seq1  AACTCACTTTGTAGTCAAGAATCACCTTGAACTCCCGACCTTCTGACTCA  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTCACTTTGTAGTCAAGAATCACCTTGAACTCCCGACCTTCTGACTCA  750

seq1  TCCTCCTCAGTGCTGGGAACACAGGTTTCAGCCAGCACACCTGACACAAC  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCCTCCTCAGTGCTGGGAACACAGGTTTCAGCCAGCACACCTGACACAAC  800

seq1  AGCCAATTTTAAAATAAGATAAAATGTATTGCCTTGAGGACTAGGGCTAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGCCAATTTTAAAATAAGATAAAATGTATTGCCTTGAGGACTAGGGCTAT  850

seq1  GTCCACCTTCCTCATTTTTAAATCTTAGTAATTAGCATTTAGGCGGGGCC  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTCCACCTTCCTCATTTTTAAATCTTAGTAATTAGCATTTAGGCGGGGCC  900

seq1  TGTAGTGGATACCTAATGTATTCTTACACAAGAAATGAATGAACAAGTCA  950
      ||||||||||||||||||||||||||||| ||||||| ||||||||||||
seq2  TGTAGTGGATACCTAATGTATTCTTACAC-AGAAATG-ATGAACAAGTCA  948

seq1  CTAATCAAATCATTTACTCTCTCCTAGAAAATTGATATGAGGCAAAAGAC  1000
      ||||||||||||||||||||||||||| |||||||||||||    |||||
seq2  CTAATCAAATCATTTACTCTCTCCTAG-AAATTGATATGAG---CAAGAC  994

seq1  TTTGCTAACCATGGGTATGTGAACAAACATATGAGAGATTCTTTTTGACC  1050
       ||||||||||| |||||||||   |||||||||||||||||||||||||
seq2  -TTGCTAACCAT-GGTATGTGA--CAACATATGAGAGATTCTTTTTGACC  1040

seq1  AGCAGAACCATCTAGGGATGAAATGAAGCACT  1082
      ||||| | |||||| ||||| |||| ||||||
seq2  AGCAG-ATCATCTA-GGATG-AATG-AGCACT  1068

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information