MoG+ -Mouse Genome database with high added value-

BAC Information

BAC name
Region	Chromosome -
Gene	search by nearby gene name.
Format	rows / page	Page	1

BAC

Clone Name	B6Ng01-318G15
Chromosome	X (Build37)
Map Location	47,932,245 - 47,933,365
singlet/doublet	singlet
Overlap gene	none
Upstream gene	LOC100041697, Olfr1320, Olfr1321, Igsf1, Olfr1322, LOC100040344, Olfr1323, EG665816, Olfr1324, LOC100041788, 6720401G13Rik
Downstream gene	2610018G03Rik, LOC100040422, Rap2c, LOC385355, Mbnl3, LOC665866, LOC385356, Hs6st2
Link	Open Mouse BAC browser

Click to get alignment info.

name	LOC100041697 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins pseudo : _no_value

name	Olfr1320 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Olfr1321 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	Igsf1 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 4 mRNAs

name	Olfr1322 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040344 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040344
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	Olfr1323 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	EG665816 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:665816 MGI:3646089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 157 ESTs, 8 Proteins pseudo : _no_value

name	Olfr1324 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:258289 MGI:3031158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100041788 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100041788
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	6720401G13Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:103012 MGI:2147989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	2610018G03Rik (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:70415 MGI:1917665
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC100040422 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:100040422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST

name	Rap2c (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:72065 MGI:1919315
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC385355 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385355
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins pseudo : _no_value

name	Mbnl3 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:171170 MGI:2444912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA

name	LOC665866 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:665866
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 6 Proteins pseudo : _no_value

name	LOC385356 (CDS detail)
type	gene
link	vega ensembl
xref	GeneID:385356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 45 ESTs, 54 Proteins pseudo : _no_value

name	Hs6st2 (CDS detail)
type	gene
link	vega ensembl MGI
xref	GeneID:50786 MGI:1354959
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 2 mRNAs

name	Olfr1320 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:115529460 GeneID:236784 MGI:3031154
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1320 transcript_id : NM_207240.2

name	Olfr1321 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:52421340 GeneID:236785 MGI:3031155
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1321 transcript_id : NM_207631.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:34330163 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177591.3

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41281998 GeneID:209268 MGI:2147913
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183336.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:41282008 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_183335.1

name	Igsf1 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:142343783 GeneID:209268 MGI:2147913
definition	exception : mismatches in transcription note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : immunoglobulin superfamily, member 1 transcript_id : NM_177915.3

name	Olfr1322 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:58801353 GeneID:257978 MGI:3031156
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1322 transcript_id : NM_001011794.1

name	Olfr1323 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:33239073 GeneID:258385 MGI:3031157
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1323 transcript_id : NM_146390.1

name	Olfr1324 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:22129700 GeneID:258289 MGI:3031158
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : olfactory receptor 1324 transcript_id : NM_146292.1

name	6720401G13Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:149271534 GeneID:103012 MGI:2147989
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : RIKEN cDNA 6720401G13 gene transcript_id : XM_001474597.1

name	2610018G03Rik (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:19526919 GeneID:70415 MGI:1917665
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RIKEN cDNA 2610018G03 gene transcript_id : NM_133729.1

name	LOC100040422 (CDS detail)
type	mRNA
link	vega ensembl NCBI
xref	GI:149271536 GeneID:100040422
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 1 EST product : hypothetical protein LOC100040422 transcript_id : XM_001474653.1

name	Rap2c (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:65301470 GeneID:72065 MGI:1919315
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : RAP2C, member of RAS oncogene family transcript_id : NM_172413.2

name	Mbnl3 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:71043949 GeneID:171170 MGI:2444912
definition	note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : muscleblind-like 3 (Drosophila) transcript_id : NM_134163.4

name	Hs6st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116284407 GeneID:50786 MGI:1354959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 2 transcript_id : NM_001077202.1

name	Hs6st2 (CDS detail)
type	mRNA
link	vega ensembl MGI NCBI
xref	GI:116284405 GeneID:50786 MGI:1354959
definition	exception : unclassified transcription discrepancy note : Derived by automated computational analysis using gene prediction method: BestRefseq. Supporting evidence includes similarity to: 1 mRNA product : heparan sulfate 6-O-sulfotransferase 2 transcript_id : NM_015819.3

name	Olfr1320 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:115529461 CCDS:CCDS30116.1 GeneID:236784 MGI:3031154
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : olfactory receptor GA_x6K02T2Q64A-11736563-11737522 product : olfactory receptor 1320 protein_id : NP_997123.2

name	Olfr1321 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:52421341 CCDS:CCDS30117.1 GeneID:236785 MGI:3031155
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11768161-11767223; GA_x5J8B7W1V10-1157-554 product : olfactory receptor 1321 protein_id : NP_997514.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:34330164 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : long isoform is encoded by transcript variant 1; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 long isoform protein_id : NP_808259.2

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41281999 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : isoform 4 is encoded by transcript variant 4; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 4 protein_id : NP_899179.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:41282009 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 exception : mismatches in translation note : isoform 3 is encoded by transcript variant 3; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 isoform 3 protein_id : NP_899178.1

name	Igsf1 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:29244558 GeneID:209268 MGI:2147913
definition	GO_component : GO:0005575 - cellular_component [Evidence ND]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0003674 - molecular_function [Evidence ND] GO_process : GO:0008150 - biological_process [Evidence ND] codon_start : 1 note : short isoform is encoded by transcript variant 2; betaglycan and inhibin binding protein product : immunoglobulin superfamily, member 1 short isoform protein_id : NP_808583.1

name	Olfr1322 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:58801354 CCDS:CCDS30118.1 GeneID:257978 MGI:3031156
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-11927171-11926215; olfactory receptor MOR264-16P product : olfactory receptor 1322 protein_id : NP_001011794.1

name	Olfr1323 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:33239074 CCDS:CCDS30119.1 GeneID:258385 MGI:3031157
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12051754-12050825; olfactory receptor MOR216-1 product : olfactory receptor 1323 protein_id : NP_666502.1

name	Olfr1324 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:22129701 CCDS:CCDS30120.1 GeneID:258289 MGI:3031158
definition	GO_component : GO:0016021 - integral to membrane [Evidence IEA] [Evidence ISS]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0004930 - G-protein coupled receptor activity [Evidence IEA]; GO:0004984 - olfactory receptor activity [Evidence IEA] [Evidence ISS]; GO:0004872 - receptor activity [Evidence IEA]; GO:0004871 - signal transducer activity [Evidence IEA] GO_process : GO:0007186 - G-protein coupled receptor protein signaling pathway [Evidence ISS] [Evidence IEA]; GO:0050896 - response to stimulus [Evidence IEA]; GO:0007608 - sensory perception of smell [Evidence IEA] [Evidence ISS]; GO:0007165 - signal transduction [Evidence IEA] codon_start : 1 note : GA_x6K02T2Q64A-12454598-12453654; olfactory receptor MOR128-2 product : olfactory receptor 1324 protein_id : NP_666404.1

name	6720401G13Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:149271535 GeneID:103012 MGI:2147989
definition	codon_start : 1 product : hypothetical protein LOC103012 protein_id : XP_001474647.1

name	2610018G03Rik (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19526920 GeneID:70415 MGI:1917665
definition	GO_component : GO:0005794 - Golgi apparatus [Evidence ISS] GO_function : GO:0005524 - ATP binding [Evidence IEA] [Evidence ISS]; GO:0016301 - kinase activity [Evidence IEA]; GO:0000287 - magnesium ion binding [Evidence IEA] [Evidence ISS]; GO:0046872 - metal ion binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA]; GO:0004674 - protein serine/threonine kinase activity [Evidence IEA]; GO:0016740 - transferase activity [Evidence IEA] GO_process : GO:0006915 - apoptosis [Evidence IEA]; GO:0006468 - protein amino acid phosphorylation [Evidence ISS]; GO:0042981 - regulation of apoptosis [Evidence ISS] codon_start : 1 note : Mst3 and SOK1-related kinase; novel protein containing a protein kinase domain product : serine/threonine protein kinase MST4 protein_id : NP_598490.1

name	LOC100040422 (CDS detail)
type	CDS
link	vega ensembl NCBI
xref	GI:149271537 GeneID:100040422
definition	codon_start : 1 product : hypothetical protein protein_id : XP_001474703.1

name	Rap2c (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:27369539 CCDS:CCDS30121.1 GeneID:72065 MGI:1919315
definition	GO_component : GO:0005622 - intracellular [Evidence IEA]; GO:0016020 - membrane [Evidence IEA] GO_function : GO:0005525 - GTP binding [Evidence IEA]; GO:0000166 - nucleotide binding [Evidence IEA] GO_process : GO:0007264 - small GTPase mediated signal transduction [Evidence IEA] codon_start : 1 product : RAP2C, member of RAS oncogene family protein_id : NP_766001.1

name	Mbnl3 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:19527398 GeneID:171170 MGI:2444912
definition	GO_component : GO:0005634 - nucleus [Evidence IEA] GO_function : GO:0046872 - metal ion binding [Evidence IEA]; GO:0003676 - nucleic acid binding [Evidence IEA]; GO:0008270 - zinc ion binding [Evidence IEA] GO_process : GO:0007275 - development [Evidence IEA]; GO:0045662 - negative regulation of myoblast differentiation [Evidence IDA] codon_start : 1 product : muscleblind-like 3 protein_id : NP_598924.1

name	Hs6st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116284408 GeneID:50786 MGI:1354959
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 1 is encoded by transcript variant 1 product : heparan sulfate 6-O-sulfotransferase 2 isoform 1 protein_id : NP_001070670.1

name	Hs6st2 (CDS detail)
type	CDS
link	vega ensembl MGI NCBI
xref	GI:116284406 GeneID:50786 MGI:1354959
definition	GO_function : GO:0016740 - transferase activity [Evidence IEA] codon_start : 1 note : isoform 2 is encoded by transcript variant 2 product : heparan sulfate 6-O-sulfotransferase 2 isoform 2 protein_id : NP_056634.3

name	LOC100040344 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100040344
definition	number : 1 pseudo : _no_value

name	LOC100041788 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:100041788
definition	number : 1 pseudo : _no_value

name	LOC385355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385355
definition	number : 1 pseudo : _no_value

name	LOC385355 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:385355
definition	number : 2 pseudo : _no_value

name	LOC665866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665866
definition	number : 2 pseudo : _no_value

name	LOC665866 (CDS detail)
type	exon
link	vega ensembl
xref	GeneID:665866
definition	number : 1 pseudo : _no_value

name	LOC100041697 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271560 GeneID:100041697
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 mRNAs, 105 ESTs, 3 Proteins product : hypothetical protein LOC100041697 pseudo : _no_value transcript_id : XR_032928.1

name	EG665816 (CDS detail)
type	misc_RNA
link	vega ensembl MGI NCBI
xref	GI:94407360 GeneID:665816 MGI:3646089
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 157 ESTs, 8 Proteins product : predicted gene, EG665816 pseudo : _no_value transcript_id : XR_001793.1

name	LOC385356 (CDS detail)
type	misc_RNA
link	vega ensembl NCBI
xref	GI:149271538 GeneID:385356
definition	note : Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 45 ESTs, 54 Proteins product : similar to smooth muscle gamma-actin pseudo : _no_value transcript_id : XR_031901.1

clone name	MSMg01-078E07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-277O13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-538M23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-509B07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-148F04
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-165J10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-095M06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-155N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-149N05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-485L08
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-427B15
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-539C05
singlet/doublet	doublet
plural/unique	plural

clone name	MSMg01-409P03
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-349G10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-401G07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460D19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-465D23
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-391O20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-434M15
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-460E22
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-336F18
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-449E18
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-306C05
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-289D20
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-343E14
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-497L13
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-459A20
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-289K09
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-132K06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-446B14
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-138A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-125N07
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-375L13
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-076G06
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-079M23
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-529D12
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-337N06
singlet/doublet	singlet
plural/unique	plural

clone name	MSMg01-262G02
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-127K21
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-052L05
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-232B07
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-134D06
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-329A24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-130F19
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-409B10
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-231I12
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-330K24
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-065M11
singlet/doublet	singlet
plural/unique	unique

clone name	MSMg01-497M10
singlet/doublet	doublet
plural/unique	unique

clone name	MSMg01-143O15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-135O16
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-246E20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-314C04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-310N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-007L24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-080B18
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-077G04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-116O17
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-325F23
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-204A22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-193E15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-105G02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-186A04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-313K16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-350A24
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-155B15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-341L12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082M05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-116E02
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-327N12
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-198K17
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-329F08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-102O14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F14
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-138M19
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-318G15
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-082C16
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-042I22
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-045G21
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-055L03
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-144G15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-019K20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-139L22
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-167D08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-010A08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-156A04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-032H15
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-332C20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-203I13
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-332F05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-254O11
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-078F11
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-138I08
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-317H10
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-153C02
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-306K04
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-025H20
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-008A05
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-191E05
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-289G09
singlet/doublet	doublet
plural/unique	unique

clone name	B6Ng01-228B04
singlet/doublet	singlet
plural/unique	unique

clone name	B6Ng01-308O07
singlet/doublet	doublet
plural/unique	unique

BAC End Information

BAC end	BAC-end 1	BAC-end 2
end name	B6Ng01-318G15.b	B6Ng01-318G15.g
ACC	GA108308	GA108309
length	1,122	1,175
definition	B6Ng01-318G15.b	B6Ng01-318G15.g
singlet/doublet	singlet	---
BLAST hit	unique	no hit data
sequence	gaattctccactgtcccttccattcaggcctgttatacttcccttggact aacttgccctcaaagggtaaacatggtggatgaaggcagaaagaggagaa aactggtgtagtggctattcctggttgtcaacctgactatatttgaaatg aactacaatccagcattggaaggctcaccagtgacccttatctacaggct tagaaagagaaatttctgatctagatcttggtatggagatcttggggcac agtgactatggattactgaagataaaatttcggagttcaacgtcttctgg gatgaaaggtttggtagaacacatttaatctagggtacaccttctcctgg agacaatataaggacattggaagaagggagtctagctcttgctccttcgc ctacttgctgtgtgagaatgagtaactcctagatccttggacttccattc gcagctactactgaaacattgttgggaattgggctgcagactgtaagtca tcaataaattactttactatatagagactatccataaattctgtgactct agagaaccctgacaatacaactgggaagcacggacatcctctttgagata taattatcaactggcaagtgtttgtttattgatattttacttaagacaaa gttaaacctactcctgtcctctgggcatggtagcatggacttattctgga actaccagaggaaaagacagaaacctactggaaaggcccaggccatcctg cctcttgtagttcactaggaccagggctcagcatagtccttggcttctaa atctgctaccatatctttatcatgtaaaactgacacaaaattaaacatat caaaattttatgaaaaccattaagtatctggaaaagaaaaaatcaacagt tataaagatagaaaagggaaaaacactacataacagaacgaaaagagtcc caccacctttgggcctcagattggctttcacatggaacatgtgacaaaat aaatacagttgaactactcaagctgggtaaagttaagaaagacagcaggc caatagtgggtgccacaccatttaatccaagcacctccggagctgaagca agttgatttctgagatttcgct	gaattcaaggcagacaaaatctcagcatgtggatggggcatgaagtccta cccctaaccaggaagctacgggcaatagtttctgggggagagttagcttc cattaaggaaatgactcctagtaggtcagccttactttagttggaaggcc acacacctaagaacacttggccaacacaaattggactctaggaactttac aagaaaggacaagaagttgggtggattgattagaaggtccagtgaatctg ggaggagttgtgagaggggtttgtgaacatgatcaaaataaattgtacta aactctcaaagtataaatattaatatttaaaactggagctcttctgatgg agagctgcagtggtctgggtttagaaggcaatttgataccatgtccattt agcaaattaatatcagtagattctttcttgggcttatgacctcccctctg catgattattttatttaatttttctgtttttatttttattggtatatatg ttttgcccatatgtatgtctgtgcactataagtatgcttagtgtctgaaa aaaaatcatgagagggcaatgggtcccctggaactgaactcatggatagt tgtggaacaccatgtgagtgcttggaactaaacccaggacttctgcaata gcagccagtgcttttaccctctgtgccacctctccatcactcccatatgg tattgtggggaggacaaggtctcactatgacactacatagctcagctgac ctaaaacttggaatatcagccagggtggtctccagcttaaaaccttcatg cttcctccccatgagcaggatcttgagtatgcaccatcatgtctggcttc ttcatacatctcaagatatgggactcaaccctatgtgcctacccgaattc ttactgggtccatccatacaggtcaatgtattcccccccaaaacatctta ttcttatcaacctccgtgtgtaggattaatagcttgcatgtatgtagcca tgactagcagtggattctccatgcttgaaaaccttaggaaagatggaact tacgttagtatgaagccttcctcctttctttcttttaacttctaatccta agagttcaggatctttcaatcagtggtgtagaaacacttgaacctctcca caaatggcgctcttgactcttccca
quality values	Open. Hide. 49 33 32 29 58 58 58 58 41 23 42 58 54 62 62 62 62 62 62 62 39 30 62 62 41 39 62 62 62 62 62 62 62 43 46 56 56 44 62 62 62 62 62 62 62 62 49 28 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 59 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 49 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 62 62 62 62 47 47 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 47 49 56 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 49 62 62 62 62 47 47 62 62 62 62 62 62 58 58 58 58 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 49 58 58 54 46 58 58 58 58 58 58 58 58 58 54 58 48 58 58 58 58 58 54 58 58 58 58 58 54 58 58 54 58 58 58 58 58 58 58 58 54 58 54 54 58 58 54 58 58 54 58 58 54 54 58 58 58 58 58 50 58 54 58 54 51 58 52 53 58 53 58 45 40 58 58 58 58 51 58 46 58 46 29 41 47 58 58 34 42 50 58 58 49 58 51 51 58 58 58 58 58 58 50 52 53 42 51 58 58 44 50 50 54 52 58 58 52 58 58 54 58 58 32 46 42 40 53 52 51 41 58 51 51 53 54 51 49 49 58 43 43 53 51 43 52 58 51 58 58 58 53 58 52 40 39 58 58 53 39 51 49 58 58 43 50 50 50 51 40 51 50 51 27 52 58 54 42 53 58 33 44 43 50 44 44 44 49 54 44 44 50 54 46 47 53 53 45 49 49 49 38 42 45 53 54 54 42 53 27 44 40 52 50 54 38 34 54 49 32 37 49 52 52 54 35 32 32 37 53 37 46 42 32 40 51 26 54 54 54 54 52 45 52 40 45 53 53 52 25 39 25 40 37 44 39 51 44 51 54 37 25 30 15 47 40 34 26 47 47 47 30 37 40 46 34 47 33 28 33 31 34 36 47 36 42 34 53 51 31 32 35 40 34 7 47 31 21 32 34 36 51 46 32 33 30 41 32 42 31 42 43 30 34 33 37 36 33 33 33 32 31 32 32 29 41 51 30 30 31 31 30 31 31 29 25 37 28 43 28 31 30 38 48 40 32 31 31 31 30 42 31 30 48 47 46 28 42 32 31 31 23 37 26 46 48 32 31 39 29 46 30 19 23 39 30 39 28 24 46 47 35 37 48 48 36 29 30 31 31 48 39 29 11 12 23 36 31 22 26 25 35 31 42 37 31 31 31 37 44 44 44 34 38 48 43 43 47 18 33 31 30 19 29 31 31 25 25 20 21 25 43 12 9 31 23 22 25 33 39 39 21 19 43 26 20 48 43 31 24 6 17 31 32 23 31 19 33 10 11 9 19 23 25 19 16 20 37 48 33 27 31 32 27 34 32 48 34 27 13 29 16 11 15 7 40 8 22 40 20 14 19 27 24 13 10 28 14 15 14 17 28 10 29 14 27 7 4 8 26 16 17 3 4 11 18 27 17 11 19 27 4 5 5 5 5 5 3 12 8 3 8 26 24 21 18 11 7 28 8 12 21 16 23 20 21 19 23 12 21 23 20 28 16 11 22 30 25 13 24 7 7 4 12 5 5 1 2 8 6 4 14 21 6 9 11 4 6 10 4 6 9 4 4 11 24 13 5 8 4 7 4 4 5 4 22 12 7 26 6 8 7 16 14 24 5 8 6 16 5 5 5 6 6 7 5 6 12 9 2 1 1 9 6 5 2 5 4 21 4 4 16 16 11 17 7 5 17 13 15 4 5 5 6 20 5 4 3 1	Open. Hide. 62 47 42 41 62 47 56 54 62 62 56 56 56 44 56 42 43 38 38 43 62 62 59 59 62 62 62 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 59 62 62 62 62 62 54 62 62 62 62 54 54 62 62 62 62 59 62 62 59 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 59 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 59 62 62 62 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 59 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 62 59 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 59 59 62 59 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 54 54 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 62 49 62 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 58 58 58 58 47 58 58 58 58 58 58 58 54 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 58 58 54 58 58 58 58 58 58 58 58 52 58 54 54 58 58 58 58 58 53 46 58 58 58 49 58 52 58 58 52 58 58 58 58 49 49 58 58 58 58 48 50 53 53 54 58 58 50 58 39 58 51 50 58 58 49 58 58 43 54 51 43 43 43 54 58 58 58 51 50 51 58 49 58 50 58 51 50 51 58 58 39 41 52 52 52 51 58 53 58 37 51 49 40 50 28 43 22 50 58 54 58 58 50 58 50 49 51 54 51 50 51 51 37 53 50 58 50 50 58 49 40 39 50 39 27 58 51 51 52 54 49 39 39 50 50 40 49 53 42 53 50 45 52 52 54 52 51 54 54 50 37 38 28 34 50 52 47 54 50 51 44 41 37 31 49 51 47 53 39 35 31 53 45 49 49 53 39 54 44 37 53 53 39 47 54 33 40 32 34 51 34 46 54 54 34 34 23 53 31 23 30 51 31 54 40 45 53 34 39 40 42 37 40 42 41 25 37 39 53 34 52 34 53 32 25 32 53 31 7 10 19 42 45 41 11 32 47 45 53 52 25 31 53 35 47 46 34 46 31 32 37 43 34 32 53 30 28 31 51 46 31 38 30 31 42 42 31 31 30 29 30 26 31 31 51 42 33 27 18 8 33 27 23 34 45 31 41 30 29 41 31 28 36 40 41 30 31 42 46 24 41 27 18 37 27 28 31 28 32 42 32 24 41 31 31 27 30 22 22 46 26 23 33 34 32 42 32 33 30 46 28 11 25 26 30 41 12 27 11 31 38 32 19 29 32 32 31 29 18 21 20 12 14 23 12 46 15 37 21 30 30 30 29 15 46 18 27 31 31 31 31 33 38 18 21 12 17 47 35 25 33 22 17 22 31 22 24 27 29 21 32 48 18 32 21 25 17 22 22 36 32 31 18 19 6 4 13 12 26 20 25 27 38 18 21 18 16 21 31 31 12 19 24 18 16 39 39 6 8 15 33 24 10 33 10 8 25 22 16 9 11 12 25 20 32 9 6 20 18 16 12 12 28 14 26 12 10 26 10 37 11 19 9 26 10 23 12 11 9 15 20 10 21 19 12 4 8 14 26 17 20 21 18 14 10 11 5 19 24 26 32 24 27 14 6 5 14 28 15 20 7 6 16 12 15 3 5 23 18 10 9 11 29 34 38 21 6 18 7 8 23 11 15 10 38 14 7 7 3 3 6 11 12 9 9 11 5 2 3 1 2 5 5 6 14 18 16 10 7 5 6 3 3 5 7 5 3 4 5 7 5 5 16 13 25 10 9 7 12 26 17 5 4 5 3 4 12 16 15 17 3 4 18 8 5 3 6 10 6 4 5 5 5 14 4 1 3 2 2 2 3 2 5 4 6 4 6 10 6 18 5 13 7 5 10 4 6 11 6 4 6 16 5 6 11 6 8 6 4 14 7 6 6 6 4 1 3 25 5 2 3 8 7 7 6 3 5 13 16 5 5 14 7 5 6 4 8 3 9 4

Alignment Information

BAC End 1

BAC End 2

seq1: chrX_47932245_47933365
seq2: B6Ng01-318G15.b_45_1166

seq1  GAATTCTCCACTGTCCCTTCCATTCAGGCCTGTTATACTTCCCTTGGACT  50
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GAATTCTCCACTGTCCCTTCCATTCAGGCCTGTTATACTTCCCTTGGACT  50

seq1  AACTTGCCCTCAAAGGGTAAACATGGTGGATGAAGGCAGAAAGAGGAGAA  100
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTTGCCCTCAAAGGGTAAACATGGTGGATGAAGGCAGAAAGAGGAGAA  100

seq1  AACTGGTGTAGTGGCTATTCCTGGTTGTCAACCTGACTATATTTGAAATG  150
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTGGTGTAGTGGCTATTCCTGGTTGTCAACCTGACTATATTTGAAATG  150

seq1  AACTACAATCCAGCATTGGAAGGCTCACCAGTGACCCTTATCTACAGGCT  200
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AACTACAATCCAGCATTGGAAGGCTCACCAGTGACCCTTATCTACAGGCT  200

seq1  TAGAAAGAGAAATTTCTGATCTAGATCTTGGTATGGAGATCTTGGGGCAC  250
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAGAAAGAGAAATTTCTGATCTAGATCTTGGTATGGAGATCTTGGGGCAC  250

seq1  AGTGACTATGGATTACTGAAGATAAAATTTCGGAGTTCAACGTCTTCTGG  300
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGTGACTATGGATTACTGAAGATAAAATTTCGGAGTTCAACGTCTTCTGG  300

seq1  GATGAAAGGTTTGGTAGAACACATTTAATCTAGGGTACACCTTCTCCTGG  350
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GATGAAAGGTTTGGTAGAACACATTTAATCTAGGGTACACCTTCTCCTGG  350

seq1  AGACAATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTTGCTCCTTCGC  400
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGACAATATAAGGACATTGGAAGAAGGGAGTCTAGCTCTTGCTCCTTCGC  400

seq1  CTACTTGCTGTGTGAGAATGAGTAACTCCTAGATCCTTGGACTTCCATTC  450
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CTACTTGCTGTGTGAGAATGAGTAACTCCTAGATCCTTGGACTTCCATTC  450

seq1  GCAGCTACTACTGAAACATTGTTGGGAATTGGGCTGCAGACTGTAAGTCA  500
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GCAGCTACTACTGAAACATTGTTGGGAATTGGGCTGCAGACTGTAAGTCA  500

seq1  TCAATAAATTACTTTACTATATAGAGACTATCCATAAATTCTGTGACTCT  550
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TCAATAAATTACTTTACTATATAGAGACTATCCATAAATTCTGTGACTCT  550

seq1  AGAGAACCCTGACAATACAACTGGGAAGCACGGACATCCTCTTTGAGATA  600
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  AGAGAACCCTGACAATACAACTGGGAAGCACGGACATCCTCTTTGAGATA  600

seq1  TAATTATCAACTGGCAAGTGTTTGTTTATTGATATTTTACTTAAGACAAA  650
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TAATTATCAACTGGCAAGTGTTTGTTTATTGATATTTTACTTAAGACAAA  650

seq1  GTTAAACCTACTCCTGTCCTCTGGGCATGGTAGCATGGACTTATTCTGGA  700
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  GTTAAACCTACTCCTGTCCTCTGGGCATGGTAGCATGGACTTATTCTGGA  700

seq1  ACTACCAGAGGAAAAGACAGAAACCTACTGGAAAGGCCCAGGCCATCCTG  750
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ACTACCAGAGGAAAAGACAGAAACCTACTGGAAAGGCCCAGGCCATCCTG  750

seq1  CCTCTTGTAGTTCACTAGGACCAGGGCTCAGCATAGTCCTTGGCTTCTAA  800
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CCTCTTGTAGTTCACTAGGACCAGGGCTCAGCATAGTCCTTGGCTTCTAA  800

seq1  ATCTGCTACCATATCTTTATCATGTAAAACTGACACAAAATTAAACATAT  850
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  ATCTGCTACCATATCTTTATCATGTAAAACTGACACAAAATTAAACATAT  850

seq1  CAAAATTTTATGAAAACCATTAAGTATCTGGAAAAGAAAAAATCAACAGT  900
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  CAAAATTTTATGAAAACCATTAAGTATCTGGAAAAGAAAAAATCAACAGT  900

seq1  TATAAAGATAGAAAAGGGAAAAACACTACATAACAGAACGAAAAGAGTCC  950
      ||||||||||||||||||||||||||||||||||||||||||||||||||
seq2  TATAAAGATAGAAAAGGGAAAAACACTACATAACAGAACGAAAAGAGTCC  950

seq1  CACCACC-TTGGGCCTCAGATTGGC-TTCACATGGAACATGTGACAAAAA  998
      ||||||| ||||||||||||||||| ||||||||||||||||||||||| 
seq2  CACCACCTTTGGGCCTCAGATTGGCTTTCACATGGAACATGTGACAAAA-  999

seq1  AATAAAATACAGTTGAAACTACTCAAAGCTGGGTAAAAGTTAGGACAGAC  1048
          ||||||||||| |||||||| ||||||||| ||||||| || ||||
seq2  ---TAAATACAGTTG-AACTACTC-AAGCTGGGT-AAAGTTAAGAAAGAC  1043

seq1  AGCAGGGC-ATAGT-GGTG-CACACCA-TTAATCCCAGCA-CTCCGGAGG  1093
      |||||| | ||||| |||| ||||||| ||||||| |||| ||||||| |
seq2  AGCAGGCCAATAGTGGGTGCCACACCATTTAATCCAAGCACCTCCGGA-G  1092

seq1  CAGAGGCAGGTGGATTTCTGAG--TTCGCT  1121
      | || ||| || ||||||||||  ||||||
seq2  CTGAAGCAAGTTGATTTCTGAGATTTCGCT  1122

BAC Information

Search Parameter

Search Result

BAC

BAC End Information

Alignment Information